ID: 1146960656

View in Genome Browser
Species Human (GRCh38)
Location 17:36973778-36973800
Sequence ATAGCCAAGCAGGCTGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 449}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146960651_1146960656 -3 Left 1146960651 17:36973758-36973780 CCTTATATAAAATTTAGAAAATA 0: 1
1: 1
2: 24
3: 195
4: 1924
Right 1146960656 17:36973778-36973800 ATAGCCAAGCAGGCTGGGGACGG 0: 1
1: 0
2: 3
3: 45
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146960656 Original CRISPR ATAGCCAAGCAGGCTGGGGA CGG Intronic
900266726 1:1760939-1760961 GTTGCCAAGGAGGCTGGGGCGGG - Intronic
901113128 1:6815492-6815514 GTACCCAAGAAGGCTGGGCATGG - Intronic
901120725 1:6890860-6890882 CTGGCCAAGCAGGCTGGGCAGGG - Intronic
901187585 1:7385064-7385086 ACAGGCAAGCAGGATGGGCAGGG - Intronic
901406363 1:9049431-9049453 ATAGACAAACAGGCCGGGCATGG + Intronic
901618124 1:10558296-10558318 ATATACAAGCAGGCCGGGCACGG - Intronic
902384182 1:16067134-16067156 GGAGCCAGGCGGGCTGGGGAGGG - Intronic
902390040 1:16098313-16098335 ATAACCAAGCAGGCTGGGCATGG + Intergenic
902429266 1:16350454-16350476 ATAGAAAAGGAGGCTGGGCACGG + Intronic
902568716 1:17332793-17332815 CTATCCAGGCAGGCTGGGGAGGG + Intronic
902604037 1:17558902-17558924 AAAGCCGAGGAAGCTGGGGAAGG - Intronic
903235347 1:21946865-21946887 CTAGCCTGGCAAGCTGGGGAGGG + Intergenic
903941951 1:26938096-26938118 ACAGCCAACCAGGGTGGGGAGGG - Intronic
904415732 1:30360081-30360103 ACAGCCACGCAGGGAGGGGAGGG + Intergenic
904697478 1:32338286-32338308 ACATCCCAGGAGGCTGGGGAGGG + Intergenic
906647211 1:47483786-47483808 ATGACCAAGCAGGCTGAGGATGG + Intergenic
906997741 1:50815731-50815753 ATAGCCATTCTGGCTGGGCACGG + Intronic
908014847 1:59820440-59820462 AGTGCAAAGAAGGCTGGGGAAGG - Intronic
908258865 1:62324015-62324037 TTAGCCAGGCAGGCTGGGCATGG + Intergenic
908295345 1:62707225-62707247 ATAGGGAAGGGGGCTGGGGAGGG + Intergenic
909670332 1:78181643-78181665 TTAGCCAAAAAGGCAGGGGATGG - Intergenic
910158387 1:84246353-84246375 ATAACCAGGAAGGCTGAGGAGGG + Intergenic
911313205 1:96323276-96323298 ATAGTCAAAGAGGCTGGGCATGG + Intergenic
911855017 1:102865614-102865636 ATAGCCAAGCAAACTTTGGAAGG - Intergenic
912118859 1:106442726-106442748 CTAGGCAAACAGGCTGGGGGCGG - Intergenic
912491203 1:110063809-110063831 GGTGGCAAGCAGGCTGGGGATGG - Intronic
915084416 1:153375336-153375358 ATGGCTAAGCAGGCCGGGTACGG - Intronic
915105481 1:153532995-153533017 CTAGCCCTGCAGGTTGGGGAGGG + Intergenic
915507759 1:156368278-156368300 ACAGGGAAGCAGGCTGGGCAGGG - Intergenic
915982631 1:160430677-160430699 ATTGCCAGGAAGGCTGGGGTAGG + Intergenic
916160299 1:161905214-161905236 ATAGCACAGCAGGGTGGGAAGGG - Intronic
916788654 1:168105276-168105298 TTAAACAAGCAGGCTGGGGCAGG + Intronic
917871830 1:179249035-179249057 AGAGCCAAACTGGCTGGGCATGG - Intergenic
918526458 1:185470129-185470151 ATAGCCAAAGAGGTGGGGGAGGG - Intergenic
919549806 1:198970934-198970956 ATGGCCAAGCTGGATGGGGTTGG + Intergenic
919766567 1:201131398-201131420 AGAGCCAAGTAGGCTGAGCATGG + Intergenic
919794231 1:201311610-201311632 CTAGCCACACAAGCTGGGGAGGG - Intronic
920323428 1:205142323-205142345 AGAGCCATGGTGGCTGGGGAGGG + Intergenic
920389787 1:205592240-205592262 GTAGGCCAGCATGCTGGGGAAGG - Exonic
920396737 1:205652124-205652146 TTAGCCAAGCAGGCCGGGTGCGG + Intergenic
920903146 1:210132363-210132385 ATGTCCAAGCAGGGTGAGGAGGG - Intronic
922295531 1:224246743-224246765 AGAGCCAAGAAGGCCGGGCATGG + Intronic
922675761 1:227547941-227547963 AGAGCCCAGCAGGCTGTGGTGGG - Intergenic
922811860 1:228420560-228420582 ATACCTAGGGAGGCTGGGGAAGG + Intergenic
923270015 1:232347081-232347103 ACAGCCAAGCAGGCTTGGACTGG - Intergenic
924207112 1:241724980-241725002 ATAGGGAGGCAGGCTGAGGAAGG - Intronic
924559689 1:245147345-245147367 ACAACAAAGCAGGCTGGGCACGG - Intergenic
1063959770 10:11297500-11297522 GGAGCCAAGCAGGATGGGGCTGG + Intronic
1064163498 10:12966366-12966388 AAAAACTAGCAGGCTGGGGAAGG - Intronic
1064237775 10:13592253-13592275 AAAGCCAAGAAGGCTGAGGCTGG - Intronic
1064426273 10:15232425-15232447 ATGGCGAAACAAGCTGGGGAAGG - Intronic
1065040172 10:21685630-21685652 GTAGCCAAAGAGGCTGGGCACGG - Intronic
1065773247 10:29096879-29096901 GTAGACAAGAAGGATGGGGATGG - Intergenic
1066100309 10:32111786-32111808 AGAGCCCAGCAGGGTGAGGATGG - Intergenic
1066368565 10:34799698-34799720 GCAGCCAAGCCGGCTGGGTACGG + Intronic
1066974104 10:42349212-42349234 TCAGCCAAGAAGGCTGGGCATGG + Intergenic
