ID: 1146957225

View in Genome Browser
Species Human (GRCh38)
Location 17:36942718-36942740
Sequence CGGGGAGGGCGCAGGACGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146957225_1146957235 11 Left 1146957225 17:36942718-36942740 CCTGACGTCCTGCGCCCTCCCCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 1146957235 17:36942752-36942774 ATTACCAGAGCGAGTACTACGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1146957225_1146957238 17 Left 1146957225 17:36942718-36942740 CCTGACGTCCTGCGCCCTCCCCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 1146957238 17:36942758-36942780 AGAGCGAGTACTACGGGCCCGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1146957225_1146957234 10 Left 1146957225 17:36942718-36942740 CCTGACGTCCTGCGCCCTCCCCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 1146957234 17:36942751-36942773 GATTACCAGAGCGAGTACTACGG 0: 1
1: 0
2: 0
3: 2
4: 35
1146957225_1146957240 19 Left 1146957225 17:36942718-36942740 CCTGACGTCCTGCGCCCTCCCCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 1146957240 17:36942760-36942782 AGCGAGTACTACGGGCCCGGGGG 0: 1
1: 0
2: 0
3: 0
4: 20
1146957225_1146957239 18 Left 1146957225 17:36942718-36942740 CCTGACGTCCTGCGCCCTCCCCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 1146957239 17:36942759-36942781 GAGCGAGTACTACGGGCCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 25
1146957225_1146957237 16 Left 1146957225 17:36942718-36942740 CCTGACGTCCTGCGCCCTCCCCG 0: 1
1: 0
2: 0
3: 10
4: 187
Right 1146957237 17:36942757-36942779 CAGAGCGAGTACTACGGGCCCGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146957225 Original CRISPR CGGGGAGGGCGCAGGACGTC AGG (reversed) Intronic
900109468 1:999472-999494 GGGGGAGGGCGCGGGACCCCCGG - Intronic
900139444 1:1133431-1133453 CGGGCAGGGCGCAGGGCGAGGGG - Intergenic
900586977 1:3437296-3437318 CGGGGAAGGCAGAGGACGCCAGG - Exonic
901663574 1:10813998-10814020 CGGGGAGGGCGCTGGCACTCTGG - Intergenic
903164094 1:21509183-21509205 CGGGGCGGGCGAGGGACGCCAGG + Intergenic
903811434 1:26036911-26036933 TGGGGAGGGCGCTGGATGCCAGG + Intergenic
904751065 1:32741766-32741788 CGGGCGGGGCGCAGGCCGGCGGG - Intergenic
905630124 1:39513911-39513933 CAGGGAGGGAGCAGGACACCTGG + Intronic
905667635 1:39772279-39772301 CAGGGAGGGAGCAGGACACCTGG - Intronic
906224952 1:44114038-44114060 GGGGGAGGAGGCAGGACCTCAGG + Intergenic
907170575 1:52459651-52459673 CGAGGCGGGCGGAGGAGGTCAGG + Intronic
908354960 1:63319857-63319879 CGGCGCGGGCGCGGGACGTCGGG + Intergenic
910188874 1:84574541-84574563 CGGGGCGGGCGTGGGAGGTCGGG + Intergenic
