ID: 1146957225

View in Genome Browser
Species Human (GRCh38)
Location 17:36942718-36942740
Sequence CGGGGAGGGCGCAGGACGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146957225_1146957238 17 Left 1146957225 17:36942718-36942740 CCTGACGTCCTGCGCCCTCCCCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 1146957238 17:36942758-36942780 AGAGCGAGTACTACGGGCCCGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1146957225_1146957240 19 Left 1146957225 17:36942718-36942740 CCTGACGTCCTGCGCCCTCCCCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 1146957240 17:36942760-36942782 AGCGAGTACTACGGGCCCGGGGG 0: 1
1: 0
2: 0
3: 0
4: 20
1146957225_1146957234 10 Left 1146957225 17:36942718-36942740 CCTGACGTCCTGCGCCCTCCCCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 1146957234 17:36942751-36942773 GATTACCAGAGCGAGTACTACGG 0: 1
1: 0
2: 0
3: 2
4: 35
1146957225_1146957235 11 Left 1146957225 17:36942718-36942740 CCTGACGTCCTGCGCCCTCCCCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 1146957235 17:36942752-36942774 ATTACCAGAGCGAGTACTACGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1146957225_1146957237 16 Left 1146957225 17:36942718-36942740 CCTGACGTCCTGCGCCCTCCCCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 1146957237 17:36942757-36942779 CAGAGCGAGTACTACGGGCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51
1146957225_1146957239 18 Left 1146957225 17:36942718-36942740 CCTGACGTCCTGCGCCCTCCCCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 1146957239 17:36942759-36942781 GAGCGAGTACTACGGGCCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146957225 Original CRISPR CGGGGAGGGCGCAGGACGTC AGG (reversed) Intronic