1067571776 10:47377000-47377022 ATGGCCAGGCAGGCTGCTGAAGG - Intronic
1068711720 10:60142126-60142148 ATAGCCAAGAAGTCAGTGGAAGG - Intronic
1069705545 10:70457014-70457036 AGAACTAAGCAGGCAGGGGAGGG - Intergenic
1069818759 10:71214765-71214787 TTGGCCAAGAAGGCTGGGGGTGG + Intronic
1070084872 10:73227373-73227395 ATGACCAAGCAGGCTGGGCATGG - Intronic
1071230119 10:83576633-83576655 ATGGCAAAGGAGGCTGGGCACGG - Intergenic
1071489563 10:86127118-86127140 CTAGCGAAGCAGGGTGGGAAGGG - Intronic
1074256891 10:111811950-111811972 ATATCTAAGGAGGCTTGGGAGGG - Intergenic
1074263872 10:111881738-111881760 ATAGAGAAGTGGGCTGGGGACGG + Intergenic
1074700148 10:116085556-116085578 ACAGCCATGCAGGCAGAGGAGGG + Intronic
1076143802 10:128100311-128100333 ATAGCCAGGCAGCCAGTGGAGGG - Intronic
1079130770 11:17745673-17745695 AAAGCCATGGAGGCTGGGGGAGG - Intronic
1079367126 11:19819279-19819301 GTAGGCAAGCAGGTTGGGAATGG + Intronic
1081013152 11:37841413-37841435 ACAACCAAGCAGGCTGGTCATGG + Intergenic
1081306857 11:41523062-41523084 ATTGCCAAGCACTTTGGGGAGGG - Intergenic
1083770838 11:64866403-64866425 ACTGCCTAGCAGGCTGGGCATGG + Intronic
1083860494 11:65417695-65417717 TTGGCCAAGGAGGGTGGGGAGGG + Intergenic
1084137850 11:67200505-67200527 AAAACCAAACAGGCTGGGCACGG - Intronic
1084147529 11:67273008-67273030 ATGGCCCAGCAGGCGGGGCACGG + Intronic
1084260958 11:67978305-67978327 ATATCCAAGAAGGCAGAGGATGG + Intergenic
1084288001 11:68144234-68144256 ATAGCCAGGCGGGCTGGGCGCGG + Intergenic
1084311579 11:68319356-68319378 TCAGCCAGGCAGGCTGGGCATGG - Intronic
1084613337 11:70218221-70218243 ATAGCTAGGCAGGTGGGGGAGGG + Intergenic
1085338001 11:75712050-75712072 GTAGCCAAGGGGCCTGGGGAGGG - Intergenic
1085405981 11:76262434-76262456 GTAGCCAAGGGGTCTGGGGAGGG - Intergenic
1085474486 11:76781379-76781401 AAAGCCCAGCAGGCTTGGGAGGG - Intergenic
1086686567 11:89740537-89740559 AGAGCCAAGGAGGCAGTGGAGGG - Intergenic
1087210939 11:95446152-95446174 ACAGCCAGGCATGCTGGCGATGG + Intergenic
1087929587 11:103961476-103961498 ATAGGGAAGCAGGCAGGTGAAGG + Intronic
1087985757 11:104677432-104677454 AAAGTCAAGCAGGCTGGGCATGG + Intergenic
1088124431 11:106406373-106406395 TCAGCCAAGAAGGCAGGGGATGG - Intergenic
1088409851 11:109522348-109522370 CTATACAAGCAGGCTGTGGATGG + Intergenic
1088687671 11:112298470-112298492 AGAGCAAAGCAGGCAGAGGAGGG - Intergenic
1089112284 11:116066309-116066331 ATAGTCAAGCAGGTTGGGTAAGG - Intergenic
1089552886 11:119294502-119294524 ATAGGTAAGCAGGCTGGGTGCGG + Intronic
1089613793 11:119684162-119684184 CTAGCCAAGCAGGCTGGAACTGG + Intronic
1091568743 12:1666007-1666029 AAAGCCAGGCAGGCCGGGGGTGG - Intergenic
1091764047 12:3106808-3106830 ATAGCCAGGAAGCCTAGGGAGGG - Intronic
1092364431 12:7865245-7865267 TTAGCCAGGCAGGCTGGGCACGG + Intronic
1093601515 12:21030613-21030635 ATAGCCAAGCAACCTTGAGAAGG - Intronic
1095275567 12:40278662-40278684 ATGGCTATGCAGGCTGTGGATGG + Intronic
1096075697 12:48802619-48802641 TTAGCCAGGCGGGCTGGGCATGG - Intergenic
1096187630 12:49592491-49592513 ATAACAAAACAGGCTGGGCATGG + Intronic
1096578904 12:52571853-52571875 TCAGCCCAGGAGGCTGGGGAGGG - Intronic
1096649074 12:53053121-53053143 AGAGCCAAGCAGGCAGGCCATGG - Intronic
1096780192 12:53987152-53987174 AGAGCGGAGCAGGCTGGGGGCGG + Intronic
1098028491 12:66230654-66230676 GGAGCCAAGTAGGGTGGGGAAGG + Intronic
1098230064 12:68364051-68364073 ATAGCAGAGCATGTTGGGGATGG - Intergenic
1101473580 12:105022107-105022129 ATCACCTAGCAGGCTGGGGAGGG + Exonic
1101616091 12:106338848-106338870 ATAGCCATTCAGGCTGGGCACGG + Intronic
1102245704 12:111354274-111354296 ATACCCTAGGAGGCTGGAGAAGG - Intergenic
1102624256 12:114221860-114221882 ATAGCCATGAAGCCAGGGGAAGG + Intergenic
1104417790 12:128609546-128609568 AAAGCCAAACAGGCTGTGCACGG - Intronic
1104501621 12:129291838-129291860 AGAGGCTAGGAGGCTGGGGAAGG + Intronic
1104641321 12:130469104-130469126 ATCGCCAAGCACGCCGGGCAGGG + Intronic
1105229722 13:18480993-18481015 TCAGCCAAGAAGGCTGGGCATGG + Intergenic
1105997462 13:25686143-25686165 AGGGCCATGCAGGCTTGGGAGGG + Intronic
1107303788 13:38995699-38995721 ATACCCATGTAGGCTGGGGGCGG + Intergenic
1107465771 13:40648707-40648729 ATAGCCAAGCAGGATGTCAAAGG + Intronic
1111534768 13:89588995-89589017 ACAGCAAAGCTGGCTGGGCATGG + Intergenic
1112016511 13:95335737-95335759 ATAGCCGGGCAGGCTGGGCACGG - Intergenic
1112545172 13:100361122-100361144 ATTGCCAAGCATTCGGGGGAGGG + Intronic
