ID: 1146955858

View in Genome Browser
Species Human (GRCh38)
Location 17:36936115-36936137
Sequence GAGGCGCGGCGCCGGCGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146955858_1146955867 -1 Left 1146955858 17:36936115-36936137 CCCCCGCGCCGGCGCCGCGCCTC No data
Right 1146955867 17:36936137-36936159 CCGGTCTCCCCGCCCCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146955858 Original CRISPR GAGGCGCGGCGCCGGCGCGG GGG (reversed) Intergenic
No off target data available for this crispr