ID: 1146955858 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:36936115-36936137 |
Sequence | GAGGCGCGGCGCCGGCGCGG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1146955858_1146955867 | -1 | Left | 1146955858 | 17:36936115-36936137 | CCCCCGCGCCGGCGCCGCGCCTC | No data | ||
Right | 1146955867 | 17:36936137-36936159 | CCGGTCTCCCCGCCCCCATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1146955858 | Original CRISPR | GAGGCGCGGCGCCGGCGCGG GGG (reversed) | Intergenic | ||