1112711262 13:102131475-102131497 ACAGCAGACCAGGCTGGGGAGGG - Intronic
1113455612 13:110446464-110446486 ATAGCCGAGCCGCCTGGCGAGGG - Intronic
1113826326 13:113257213-113257235 ATGACAAAGCAGGCTGGGCATGG - Intronic
1114045085 14:18868158-18868180 AAAGCCAAATAGGCTGGGTACGG + Intergenic
1114119126 14:19651310-19651332 AAAGCCAAATAGGCTGGGTACGG - Intergenic
1114423361 14:22602905-22602927 ATAACCAAGCAGCATGGTGAGGG + Intronic
1114491667 14:23106204-23106226 TTAGCCAGGCAGGCCGGGGGAGG - Intergenic
1115713209 14:36073124-36073146 ACACCCAAGCAGGATGAGGAAGG - Intergenic
1116942181 14:50801379-50801401 AAAGCAAAACAGGCTGGGCACGG - Intronic
1117033138 14:51696619-51696641 AAAGCTAGGCAGGCTGGGCATGG + Intronic
1121437264 14:93927980-93928002 AGACCCAAGCAGGCTGGGCGAGG + Intronic
1121896276 14:97650891-97650913 ATAGCTAAAGAGGTTGGGGAAGG + Intergenic
1121921723 14:97888275-97888297 ATGGACAAGCAGGCCTGGGATGG + Intergenic
1122619800 14:103049276-103049298 TCAGCCAAGCAGGCCGGGGGTGG - Intronic
1122871424 14:104640711-104640733 AAAGCCATCCATGCTGGGGATGG - Intergenic
1123408487 15:20039282-20039304 ATGGCCCTGCAGGCTGGGCATGG + Intergenic
1123496525 15:20832718-20832740 AGAGGCAAGCAGACTAGGGAGGG - Intergenic
1123553762 15:21406308-21406330 AGAGGCAAGCAGACTAGGGAGGG - Intergenic
1123590004 15:21843673-21843695 AGAGGCAAGCAGACTAGGGAGGG - Intergenic
1123753724 15:23380155-23380177 AAATCCAAGCGGGCTGGGCATGG + Intergenic
1124958435 15:34375914-34375936 ATATCAAAGAAGGCTGGGCATGG - Intergenic
1126050441 15:44680252-44680274 ACAGCTCAGCAGGCTGGTGATGG - Intronic
1126767923 15:52027416-52027438 AAATCCAAGCAGGAGGGGGAGGG - Intronic
1127076850 15:55335007-55335029 ATAGCTAAACAGGCTGGGCATGG - Intronic
1127265366 15:57356589-57356611 AAACCCAACCAGGCTGGGCATGG + Intergenic
1127662394 15:61112467-61112489 AAAGCCTAACAGGATGGGGACGG + Intronic
1127772606 15:62243583-62243605 ATGGCCAAGAAGGGTGGGGGCGG - Intergenic
1127957491 15:63865568-63865590 ATAGCCAGGCATGATGGCGAGGG - Intergenic
1128390762 15:67180939-67180961 AAGGCCAAGCAGGCGGGGCAGGG + Intronic
1128579338 15:68797911-68797933 ATGGCCAAACAGGCTAGGGGAGG + Intronic
1128754226 15:70170486-70170508 GAAGCCCAGCTGGCTGGGGAGGG - Intergenic
1128882618 15:71257424-71257446 ACAGCCAAGTTGGCTGGAGAGGG + Intronic
1129189755 15:73930450-73930472 CTGGCCTAGCAGGGTGGGGAGGG - Intronic
1129234759 15:74217479-74217501 ATAGCAGAGCAGGCAGGGAAGGG - Intergenic
1129608547 15:77036578-77036600 ATAGCCAGGCAGGCTGGGTGTGG + Intronic
1129702357 15:77775171-77775193 ATGGCCAAGGAGACTGGAGAGGG - Intronic
1129873608 15:78957601-78957623 ATACCCAAGGAGGCTGGGCACGG - Intergenic
1129977012 15:79831068-79831090 ATAGACTAGCCAGCTGGGGATGG + Intergenic
1130433182 15:83869636-83869658 AAAGCCCAGCAGGCTATGGATGG + Intronic
1130533066 15:84762464-84762486 AAAGCCCTTCAGGCTGGGGAGGG + Intronic
1131508881 15:93038103-93038125 AAAGCCCTGCAGGATGGGGAAGG + Intronic
1131690794 15:94825108-94825130 AGAGCCAAGCAGACTGTGGCAGG + Intergenic
1132104701 15:99054907-99054929 CAAACCAAGCAGGCAGGGGAGGG - Intergenic
1202962108 15_KI270727v1_random:133504-133526 AGAGGCAAGCAGACTAGGGAGGG - Intergenic
1132457302 16:31227-31249 ACAGCCCAGCAGGGAGGGGAGGG + Intergenic
1132539511 16:501929-501951 ATAGGCAAGGAGGCTGGGAGAGG + Intronic
1132539523 16:501965-501987 ATAGGCAAGGAGGCTGGGAGAGG + Intronic
1132715731 16:1289028-1289050 AGAGCCCATCAGGCAGGGGAGGG + Intergenic
1132805677 16:1774014-1774036 AGAGCCGAGCTGGCTGGAGAAGG + Intronic
1132948140 16:2544023-2544045 ATAGTAAAGCAGGCCGGGCACGG - Intronic
1133272693 16:4618200-4618222 ATAGCGGAGAGGGCTGGGGAGGG + Intronic
1134462654 16:14442869-14442891 AAATCCAAGCGGGCTGGGCATGG - Intronic
1134833624 16:17343757-17343779 AAAGCCAAGCACACTGGGTATGG - Intronic
1135094926 16:19556832-19556854 ATAGTCATGCTGGCTGGGTATGG + Intronic
1135383019 16:22009080-22009102 ATTGCCAAGCGGGCAGGGGATGG - Intronic
1136384190 16:29912382-29912404 TTAGCCAGGGGGGCTGGGGAGGG - Intronic
1136649451 16:31655345-31655367 TTAGCCAAGCATGATGGTGAGGG + Intergenic
1138350978 16:56346064-56346086 AGAGAAAGGCAGGCTGGGGATGG - Exonic
1138399035 16:56730588-56730610 GTAGGCAAGCAGGCAGGGCACGG - Intronic
1138419933 16:56892563-56892585 CTAGCCATGCAGGGTGGGGTGGG + Intronic
1138448594 16:57079536-57079558 ACAGGAAACCAGGCTGGGGATGG - Exonic
1138811931 16:60161251-60161273 ATAACAAAGGAGGCTGGGCACGG + Intergenic
1139014459 16:62673232-62673254 ATAGCCCAGCTGGCAGGGAATGG + Intergenic