910773393 1:90851611-90851633 TGGGGCGGGCGCAGGACTGCAGG - Intergenic
912384405 1:109264104-109264126 CGTGGAGGGCACAGGGCTTCAGG + Exonic
914899912 1:151706398-151706420 CTGGGAGGGCTCAAGAAGTCAGG - Intronic
919763893 1:201114474-201114496 CGGAGGGGACGCAGGACGCCCGG + Exonic
920021275 1:202958268-202958290 CGGGGAGGGCGCTGAAGATCGGG - Exonic
920044790 1:203126351-203126373 GGGGGAGTAGGCAGGACGTCAGG + Intronic
920049295 1:203153681-203153703 TGGGGAGGGGGCAGGATGTCAGG - Intronic
921068979 1:211643333-211643355 CGGGGAGGCCACAGGACAGCCGG - Intergenic
1062824480 10:557812-557834 GGGGGAGGGGGCAGGAAGGCAGG + Intronic
1064418248 10:15168752-15168774 CGGGGAGGGGGCGGGACGGAGGG - Intergenic
1067692306 10:48509643-48509665 CGGGGAGGGCCCAGCGAGTCTGG - Intronic
1073717797 10:106127873-106127895 TGGGGAGGGAGCAGGGCATCAGG - Intergenic
1074371713 10:112905763-112905785 CAGGGAGGGTGCAGGAGGTAAGG - Intergenic
1075616134 10:123891866-123891888 CGGGGCGGGCGCAGGGGGGCCGG + Intronic
1076700409 10:132269958-132269980 AGGGGAGGGCTCAGGTCGTCAGG - Intronic
1076781020 10:132724658-132724680 CAGGGAGGCCCCAGGACGACAGG + Intronic
1076781067 10:132724875-132724897 CGGGGAGGCCCCAGGATGACAGG + Intronic
1076781081 10:132724945-132724967 CGGGGAGACCCCAGGACGACAGG + Intronic
1076784463 10:132742954-132742976 CGGGGCAGGCGCAGGCCGGCTGG - Intronic
1077061341 11:619092-619114 CTGGGAGGGCTCAGGGGGTCTGG + Exonic
1077179614 11:1206525-1206547 CTGGGAGGCCGCAGTGCGTCCGG + Intergenic
1077204537 11:1336323-1336345 GGGGGAGGGGGGAGGACGGCGGG - Intergenic
1081481115 11:43490241-43490263 TGGAGAGGACCCAGGACGTCTGG - Exonic
1082774615 11:57235820-57235842 CGGGGAGGGCCGAGGGCGCCAGG + Exonic
1089392494 11:118111701-118111723 CAGGGAGGAGGCAGGAAGTCAGG - Intronic
1089397605 11:118146079-118146101 CGGGGAGGGCGCTGGACCCGCGG + Intronic
1090636648 11:128694140-128694162 CAGGGAGGGCCCAGGGCGCCAGG + Exonic
1099439994 12:82687378-82687400 CGGGGAGGACGCAGGAGCTGCGG + Exonic
1102546818 12:113663370-113663392 AGGGGAGGCCTCAGGAGGTCAGG - Intergenic
1109062126 13:57632709-57632731 GGCGGAGGGCGCAGCAAGTCGGG + Exonic
1113546382 13:111154068-111154090 CGCGGAGGAGGCAGGAGGTCCGG - Intronic
1113696609 13:112350512-112350534 CTGGGAGGTGGCAGGAGGTCAGG - Intergenic
1113758509 13:112831349-112831371 CGGGCAGGGCACAGCAAGTCAGG - Intronic
1113889579 13:113728834-113728856 CGGGGAGGGCACAGCCCGGCTGG + Intronic
1121860252 14:97310559-97310581 AGGGGAGGGCACAGGACGGGAGG - Intergenic
1122325926 14:100880635-100880657 CGGGGAGGCCAGGGGACGTCGGG + Exonic
1122623721 14:103073832-103073854 AGGGCAGGGCCCAGGATGTCAGG + Intergenic
