ID: 1146957706

View in Genome Browser
Species Human (GRCh38)
Location 17:36946422-36946444
Sequence GCCAGCCCGGAGAAGTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146957706_1146957713 5 Left 1146957706 17:36946422-36946444 CCACCCAACTTCTCCGGGCTGGC No data
Right 1146957713 17:36946450-36946472 CTGGTAAGCTGCTCTAGGTGAGG No data
1146957706_1146957716 14 Left 1146957706 17:36946422-36946444 CCACCCAACTTCTCCGGGCTGGC No data
Right 1146957716 17:36946459-36946481 TGCTCTAGGTGAGGCACTTGGGG No data
1146957706_1146957715 13 Left 1146957706 17:36946422-36946444 CCACCCAACTTCTCCGGGCTGGC No data
Right 1146957715 17:36946458-36946480 CTGCTCTAGGTGAGGCACTTGGG No data
1146957706_1146957717 29 Left 1146957706 17:36946422-36946444 CCACCCAACTTCTCCGGGCTGGC No data
Right 1146957717 17:36946474-36946496 ACTTGGGGAAGTATTACCTGTGG No data
1146957706_1146957711 0 Left 1146957706 17:36946422-36946444 CCACCCAACTTCTCCGGGCTGGC No data
Right 1146957711 17:36946445-36946467 TGCCGCTGGTAAGCTGCTCTAGG No data
1146957706_1146957714 12 Left 1146957706 17:36946422-36946444 CCACCCAACTTCTCCGGGCTGGC No data
Right 1146957714 17:36946457-36946479 GCTGCTCTAGGTGAGGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146957706 Original CRISPR GCCAGCCCGGAGAAGTTGGG TGG (reversed) Intergenic
No off target data available for this crispr