1139938945 16:70591002-70591024 AGACCCGAGCAGGCTGGGGCCGG - Intronic
1140540297 16:75750691-75750713 ATAGGAAAGCAGGCTGGGAGAGG - Intronic
1140607873 16:76563068-76563090 GTAGCCATGCAGGCAGGGGTAGG - Intronic
1140715594 16:77722853-77722875 ACAGCCAAGCCGGCTGGGAAGGG - Intronic
1141000450 16:80302666-80302688 ATGGACAAGCAGGCTGGGCATGG - Intergenic
1141047998 16:80734542-80734564 ATAGGGAAGCAGGTTTGGGAAGG + Intronic
1141290759 16:82716287-82716309 ATGGAAAAGCAGGCTCGGGATGG - Intronic
1141326970 16:83069694-83069716 AGAGCCAATCAGGGTGAGGATGG - Intronic
1142239393 16:88938286-88938308 GTGGCCCGGCAGGCTGGGGATGG + Intronic
1143228258 17:5327055-5327077 ATAGCTAAACAGGCTGGGCACGG + Intronic
1143324737 17:6091458-6091480 ATGTCCAAGCAGGATAGGGAAGG + Intronic
1143428553 17:6861586-6861608 ATCTCCAAGAAGGCTGGGCATGG - Intergenic
1143779176 17:9220508-9220530 AGAGCCAAGCAGGATGTGGAGGG - Intronic
1143864259 17:9912439-9912461 ATGGACAAGAAGGCTGGGGCTGG - Intronic
1144106291 17:11988866-11988888 TTAGCCAAGCAGGCCGGGCATGG + Intronic
1145949061 17:28801551-28801573 ATAGTAAAACAGGCTGGGCATGG + Intronic
1146322760 17:31859286-31859308 AGCGCCAATCAGCCTGGGGAGGG + Exonic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146958727 17:36954034-36954056 AAAGCCAAGGGGGATGGGGAGGG - Intronic
1146960656 17:36973778-36973800 ATAGCCAAGCAGGCTGGGGACGG + Intronic
1148764415 17:50028861-50028883 ACAGCCAAGCACGCTGGGTTTGG + Intergenic
1148872743 17:50668342-50668364 CTAGCCCAGGATGCTGGGGATGG + Intronic
1149565104 17:57635676-57635698 CAAGCTCAGCAGGCTGGGGAAGG - Intronic
1149566580 17:57644690-57644712 AGATGCAAGCATGCTGGGGAAGG + Intronic
1149915948 17:60609381-60609403 AAAACCATGCAGGCTGGGCACGG - Intronic
1150025254 17:61667558-61667580 AAAGCCACTCAGGCTGGGGGCGG - Intergenic
1150146219 17:62771865-62771887 ATTGACAAGCAGGCTGGGGGTGG - Intronic
1150442612 17:65203443-65203465 ATAACCAGGGAGCCTGGGGAAGG - Intronic
1150456857 17:65313191-65313213 AAACCCAAGAACGCTGGGGAAGG - Intergenic
1150498664 17:65629260-65629282 ATAGCTAAACAGGCTGGGCAAGG - Intronic
1150994093 17:70296158-70296180 ATAGCCTGGCACGTTGGGGAAGG + Intergenic
1151312449 17:73301978-73302000 TTAGCCAGGCAGGCAGGGCATGG - Intronic
1151419135 17:73985848-73985870 CTAGCTATGCAGGCTGAGGACGG - Intergenic
1151657788 17:75503788-75503810 AGGGCCCAGCAGGCGGGGGAGGG - Intronic
1151979314 17:77499299-77499321 CTGGCCAAGCAGTCTGCGGATGG - Exonic
1152216544 17:79035958-79035980 CTATTCAAGCAGGCTGGGGATGG + Intronic
1153262256 18:3236000-3236022 ATGGCTGAGCAGACTGGGGAGGG + Intergenic
1154454439 18:14508401-14508423 AGAGGCAAGCAGACTAGGGAGGG - Intronic
1155050524 18:22143450-22143472 AAAACCAAGCAGGCTGGGTGTGG - Intergenic
1155311618 18:24529943-24529965 ATATGTAAGCAGGCTGGGCATGG + Intergenic
1156429669 18:37058420-37058442 ATAAACAAGTAGGCTGGGCATGG + Intronic
1156718586 18:40042261-40042283 ATAGCCAAGCTGCCTGGCAAAGG - Intergenic
1157449097 18:47772214-47772236 GGAGGCAAGGAGGCTGGGGAAGG + Intergenic
1157479635 18:48045160-48045182 ACAGCCAAGCAGGCAAGGGCCGG + Intronic
1157520794 18:48343883-48343905 AGACCAAAGCAGGCGGGGGAGGG - Intronic
1157800668 18:50618131-50618153 TTTGCCAGGCAGCCTGGGGAAGG - Intronic
1157811634 18:50701178-50701200 ATGGCCAAGGAGGATGGGGGTGG - Intronic
1160006338 18:75071810-75071832 TGAGCCCAGCAGGCTGTGGACGG + Intergenic
1160176817 18:76601636-76601658 GGGGCCAAGCAGGCTGGGCACGG - Intergenic
1160704568 19:524033-524055 ACAGCCAGGCAGGCTGAGGTGGG + Intergenic
1160943297 19:1630042-1630064 ATAGCCAGGCAGCTTGGAGAGGG - Intronic
1161284025 19:3459643-3459665 ACAGCCAGGCAGGAAGGGGAGGG + Intronic
1161495425 19:4583647-4583669 ACAGCCAAGAAGGCAGGGGAGGG - Intergenic
1161496844 19:4591206-4591228 GTCGCAGAGCAGGCTGGGGACGG - Intergenic
1161733636 19:5977617-5977639 ATAGGCAGCCAGGCCGGGGAAGG + Intronic
1162103987 19:8358810-8358832 ATACACAAACAGGCTGGGCAGGG - Intronic
1162306135 19:9875325-9875347 AGAGGCATGAAGGCTGGGGAAGG - Intronic
1162332705 19:10039922-10039944 TTAGCCAAGCTGGCTGGGCATGG + Intergenic
1162568000 19:11454586-11454608 ATAGCCGTTCAGGCTGGCGATGG + Exonic
1163164385 19:15485344-15485366 ATAGGCAACCAGGCTGGGCGCGG - Intronic
1163222485 19:15931466-15931488 AGATCCAAGCAGGCTGGAGTGGG + Intronic
1163317399 19:16550438-16550460 ATTGTCAATCAGGCTGGGCACGG + Exonic
1163767658 19:19172310-19172332 AGAGCGAAGCTGGCTGGGGCTGG + Intronic
1165658045 19:37550694-37550716 ATATCCAGGCATGCTGGCGAGGG - Intergenic
