ID: 1146964828

View in Genome Browser
Species Human (GRCh38)
Location 17:37017146-37017168
Sequence TTCCATGAGCACTTGCACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 5, 3: 16, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146964821_1146964828 8 Left 1146964821 17:37017115-37017137 CCGAGGATCACCCTGTTGTGCTG 0: 1
1: 0
2: 1
3: 17
4: 251
Right 1146964828 17:37017146-37017168 TTCCATGAGCACTTGCACCCCGG 0: 1
1: 0
2: 5
3: 16
4: 128
1146964826_1146964828 -3 Left 1146964826 17:37017126-37017148 CCTGTTGTGCTGGGGCAGCCTTC 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1146964828 17:37017146-37017168 TTCCATGAGCACTTGCACCCCGG 0: 1
1: 0
2: 5
3: 16
4: 128
1146964820_1146964828 9 Left 1146964820 17:37017114-37017136 CCCGAGGATCACCCTGTTGTGCT 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1146964828 17:37017146-37017168 TTCCATGAGCACTTGCACCCCGG 0: 1
1: 0
2: 5
3: 16
4: 128
1146964825_1146964828 -2 Left 1146964825 17:37017125-37017147 CCCTGTTGTGCTGGGGCAGCCTT 0: 1
1: 0
2: 0
3: 16
4: 158
Right 1146964828 17:37017146-37017168 TTCCATGAGCACTTGCACCCCGG 0: 1
1: 0
2: 5
3: 16
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146964828 Original CRISPR TTCCATGAGCACTTGCACCC CGG Intronic
903357746 1:22758497-22758519 TTGCATGAGCACTGCCTCCCTGG + Intronic
903733247 1:25513559-25513581 TTCTATGAGCAATTACGCCCTGG - Intergenic
905954197 1:41978438-41978460 TTCTCTGTGCACCTGCACCCTGG - Intronic
906822759 1:48946636-48946658 TTCCATAAGCACTTGGTGCCAGG + Intronic
910332447 1:86089917-86089939 TTCTGTGAGCACCTGCAGCCTGG + Intronic
910859619 1:91731181-91731203 TTCCATGTGGACTTGAACCCTGG - Intronic
912889332 1:113511890-113511912 TTTCAGGAGCATTTGCTCCCAGG + Intronic
912917759 1:113833984-113834006 TTCCTTGATCACTTCCAACCTGG + Intronic
914811784 1:151034008-151034030 TTCCTTGTCCACTTGCTCCCTGG - Exonic
914834022 1:151192272-151192294 TGCGATGATCACTTGAACCCAGG - Intronic
921955968 1:220983674-220983696 TTCCCTGATCACATGCTCCCAGG - Intergenic
922222817 1:223621415-223621437 TTCCCTGAGCACCCGCTCCCTGG - Intronic
1062908166 10:1193130-1193152 TCCCAGCAGAACTTGCACCCGGG - Intronic
1065806747 10:29400006-29400028 TCCCATCAGCTCTGGCACCCAGG + Intergenic
1068012609 10:51472754-51472776 TTTCATGAGCACAAGTACCCAGG + Intronic
1070730971 10:78828099-78828121 TGCCATGAGGACTTACACGCAGG + Intergenic
1071476932 10:86033310-86033332 GCCCATGAGCACTTGCTGCCCGG + Intronic
1077080837 11:724102-724124 TTCCCTGAGCACCTGGACACGGG + Intronic
1077446972 11:2599729-2599751 TGCTCTGGGCACTTGCACCCTGG + Intronic
1080117147 11:28633832-28633854 TTCCATGAGGACTTCTAACCAGG - Intergenic
1089200181 11:116720076-116720098 TTCCATGGGCACTTGCACTCTGG - Intergenic
1090898018 11:130996808-130996830 ATCCATGTGGACTTCCACCCAGG + Intergenic
1091889029 12:4038332-4038354 TTCCAAGAGCACTTGCTTCTAGG - Intergenic
1093858977 12:24140052-24140074 TTCTATGAGCAAATTCACCCTGG + Intergenic
1094196202 12:27752270-27752292 TTCCCTCAGCCCTTGCAGCCAGG - Intronic
1094591042 12:31821041-31821063 TGCCATGAGCACCTGCCTCCTGG - Intergenic
1095407042 12:41878368-41878390 TTCTATGAGCCCTAGGACCCAGG + Intergenic
1095415174 12:41968731-41968753 TTCCCTGAGCTCTTGAACACAGG - Intergenic
1101417963 12:104525191-104525213 TTCTAGGATCACTTGAACCCAGG - Intronic
1103365294 12:120377841-120377863 TTCCATGACTACCTGCACCAAGG - Intergenic
1104275238 12:127320906-127320928 TCCCATGAGCACATGCAGCAGGG - Intergenic
1104389833 12:128382418-128382440 TCCCCTGAGCACTTGAACCATGG + Intronic
