ID: 1146955867

View in Genome Browser
Species Human (GRCh38)
Location 17:36936137-36936159
Sequence CCGGTCTCCCCGCCCCCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146955854_1146955867 13 Left 1146955854 17:36936101-36936123 CCGGTCCACTCCTTCCCCCGCGC No data
Right 1146955867 17:36936137-36936159 CCGGTCTCCCCGCCCCCATCAGG No data
1146955856_1146955867 8 Left 1146955856 17:36936106-36936128 CCACTCCTTCCCCCGCGCCGGCG No data
Right 1146955867 17:36936137-36936159 CCGGTCTCCCCGCCCCCATCAGG No data
1146955858_1146955867 -1 Left 1146955858 17:36936115-36936137 CCCCCGCGCCGGCGCCGCGCCTC No data
Right 1146955867 17:36936137-36936159 CCGGTCTCCCCGCCCCCATCAGG No data
1146955861_1146955867 -4 Left 1146955861 17:36936118-36936140 CCGCGCCGGCGCCGCGCCTCCGG No data
Right 1146955867 17:36936137-36936159 CCGGTCTCCCCGCCCCCATCAGG No data
1146955852_1146955867 25 Left 1146955852 17:36936089-36936111 CCGAGGCGCTTCCCGGTCCACTC No data
Right 1146955867 17:36936137-36936159 CCGGTCTCCCCGCCCCCATCAGG No data
1146955859_1146955867 -2 Left 1146955859 17:36936116-36936138 CCCCGCGCCGGCGCCGCGCCTCC No data
Right 1146955867 17:36936137-36936159 CCGGTCTCCCCGCCCCCATCAGG No data
1146955857_1146955867 3 Left 1146955857 17:36936111-36936133 CCTTCCCCCGCGCCGGCGCCGCG No data
Right 1146955867 17:36936137-36936159 CCGGTCTCCCCGCCCCCATCAGG No data
1146955851_1146955867 26 Left 1146955851 17:36936088-36936110 CCCGAGGCGCTTCCCGGTCCACT No data
Right 1146955867 17:36936137-36936159 CCGGTCTCCCCGCCCCCATCAGG No data
1146955853_1146955867 14 Left 1146955853 17:36936100-36936122 CCCGGTCCACTCCTTCCCCCGCG No data
Right 1146955867 17:36936137-36936159 CCGGTCTCCCCGCCCCCATCAGG No data
1146955860_1146955867 -3 Left 1146955860 17:36936117-36936139 CCCGCGCCGGCGCCGCGCCTCCG No data
Right 1146955867 17:36936137-36936159 CCGGTCTCCCCGCCCCCATCAGG No data
1146955863_1146955867 -9 Left 1146955863 17:36936123-36936145 CCGGCGCCGCGCCTCCGGTCTCC No data
Right 1146955867 17:36936137-36936159 CCGGTCTCCCCGCCCCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146955867 Original CRISPR CCGGTCTCCCCGCCCCCATC AGG Intergenic
No off target data available for this crispr