1165715694 19:38044423-38044445 TCAGCGAAGGAGGCTGGGGAGGG + Intronic
1166175978 19:41070310-41070332 ATAGCCATTCTGGCTGGGCACGG + Intergenic
1166540711 19:43603706-43603728 AGGGCCAAGCAGGCAGGGTAGGG + Intronic
1166552943 19:43678776-43678798 ATAGCAAAGAAGGCTGCTGAAGG - Intergenic
1167717585 19:51154002-51154024 AGAGCTATGCAGGCTGGGGCAGG - Intergenic
1168481641 19:56724919-56724941 ACAGCCAAGGCTGCTGGGGATGG + Intergenic
925085049 2:1101224-1101246 ACAGGCAAGCTGGCTGGGGGAGG - Intronic
925182637 2:1827025-1827047 AGAGCCCTGCAGGATGGGGAGGG - Intronic
925194871 2:1914771-1914793 ATAGGCGGGCAGGCTGTGGAGGG - Intronic
925791866 2:7497382-7497404 ATAGCAAAGAAGCCCGGGGAGGG + Intergenic
925847900 2:8050462-8050484 AAGCCCAAGCAGGCTGAGGAGGG - Intergenic
926008985 2:9393653-9393675 ATGGCCGAGCTGGCTGGGGGTGG - Intronic
926106303 2:10154181-10154203 ATTGCCAGGCAGGCTGGGCGTGG + Intronic
927640439 2:24842204-24842226 ATGGCAGAGCAGGCTGTGGAGGG - Intronic
928200105 2:29242489-29242511 ATAGCAAAGAAGGCTTAGGAAGG - Intronic
928857713 2:35819241-35819263 ATAGCCCAGCTGGCTGGGTGAGG + Intergenic
928951561 2:36817715-36817737 AGAGCCAAGTTGGGTGGGGATGG - Intergenic
930940297 2:57004319-57004341 AAAGCTAAGCAGGCTGGGCGTGG - Intergenic
931242245 2:60463510-60463532 GTAGCCAAGCCGTCTGGAGAGGG + Intronic
931672683 2:64662948-64662970 TTAGCTGAGCAGGCTGGGCACGG + Intronic
932106576 2:68948587-68948609 AAACCCAAGCTGGCTGGAGAGGG + Intronic
932411969 2:71552945-71552967 AAAGGCACCCAGGCTGGGGAGGG - Intronic
932967369 2:76492391-76492413 ACAGACAAGCAGGCTGGGCACGG - Intergenic
933003242 2:76954062-76954084 CTAGCCAGGCAGGCTGGGGGTGG + Intronic
933807790 2:86012510-86012532 ATGGCCAAGCCCCCTGGGGACGG - Intergenic
934849110 2:97685851-97685873 ATAGCCATTCTGGCTGGGCACGG - Intergenic
934980705 2:98837295-98837317 ACAGGCAAGGAGGCTGGGGAGGG + Intronic
936351215 2:111714042-111714064 ATGACAAAGCAGGCTGGGCACGG + Intergenic
936854588 2:116941631-116941653 ATTTCCAAGCATGCTGGGAAGGG - Intergenic
937011708 2:118568765-118568787 TGAGGCAGGCAGGCTGGGGAGGG - Intergenic
937251950 2:120529557-120529579 GTACCCATGCAGGCTGGGAAAGG - Intergenic
938342354 2:130544156-130544178 CTGGGCCAGCAGGCTGGGGAGGG - Intronic
938347478 2:130576553-130576575 CTGGGCCAGCAGGCTGGGGAGGG + Intronic
939845715 2:147244040-147244062 AAAGCAAAGCAGGCTGGGGAGGG + Intergenic
940159280 2:150693855-150693877 AGAGGAAAGCAGGATGGGGAAGG + Intergenic
940595696 2:155789964-155789986 AAAGCTAACCAGGCTGGGCACGG + Intergenic
941536752 2:166732199-166732221 ATAGTCAAGCAGGCAGGGGGTGG - Intergenic
942450255 2:176104720-176104742 AGAGCCAAGCGGGCTGGGACTGG + Intronic
944046391 2:195416089-195416111 ATAGTAAAGCAGGCAGGGCATGG - Intergenic
944393582 2:199245317-199245339 ATAGCAAGCCTGGCTGGGGAAGG - Intergenic
945246515 2:207722361-207722383 ATATCCAAGGCGGCTGGGCATGG - Intronic
946544718 2:220726033-220726055 ATAGCAAAGCAGTGTGGAGAGGG + Intergenic
947691620 2:232142198-232142220 AAAGCAAATCAGGCTGAGGAGGG + Intronic
1170152672 20:13241827-13241849 GTAGCCAAGCAGGTGGGTGATGG - Intronic
1170733028 20:18990392-18990414 AAAGCCAAGGATGCTGGGGGAGG - Intergenic
1171223004 20:23418324-23418346 ATAGCTAAGAAGGCAGGGGCAGG + Intronic
1172182089 20:33009768-33009790 ACAGGCAGGCAAGCTGGGGAGGG - Intronic
1172613454 20:36267952-36267974 ATGGCCACCCTGGCTGGGGAAGG + Intronic
1172804827 20:37604286-37604308 ATATCCAAACAGTCTGGGGTTGG - Intergenic
1173225492 20:41160174-41160196 GTAGCCCAGCAGGGTGGGGATGG + Intronic
1173254901 20:41387306-41387328 ATAGACAGGCAGCTTGGGGAGGG + Intergenic
1173490643 20:43477584-43477606 ACAGCTAAGCAGGCTGGGTGTGG - Intergenic
1173696319 20:45017446-45017468 ATATGCAGGAAGGCTGGGGAAGG + Intronic
1174001529 20:47378423-47378445 ATGGCCCAGCTGGCTGGGCACGG + Intergenic
1174240031 20:49126269-49126291 ATAGAAAATCAGGCTGGGCAGGG + Intronic
1175248042 20:57593086-57593108 AGAGCCAAGCAGCCTGGGAGAGG + Intergenic
1175779565 20:61673645-61673667 CCAGCCTGGCAGGCTGGGGAGGG + Intronic
1175974140 20:62701944-62701966 ACAGTCCAGCAAGCTGGGGAGGG + Intergenic
1176152361 20:63598524-63598546 GAAAACAAGCAGGCTGGGGATGG + Intronic
1176241773 20:64078810-64078832 AAAGCCTGGGAGGCTGGGGAAGG - Intronic
1176416348 21:6477373-6477395 AAAAGCAAACAGGCTGGGGATGG + Intergenic
1176773712 21:13109352-13109374 TCAGCCAAGAAGGCTGGGCATGG + Intergenic
1176819731 21:13644901-13644923 AGAGGCAAGCAGACTAGGGAGGG + Intergenic