1122904400 14:104795313-104795335 CGGGGAGGGCGCGGGGCGCGCGG - Intronic
1124118150 15:26866976-26866998 GGGGGAGGGCGCAGGGCCCCCGG - Exonic
1124619736 15:31266882-31266904 GGGGGAGGGGGCAGGGCGTGAGG - Intergenic
1129029082 15:72605513-72605535 TTGGGAGGGGGCAGGAGGTCAGG - Intergenic
1132655337 16:1039629-1039651 GGGGCAGGGAGCAGGATGTCTGG - Intergenic
1132889353 16:2196382-2196404 CGGTGAAGGCGGAGGACGTAGGG - Exonic
1133031512 16:3013425-3013447 GGGGCAGGGCGCAGGACACCAGG - Exonic
1136227767 16:28870457-28870479 CGGGGAGGGCCCAGGATATGGGG + Intronic
1136460500 16:30407561-30407583 CGGGGAGGGGGCGGGACCGCAGG - Exonic
1136926642 16:34381085-34381107 CGGGGCCAGCGCAGGAGGTCTGG - Intergenic
1136977932 16:35030722-35030744 CGGGGCCAGCGCAGGAGGTCTGG + Intergenic
1138179034 16:54930224-54930246 CGCCCAGGGCGCAGGAAGTCCGG - Intergenic
1139576734 16:67846891-67846913 CGGGGCGGGCGAAGGAAGGCAGG + Exonic
1142245247 16:88967371-88967393 CGGGGACGGGGCAGGATGCCTGG + Intronic
1142395353 16:89828580-89828602 CGCGGCGGGCGCAGGGCGGCCGG + Exonic
1143500245 17:7334744-7334766 CTGGGTGGGAGCAGGACCTCAGG - Intergenic
1146957225 17:36942718-36942740 CGGGGAGGGCGCAGGACGTCAGG - Intronic
1147659585 17:42110473-42110495 CAGGGAGGGCGCAGGAAATGAGG + Intronic
1148028143 17:44602283-44602305 GGGGGAGGGCGCAGGGGGTGGGG + Intergenic
1149470897 17:56914230-56914252 CGGGCTGGGCGCGGGACGCCGGG + Intergenic
1149806122 17:59619786-59619808 CGCGGCGGGCGCAGGAATTCGGG - Intronic
1150211077 17:63441842-63441864 CGGGGAGGACGCAGGAGGACTGG - Intronic
1150600132 17:66643826-66643848 TTGGGATGGGGCAGGACGTCAGG + Intronic
1151516245 17:74598044-74598066 ATGGGAGGGGGCAGGACTTCAGG - Intergenic
1151880908 17:76893865-76893887 CAGGGTGGGGGCAGGACATCAGG - Intronic
1151894172 17:76969039-76969061 CGGGGAGGGCGTCGGGGGTCGGG + Intergenic
1152287924 17:79423200-79423222 CGGGGAGACCGCAGGACGTGAGG - Intronic
1152335481 17:79698222-79698244 CGGGGAGGGAGCAGGACACGTGG - Intergenic
1152728272 17:81958256-81958278 CAGGGAGGAGGCAGGACGGCAGG - Intronic
1153024262 18:658646-658668 CGGGGTGGGCACAGGACGTTAGG + Intronic
1156253820 18:35376950-35376972 CGCGGTGGGCGCGGGAGGTCGGG - Intronic
1159772300 18:72560200-72560222 GAGGGAGGGCGCAGGATGGCTGG + Intronic
1161362646 19:3859623-3859645 GGTGGAGGGCGCAGGGCCTCAGG + Intronic
1161672593 19:5622489-5622511 CGGGGGTGGCGCAGGAGGCCCGG - Intronic
1161851393 19:6739689-6739711 CGGGGAGGGCGGCGGGCGGCGGG + Exonic
1162440742 19:10690617-10690639 CGGGGAGGGAGGAGGAGCTCTGG + Exonic
1163548426 19:17952294-17952316 CGGGCAGGGCGCAGGGACTCCGG + Intronic