1177939934 21:27397432-27397454 ATAGCCAAGTTAGCTGGGGGTGG + Intergenic
1178702846 21:34848179-34848201 ATACCCAAGGAGGCTGAGGGTGG + Intronic
1179081384 21:38173763-38173785 ATATCCAAGAGGGCTGGTGAGGG - Intronic
1179231908 21:39511689-39511711 ATAGCCATGGAGGGTGCGGAAGG + Exonic
1179691848 21:43085708-43085730 AAAAGCAAACAGGCTGGGGATGG + Intergenic
1180463615 22:15590773-15590795 AAAGCCAAATAGGCTGGGTACGG + Intergenic
1180521324 22:16209064-16209086 TCAGCCAAGAAGGCTGGGCATGG + Intergenic
1180922791 22:19530450-19530472 ATAACCCAGGAGGCTGGGCATGG - Intergenic
1181809984 22:25398100-25398122 TTAGCCAGGCAGGCTGGACACGG + Intronic
1181840964 22:25660366-25660388 AAAGGCAGGCAGACTGGGGAAGG - Intronic
1182102967 22:27670686-27670708 AGAAAGAAGCAGGCTGGGGAAGG - Intergenic
1182288848 22:29263969-29263991 CTGGCCATGCTGGCTGGGGAGGG - Exonic
1183364922 22:37401864-37401886 GTCGCCAAGGAGGCTGGGGGCGG - Intronic
1183433177 22:37778216-37778238 ATAGCCAAGCAGCCCGGGTGAGG + Intergenic
1184213826 22:43053131-43053153 GAATCCAGGCAGGCTGGGGAGGG - Intronic
1184486525 22:44783255-44783277 AAAGCCCTGCAGGCAGGGGAGGG - Intronic
1184491774 22:44814060-44814082 GCAGCCAACCAGGGTGGGGATGG - Intronic
1185134786 22:49063422-49063444 ATATCCAAGCCAGCTGTGGAGGG + Intergenic
1185418285 22:50721490-50721512 GGAGCCCAGCAGGCTGGGGGGGG + Intergenic
949468800 3:4372015-4372037 TTAGCCAGGCAGGCCGGGCATGG + Intronic
949889580 3:8723817-8723839 GCAGCCAAGGGGGCTGGGGAAGG - Intronic
950246011 3:11419260-11419282 ATAGACAAACAAGCTGGGCATGG + Intronic
950464002 3:13142540-13142562 ATCGGAAAGCAGGCTGGTGAGGG - Intergenic
950629781 3:14274823-14274845 CTAGGCACGCAGGTTGGGGATGG - Intergenic
951293213 3:20899923-20899945 GAAAGCAAGCAGGCTGGGGATGG - Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
954097603 3:48341666-48341688 AAAGACAAGCATGCTGGGCATGG + Intergenic
954655231 3:52190483-52190505 TTAGCCAAGGAGGCTGGCCAAGG - Intergenic
955157189 3:56428228-56428250 ATGGCCCTGCAGGCTGGGGGCGG + Intronic
955639401 3:61066321-61066343 ATAGCCAAAAAGGCCGGGCATGG + Intronic
955948926 3:64222596-64222618 GTAGGCAGGCAGGCAGGGGAGGG + Intronic
956746323 3:72313728-72313750 ATAGCCAATGATCCTGGGGAAGG - Intergenic
957507082 3:81135812-81135834 ATAGCATAGCAGGCTGGGAATGG - Intergenic
962385301 3:134927953-134927975 ACAGACAAGCAGGCCTGGGATGG - Intronic
962555764 3:136549589-136549611 ATAGAAAACCAGGCTGGGCATGG - Intronic
962801651 3:138895797-138895819 CTAACCAAGAGGGCTGGGGATGG - Intergenic
963024448 3:140904915-140904937 AGAGGCAAGCAGGCTGGAGTGGG + Intergenic
963487449 3:145953103-145953125 AGAGCCAAGAAGGATGGGAAAGG + Intergenic
964365333 3:155945068-155945090 ATGCTCAAGCAGGCTGGGCAAGG + Intergenic
964474259 3:157084418-157084440 ATTCTCAATCAGGCTGGGGAAGG + Intergenic
965672273 3:171159034-171159056 ACAGCCATGCAGGCACGGGAAGG + Intronic
966894049 3:184428953-184428975 ATTGGCATCCAGGCTGGGGAGGG + Intronic
967198236 3:187048231-187048253 AAAGCCAATCAGGCTGGGCACGG - Intronic
967461005 3:189745416-189745438 AGAACCAAACAGGCTGGGCATGG + Intronic
969496551 4:7529630-7529652 ATGGCTCAGCAGGGTGGGGAAGG + Intronic
970233014 4:13930236-13930258 CCAGGCAAGCAGGCTGGCGAAGG - Intergenic
971453904 4:26825909-26825931 ATAGCTAAGCTGGCCGGGCATGG + Intergenic
972272971 4:37530279-37530301 ATAGCAATGCCGGCTGGGCATGG + Intronic
972663672 4:41143087-41143109 GTAGCCAAGCATGCTGTGGTCGG - Exonic
973744633 4:53951064-53951086 ATGGACGTGCAGGCTGGGGACGG + Intronic
974078032 4:57185361-57185383 AGAGCCAACTGGGCTGGGGAGGG + Intergenic
974085617 4:57257576-57257598 ATAGCCATTCTGGCTGGGCACGG + Intergenic
976441163 4:85076277-85076299 ATAACAAAACAGGCTGGGCATGG + Intergenic
976774315 4:88690510-88690532 ATAGGCAAGCATCCTGAGGAAGG + Intronic
977583789 4:98752732-98752754 TTAGCCAAGCATGCTGGTGTGGG - Intergenic
978536813 4:109771264-109771286 TTAGCCAGGCAGGCTGTGCATGG + Intronic
979584187 4:122395339-122395361 ATAGCAAAGTAGGCTGGGCGCGG - Intronic
980821405 4:138022413-138022435 ATTACCAAGTAGGCTGGGCACGG + Intergenic
980933919 4:139208173-139208195 AGAGCAAAGCAGGCGGGAGAAGG - Intergenic
981024850 4:140067398-140067420 ATAGCCAACAAGGTTAGGGAGGG + Intronic
982611695 4:157582343-157582365 ATGGCCAAGCATTCTGGAGAGGG - Intergenic
982704903 4:158697383-158697405 ATATCAAAGAAGGCTGGGCACGG - Intronic
982830928 4:160059449-160059471 ATAGCAAAACAGGCTGGGTGTGG + Intergenic
983946905 4:173596610-173596632 AAAGCCAAACAGGCTGGGCGCGG + Intergenic
984249640 4:177316577-177316599 AGAGTCAAGCAGGATGGGGATGG + Intronic
984760322 4:183357554-183357576 ACATCCAATCAGGCTGGGGTAGG + Intergenic
985141448 4:186844195-186844217 ATAACCAAGCCTGCTGGGAAGGG + Intergenic
987473239 5:18358046-18358068 ATAGTAAAGCAGGCTGAGGGAGG - Intergenic
989007674 5:36833388-36833410 ATAGGCCAGCAGTCTGAGGAAGG + Intergenic
989800719 5:45535305-45535327 ATAGAGAAGCAGGCTGGGCATGG + Intronic
991630022 5:68647301-68647323 CTGGCCAAGTGGGCTGGGGATGG - Intergenic
992242753 5:74788413-74788435 ATAGTCAATCAGGCCGGGGGCGG + Intronic
993238809 5:85352504-85352526 ATATCCAGACAGGCTGGGCATGG + Intergenic
993907382 5:93638520-93638542 ATAGAAATGCAGGCTGGGCACGG + Intronic
995455600 5:112348569-112348591 ATAGGGAAGCAGGTGGGGGAGGG + Intronic
995944564 5:117627948-117627970 ATATACAAGAAGGCTGGGCATGG - Intergenic
996963205 5:129276181-129276203 ATAGAAAAGGAGGCTGGGCATGG - Intergenic
997183769 5:131860735-131860757 AAAGCCAAACAGGCTGGGCATGG - Intronic
997356976 5:133268889-133268911 AGAGCCAGGCAGGCTGGGCGCGG + Intronic
997385208 5:133466794-133466816 TAAGCCCAGCACGCTGGGGAAGG + Intronic
997610635 5:135213333-135213355 ATAGCCGGGCAGCATGGGGAAGG + Intronic
997667825 5:135646251-135646273 AGAGCCAAGCCGGCCGGAGAGGG - Intergenic
999397816 5:151241463-151241485 CTTGTCAAGCAGGCTGGGCAGGG - Intronic
999458108 5:151734747-151734769 TTAGCCAGGCAGGCTGAGGCGGG + Intergenic
1000861989 5:166466966-166466988 ATAGAAAAGAGGGCTGGGGACGG - Intergenic
1001586111 5:172834673-172834695 GTATCCGGGCAGGCTGGGGAGGG - Intronic
1002367552 5:178725033-178725055 ATAGCCTAGAAAGCTAGGGAAGG - Intronic
1002367769 5:178726588-178726610 AAAGCCATGTAGGCTGGGCATGG - Intronic
1002385943 5:178867409-178867431 ATAGCCTAGAAAGCTAGGGAAGG + Intronic
1003069431 6:2933255-2933277 ATAGCCAAACAGGCTGGGTGCGG - Intergenic
1004351069 6:14890865-14890887 ATAGCTAAACAGGCTGGGCGCGG + Intergenic
1004397963 6:15262817-15262839 ATAGCCAAACGGGCCGGGCACGG - Intronic
1005347919 6:24908742-24908764 GAAGCCAAGGAGGCTGGGGGCGG - Intronic
1006608470 6:35277087-35277109 AAAACAAAGCAGGCTGGGCACGG - Intronic
1006635353 6:35457687-35457709 ATATACAAGCTGGCTGGGGGAGG + Intronic
1006736958 6:36280549-36280571 ATAGCCCAGCAGCCTTTGGAGGG + Intronic
1007310356 6:40940520-40940542 AAAGGCAAGCAGGGTGGGGGAGG + Intergenic
1007568664 6:42873182-42873204 ATAGACAAGAAAGCTGGGGTAGG - Intergenic
1008261377 6:49369953-49369975 TTACCAAAGCAGGCTGGGTATGG - Intergenic
1011043794 6:83059818-83059840 GAAACCAAGCAGGCTGTGGAGGG + Intronic
1011570865 6:88733119-88733141 AAGGCCAAGCTGGGTGGGGATGG + Intronic
1013334299 6:109139776-109139798 TTAGCCAGGCAGGCTGGGCATGG - Intronic
1015706067 6:136088965-136088987 AAAGGCATACAGGCTGGGGATGG - Intronic
1016275781 6:142350943-142350965 AGAGCAAAGTAGGCTGGGCACGG + Intronic
1016396085 6:143624863-143624885 ATAGTCAAGGAGGCCGGGAACGG + Intronic
1016518048 6:144918790-144918812 ATAGACAGGGAGGCAGGGGATGG - Intergenic
1017600598 6:156076623-156076645 AAAGACAAGCATGCAGGGGAGGG + Intergenic
1017645240 6:156534051-156534073 ATAGCCCAGCCTGCAGGGGAAGG + Intergenic
1017882113 6:158569244-158569266 ATAGCCCTGCAGGCTGCAGAGGG + Intronic
1017944593 6:159084311-159084333 AGAGAAAAGCAGGCTGGGCACGG - Intergenic
1019099002 6:169612139-169612161 AAAACCAAACAGGCTGGGCACGG + Intronic
1019501396 7:1366619-1366641 ATAGCCAAGCAGGCGGACGCTGG + Intergenic
1019637949 7:2086452-2086474 ACAGCACAGCCGGCTGGGGACGG + Intronic
1020119293 7:5493980-5494002 TTAGCCAGGCAGGCCGGGCACGG + Intronic
1020146162 7:5645103-5645125 ATAGGCAAACAGGCGGGGCACGG - Intronic
1020541198 7:9462441-9462463 ATTGCTTGGCAGGCTGGGGAGGG + Intergenic
1021918844 7:25463261-25463283 ATAGCAAAGAAGACTGGAGATGG + Intergenic
1022498895 7:30870445-30870467 ACAGCCCAGCAGGCCTGGGAAGG - Intronic
1023063703 7:36353769-36353791 ATAAACAAGGAGGCTGGGTATGG - Intronic
1023799794 7:43824026-43824048 ATGGCCAAGCAGGCAGTGGGTGG + Intergenic
1023909958 7:44546832-44546854 ATAGAAAAGCAGGCTGGGCATGG + Intergenic
1026285736 7:68961323-68961345 ATAGCCAGGCAGGCTGGGCACGG - Intergenic
1026915238 7:74116043-74116065 AGAGCCAAGGAGGCTGGGAGGGG - Intronic
1026921765 7:74160810-74160832 ATAGCCAACCAGGCCTGGCACGG + Intergenic
1027762812 7:82301413-82301435 ATAGCAAACCTGGCTGGGCACGG - Intronic
1027905828 7:84180234-84180256 ACAGCTAAGCAGGCCGGGCACGG - Intronic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1028910696 7:96204382-96204404 TTGGCAAAGCAGGCTGGGCACGG + Intronic