1164693978 19:30229639-30229661 CGGGGAGAGCCCAGGGCTTCTGG + Intronic
1166678489 19:44753803-44753825 TGGGGAGGGGGCAGGAAGGCGGG + Intronic
1166893780 19:46010442-46010464 CTGGGAGAGCGGAGAACGTCAGG + Intronic
1167252065 19:48404707-48404729 CAGGGAGGGAGGAGGATGTCAGG - Intronic
1167489212 19:49782136-49782158 GGGGGAGGGGGCTGGAGGTCTGG + Intronic
1167738824 19:51312032-51312054 CGGGGAGGCCCCGGGACGCCGGG + Intronic
925887749 2:8407751-8407773 AGGGCAGGTCACAGGACGTCTGG + Intergenic
927696050 2:25240518-25240540 CGGGGAGGGCACGGGAAGACAGG + Intronic
927751306 2:25673225-25673247 CGGGGAGGGCGCGGGGAGCCGGG - Intronic
932428942 2:71661956-71661978 AGGGGCTGGCGCAGGACCTCAGG + Intronic
932735217 2:74249656-74249678 AGGGCAGGGAGCAGCACGTCAGG + Intronic
934907393 2:98217133-98217155 CAGGGAGGGGGCAGGAGGACAGG - Intronic
935387231 2:102512982-102513004 AGGGGAGGACCCAGCACGTCAGG + Intronic
935568903 2:104638452-104638474 CGGGGAGGGCAAAGGAGGTCTGG - Intergenic
937906967 2:127057151-127057173 CGGGGAGTGTGGAGGACGTGTGG - Intronic
948062863 2:235054401-235054423 CGAGGAGGGAGCAGGACCTGGGG - Exonic
948822049 2:240554986-240555008 CGCTGAGGGCGCAGGACCTGAGG - Exonic
948934045 2:241150698-241150720 CGGGGGAGGCGCTGGACCTCGGG + Intronic
1171209332 20:23304774-23304796 CGGGGAGGGTGGATGCCGTCGGG - Intergenic
1175921954 20:62454349-62454371 CGGGGAGAGGGCAGGACCCCCGG + Intergenic
1175974076 20:62701696-62701718 CGAGGAGGGCACTGGATGTCTGG - Intergenic
1180188362 21:46151375-46151397 CGGGGACCGCGCAGGTCGGCAGG - Intronic
1180968332 22:19802028-19802050 CGGGGAAGGCGCTGGCTGTCTGG - Exonic
1183008899 22:34928585-34928607 CGGGCAGTGGGCAGGACCTCTGG + Intergenic
1183204617 22:36410128-36410150 GGTGGAGCGCGCAGGACTTCCGG - Intergenic
1183383716 22:37503230-37503252 CAGGGAGGGGGCAGGAGGTGAGG + Intronic
1183616755 22:38950409-38950431 AGGGGATGGCGCAGGAGGGCAGG + Intergenic
1183961363 22:41413692-41413714 CGGGGAGGGCAAAGGGCGTGCGG + Intergenic
1185098745 22:48826320-48826342 CGGGGAGGACGCAGGGAGCCCGG - Intronic
1185370542 22:50459007-50459029 TGGAGAGCGGGCAGGACGTCAGG + Intronic
1185402327 22:50625530-50625552 CGGGGAGGGGTCAGCAGGTCGGG + Intronic
949743617 3:7263986-7264008 TGGGGAGGGCGCAGGCAGGCTGG + Intronic
950921777 3:16702373-16702395 TGGGGTGGGAGCAGGACGTGGGG + Intergenic
953797185 3:45995029-45995051 CGGGGAGGGGGGAGGATGGCGGG - Intronic
961475359 3:127142568-127142590 CGGGGAGGGAGGAGGAAGCCAGG + Intergenic
961532552 3:127548036-127548058 TGGGGGGGCCGCAGAACGTCGGG + Intergenic
962629331 3:137259941-137259963 GGGGGAGTGAGCAGGAAGTCTGG - Intergenic
962810476 3:138955246-138955268 CAGGGAGAGAGCAGGAAGTCTGG + Intergenic
965404122 3:168249497-168249519 CGAGGAGGGCGCAGGGCGTGGGG + Intergenic
966261578 3:177984852-177984874 CGGGGAGGCCCCAAGAGGTCAGG - Intergenic
968512589 4:1002171-1002193 CGGGGGGCGCGCAGGGCGTTGGG - Intronic
968657031 4:1783105-1783127 GGGGGGGGGTGCAGGGCGTCTGG + Intergenic
969714303 4:8860998-8861020 CGGGGAGGGGGCGGGGCGCCCGG + Intronic
969720949 4:8892870-8892892 CGGGGAGGGGGCAGGCGGCCGGG - Intergenic
973759013 4:54100388-54100410 CAGCGAGGGCGCAGGCCGTGAGG - Exonic
975563112 4:75725281-75725303 GAGGGAGGGAGCAGGACTTCAGG - Intronic
975983598 4:80184282-80184304 CGGGGCGGGGGCGGGACGCCGGG - Intronic
981920470 4:150079454-150079476 AGGGGAGGGCGCCGCACGGCAGG + Intronic
983939817 4:173527298-173527320 CGGGCTGGCCGCAGCACGTCTGG - Exonic
985520107 5:370254-370276 CAGCGAGGGCCCAGGAGGTCGGG - Intronic
985660862 5:1155923-1155945 CGGGGCGGGCGCGGGAGGCCGGG + Intergenic
985714242 5:1446537-1446559 CGGGGCGGGCGCAGGGGGTGGGG - Intergenic
985936958 5:3104792-3104814 CGGGGAGCCCGCAGGACTCCTGG - Intergenic
986233575 5:5887227-5887249 CGGGGAGGTCCCGGGACGGCAGG - Intergenic
998142852 5:139709764-139709786 CGGGGTGGGGGCAGGAAGTTGGG - Intergenic
1002065722 5:176650754-176650776 TGGGGAGGTCGCAGGAGGTGGGG + Intronic
1002461197 5:179374723-179374745 CAGAGAGCACGCAGGACGTCAGG + Intergenic
1004204131 6:13575194-13575216 CGGGGAGGCCGCATGCAGTCTGG + Intronic
1005816198 6:29554611-29554633 CGGGGAGGGCACTGGTCATCTGG - Intergenic
1006043273 6:31271920-31271942 CGGCGAGGGCGCAGGACCCGGGG - Intronic
1006606301 6:35259889-35259911 CCGGGCGGGCGCAGGACCCCGGG + Intronic
1007428753 6:41764192-41764214 CAGGCAGGGTGCAGGACATCAGG - Intergenic
1012450617 6:99349730-99349752 CGGGGAGGGGGCAGGGCGCGGGG - Intronic
1016772797 6:147870742-147870764 GGGAGAGGGGGCAGGAAGTCGGG + Intergenic
1019621259 7:1993289-1993311 CAGGGAGGGCACAGGGCTTCTGG + Intronic
1023842373 7:44104619-44104641 CGGGGAGGGCGCGGGGGGTCAGG - Exonic
1023876109 7:44287115-44287137 GGGGGAAGGCGCAGGAGGGCTGG + Intronic
1025230606 7:57201356-57201378 TGGGGAGGGGGCAGCAGGTCAGG + Intergenic
1025928913 7:65979930-65979952 CGGGGAGGGGGCTGCAGGTCAGG + Intronic
1029238807 7:99144064-99144086 CGGCGAGGGCGGCGGGCGTCCGG - Exonic
1029307149 7:99628776-99628798 TGGGGAAGGCGCAGGACATCTGG + Intronic
1029619173 7:101679237-101679259 CGGGGAGGGCGCATGAGCTAGGG + Intergenic
1030714320 7:112790441-112790463 CGGGGAGGGGGCCGGGCCTCGGG - Exonic
1033352225 7:140570745-140570767 GGGGCAGGGCACAGGGCGTCTGG - Intronic
1034306688 7:150049214-150049236 CGGGGAGGACGCGGGAGGGCCGG - Intergenic