1029514137 7:101015565-101015587 GTAGGCAAGGAGGCTGAGGAGGG - Intronic
1030703789 7:112669715-112669737 ATACCCACTCATGCTGGGGAGGG - Intergenic
1033705592 7:143882696-143882718 AAAGCCTGGCAGGCTGGAGAAGG - Intronic
1034201643 7:149286343-149286365 ATAGCCATGCTGTGTGGGGAAGG + Intronic
1034385175 7:150734962-150734984 ATAGCAGAGGTGGCTGGGGATGG + Intronic
1034405345 7:150899113-150899135 TTAGCCATGGAGGCTGGGGGTGG + Intergenic
1034461613 7:151200693-151200715 ATAGCAAATCAGGGTGGCGAGGG - Intronic
1034960587 7:155362021-155362043 AGAGCCAAGGATGCTGGAGAGGG - Intronic
1034974892 7:155442346-155442368 ATAGCAAAGCAGGCTGGGCGTGG + Intergenic
1035193561 7:157194852-157194874 ATTTCCAAGCAAGCTGTGGAAGG + Intronic
1035321916 7:158035490-158035512 AGGGCCCAGCAGGCTGGGGTTGG + Intronic
1036956636 8:13194715-13194737 ATAAGAAAGCAGGCTGGGCATGG + Intronic
1037540616 8:19867022-19867044 TTAGAAAAGCAGGCTGGGCATGG - Intergenic
1037647299 8:20804128-20804150 AAGGCCAAGCTGGCTGGGCAGGG + Intergenic
1038053333 8:23833887-23833909 AGAGCCAAGAAGAGTGGGGAGGG + Intergenic
1038071895 8:24026530-24026552 ATAGCCAAACTGCCTGCGGATGG + Intergenic
1038162482 8:25053004-25053026 TTAGCCAGGCAGAATGGGGAAGG - Intergenic
1039735884 8:40332381-40332403 ATAGCTCAGGAGACTGGGGAAGG + Intergenic
1041492512 8:58450304-58450326 ATTTCCAAGCAAGCTGTGGAAGG - Exonic
1042391795 8:68244478-68244500 ATAGAAAAGCAGGCTAGGCACGG + Intergenic
1048509580 8:135050096-135050118 ATAGCCATGCAGATTTGGGAGGG - Intergenic
1049574316 8:143383422-143383444 CGGCCCAAGCAGGCTGGGGAGGG - Exonic
1052501680 9:29299847-29299869 ATAGCCAATGAGGCTGGGTGTGG + Intergenic
1052956993 9:34260678-34260700 ATAACAGAGCTGGCTGGGGACGG + Intronic
1053242993 9:36511717-36511739 ATAGAAATGCAGGCTGGGCATGG - Intergenic
1055487259 9:76768137-76768159 ATAGCCAAGCTTTCTGGGGAGGG - Intronic
1057055813 9:91959858-91959880 AGAGAGAAGCAGGCTGGGCACGG - Intergenic
1057215399 9:93225106-93225128 AGTACCAAGCAGGCTGGGCATGG + Intronic
1057527662 9:95816876-95816898 ACAGCCAAGCAGGCAGCAGATGG - Intergenic
1057562581 9:96140032-96140054 ATAGCCAACCACGCAGGAGAGGG - Intergenic
1058425731 9:104874243-104874265 AAGGCCAAACAGGCTGGGCATGG + Intronic
1059178865 9:112193020-112193042 ATTGCTAGGGAGGCTGGGGAAGG - Intergenic
1059437194 9:114283988-114284010 ATACCCAAGAAGGCTTGGGGTGG - Intronic
1059889474 9:118785384-118785406 ATATCCAGGCAGGCAAGGGATGG + Intergenic
1060184633 9:121556809-121556831 CTAGCCAAGAAGCATGGGGAAGG + Intergenic
1060478494 9:124002037-124002059 GCTGCCAAGCAGGCTGGGGATGG + Intronic
1060930834 9:127488550-127488572 AAAGCTAAACAGGCTGGGCACGG - Intronic
1061082527 9:128380470-128380492 ATGGCCATGCAGCCTTGGGAGGG + Intronic
1061551121 9:131335188-131335210 AGAGCCAAGCAGCCTGGGAGAGG + Intergenic
1061743100 9:132721838-132721860 ATAGCCAAGCATGCTGGCTGTGG + Intergenic
1062037508 9:134389337-134389359 GAGGCCAAGCAGGCTGGGAAGGG + Intronic
1062047768 9:134432360-134432382 CAAGCCCTGCAGGCTGGGGATGG + Intronic
1203527630 Un_GL000213v1:104669-104691 AGAGGCAAGCAGACTAGGGAGGG - Intergenic
1185651190 X:1649194-1649216 ACAGCAAAGCAGACTGGGCACGG - Intergenic
1187955019 X:24509005-24509027 AGAGACAAATAGGCTGGGGATGG - Intronic
1189807698 X:44752058-44752080 TTAGCCGGGCAGGCTGGGCACGG + Intergenic
1190465511 X:50721941-50721963 CTAGCCCAGCTGGCTGGGGGTGG + Intronic
1190625697 X:52336641-52336663 AGATCCAAGCAGGCAGGGGGAGG - Intergenic
1192119498 X:68441705-68441727 ATAGCCCAGCAGGCTGTGCTGGG - Intergenic
1192867930 X:75155791-75155813 AAAGGCAAGCAGGCTGGGAATGG + Intronic
1193344948 X:80394682-80394704 ATAAATAAGCAGGCTGGGCATGG - Intronic
1195013219 X:100753120-100753142 GTAGCCAAGAAGGGTGAGGAAGG + Intergenic
1195464758 X:105168157-105168179 ATAGCCAGACAGGCCTGGGATGG + Intronic
1195647997 X:107254141-107254163 ATAGCCATGCAGCCTGGGGTTGG - Intergenic
1195757699 X:108215650-108215672 ATAGCCAAGGAGGGAGGGCATGG - Intronic
1196727448 X:118909008-118909030 CTAGCCAGGCAGGCCGGGCACGG - Intergenic
1200002922 X:153071545-153071567 AGAGCCCATCAGGCTGGTGAGGG + Intergenic
1200004801 X:153078464-153078486 AGAGCCCATCAGGCTGGTGAGGG - Intergenic
1200055162 X:153456424-153456446 AGAACCAAGCAGCCTGGGGCTGG + Intronic
1200383431 X:155864718-155864740 CTAGCCAAGCTGACTGGTGAAGG - Intergenic
1200399056 X:156008158-156008180 ACAGCCCAGCAGGGAGGGGAGGG - Intronic
1201932432 Y:19366102-19366124 ATAGACAAGGAGGCTGTGAATGG + Intergenic