1034494115 7:151409994-151410016 CGGGGAGGGCGCGGGGCGCTCGG - Intronic
1034800157 7:154051429-154051451 CGGGGAGGACGCGGGAGGGCCGG + Intronic
1034911566 7:155002666-155002688 CGGGGTGGGCGCGGGAGGCCCGG - Intronic
1034958464 7:155350330-155350352 CGGGGAGACCGCAGGAAGCCGGG - Intergenic
1034958479 7:155350366-155350388 CGGGGAGACCGCAGGAAGCCGGG - Intergenic
1034958524 7:155350474-155350496 CGGGGAGACCGCAGGAAGCCGGG - Intergenic
1034958554 7:155350546-155350568 CGGGGAGACCGCAGGAAGCCGGG - Intergenic
1034958584 7:155350618-155350640 CGGGGAGACCGCAGGAAGCCGGG - Intergenic
1034958614 7:155350690-155350712 CGGGGAGACCGCAGGAAGCCGGG - Intergenic
1034958629 7:155350726-155350748 CGGGGAGACCGCAGGAAGCCGGG - Intergenic
1034977619 7:155457626-155457648 CGGCGAGGGCGGCGGACGGCCGG + Intergenic
1035247045 7:157569375-157569397 AGGGGAGGGCGCTGGGCGGCTGG + Intronic
1036929955 8:12946521-12946543 CACGGAGGGCGAAGGACCTCAGG + Intronic
1047454611 8:124998117-124998139 CAGGGAGGGCGCAGGAGCTGGGG + Intergenic
1048304326 8:133273056-133273078 CGGGCAGGGCTCTGGAGGTCTGG - Intronic
1049499858 8:142956009-142956031 TGGGGAGGGGGCAGGACTACAGG + Intergenic
1057596564 9:96419322-96419344 CGGGGCGGGCAGAGGACGTTGGG - Intergenic
1059129087 9:111725507-111725529 CAGGGAGGGCGGGGGAGGTCAGG + Intronic
1059609759 9:115879629-115879651 CGGGGAAGGAGCATGAGGTCAGG - Intergenic
1061208963 9:129179664-129179686 CGGTGAAGCAGCAGGACGTCTGG - Intergenic
1061301209 9:129705934-129705956 CGGGGAGGCCCCAAGAGGTCAGG - Intronic
1061596798 9:131635737-131635759 CGGGGAGGGGGCAGCAGGTTGGG + Intronic
1061678777 9:132232414-132232436 CCCTGAGGGGGCAGGACGTCTGG - Intronic
1062396861 9:136356071-136356093 CAGGGAGGGGGCAGGGCGTGGGG + Intronic
1062500221 9:136848964-136848986 CGGGGAGGGGGGAGGCCTTCGGG + Intronic
1062522753 9:136965203-136965225 GGCGGAGGGCGGAGGGCGTCAGG + Intergenic
1187403611 X:18983968-18983990 CCGCGTGGGCGCGGGACGTCGGG + Exonic
1189309426 X:40009292-40009314 GGGGGAGGGCGGGGGACGCCAGG + Intergenic
1190580348 X:51887639-51887661 CGGGGAGGGGGCAGGGGGGCGGG - Intronic
1190669696 X:52729003-52729025 CGGGGAGGGCGCAGGGGGGAGGG + Intergenic
1192224106 X:69216681-69216703 CAGAGAGGGGGCAGGACTTCTGG + Intergenic
1192258372 X:69485703-69485725 CAGAGAGAGGGCAGGACGTCTGG - Intergenic
1192496183 X:71617913-71617935 GGGGGGGGGCGCAGGAAGTTGGG - Intronic
1200052445 X:153442193-153442215 CGGGGAGGGCGCCCGAGGCCAGG + Intergenic
1201763549 Y:17561390-17561412 GGGGAAGGGCACAGGACATCAGG - Intergenic
1201838004 Y:18344600-18344622 GGGGAAGGGCACAGGACATCAGG + Intergenic