1106451850 13:29889232-29889254 TGCCATGAGCGCTTGCAGCGCGG - Intergenic
1112922332 13:104629373-104629395 TTTTATGAGGACTTGTACCCAGG + Intergenic
1113097262 13:106679320-106679342 TGCCTTGGACACTTGCACCCTGG + Intergenic
1114884698 14:26833790-26833812 TGCCATGTGCACTTACACCCAGG - Intergenic
1115765106 14:36615135-36615157 TGGGATGAGCACTTGAACCCAGG + Intergenic
1116340386 14:43715443-43715465 TTCCATGTGCACTTGAACACTGG - Intergenic
1119073294 14:71609359-71609381 TGTGATGAGCACTTGAACCCAGG - Intronic
1122545321 14:102518536-102518558 TTTAATGAGCTCTTGCACACTGG - Intergenic
1123680651 15:22760816-22760838 TGGGATGATCACTTGCACCCAGG - Intergenic
1123935413 15:25191712-25191734 TTCAGTGAGCTCTTCCACCCAGG + Intergenic
1123946642 15:25242067-25242089 TTCAGTGAGCTCTTCCACCCAGG + Intergenic
1123948691 15:25251171-25251193 TTCAGTGAGCTCTTCCACCCGGG + Intergenic
1124068074 15:26364422-26364444 TTCCATGATCACTAGTGCCCTGG - Intergenic
1127290848 15:57569685-57569707 CTCCAAGAGCACTGGCAGCCAGG + Intergenic
1127445271 15:59055721-59055743 TTGCATGAGAACTGGAACCCTGG - Exonic
1139674449 16:68513598-68513620 GTCCATGAGAACTTGGAGCCAGG - Intergenic
1141193503 16:81842245-81842267 TTCTCTGAGCACATGCATCCTGG - Intronic
1142410104 16:89911590-89911612 TTCAAGGAGGACGTGCACCCAGG - Intergenic
1142676897 17:1519196-1519218 TCCCATTAGCAGATGCACCCAGG + Exonic
1143095336 17:4475841-4475863 TTCCATGAGCAGTTCAAACCCGG - Intronic
1144753291 17:17664840-17664862 CTCCATGGGCAGTGGCACCCCGG - Intergenic
1145124232 17:20286924-20286946 TTCCAGGAGCTCCTGCAGCCTGG - Intronic
1146335031 17:31962206-31962228 TGGGATGATCACTTGCACCCAGG + Intronic
1146964828 17:37017146-37017168 TTCCATGAGCACTTGCACCCCGG + Intronic
1147845916 17:43403771-43403793 TTCCTTGAGCCCTTGCAGCATGG - Intergenic
1147851840 17:43449668-43449690 TTCCCTGAGCACTGGCACCAGGG - Intergenic
1150641040 17:66949612-66949634 TTCCAGGAGCACTTCAACACAGG + Intergenic
1152495316 17:80667101-80667123 TACCATCAGCACTGGCACGCTGG - Intronic
1153201324 18:2650459-2650481 TTCCATAAGCACTTGCACACTGG + Intergenic
1158111896 18:53949377-53949399 TTCCAGGAGCATTAGCACCATGG + Intergenic
1160017972 18:75158636-75158658 TTCCAGGAGCAGTGGCACCTGGG + Intergenic
1160717626 19:583534-583556 TTCCGAGAGCAGGTGCACCCTGG + Intergenic
1164941094 19:32252686-32252708 TTCCAGGAACACTTCCACACGGG + Intergenic
925787236 2:7444188-7444210 TTCCAGGATCTCTTGCAGCCAGG - Intergenic
925872604 2:8284154-8284176 CTCCTAGAGCACTTTCACCCCGG + Intergenic
927018353 2:18991869-18991891 TGCCATGAGCATATGGACCCTGG + Intergenic
929400201 2:41571239-41571261 TACCATGAGCACATGCACCCAGG + Intergenic
930395803 2:50823044-50823066 ATCAATGTGCACTTGCACCCTGG + Intronic
930551330 2:52838417-52838439 TTCCAGGAGCATTTGCATCAGGG + Intergenic
930766503 2:55090706-55090728 TTGTATGAGCAATTGGACCCTGG - Intronic
930769201 2:55114804-55114826 ACCCGTGAGCATTTGCACCCAGG - Intergenic
931051947 2:58425720-58425742 TTCCATAAGCACTTGCACACTGG - Intergenic
932294452 2:70612805-70612827 GTCCATGAGAAGTTCCACCCTGG + Intronic
938389212 2:130892050-130892072 TAGGAGGAGCACTTGCACCCAGG - Intronic
939171364 2:138700124-138700146 TTCCCTGAGCAAGTGCACCCTGG + Intronic
939389114 2:141543855-141543877 TCCCATGAGACCTTGCACCATGG - Intronic
944023377 2:195134090-195134112 TTCCATGAGAAGTTACACCTCGG + Intergenic
944856578 2:203773858-203773880 CTGCATGAGTACTTTCACCCTGG - Intergenic
947858971 2:233345376-233345398 TGCCGTGAGCATGTGCACCCTGG - Intronic
948904191 2:240970515-240970537 TTCCCTTAGCATTTGCATCCAGG + Intronic
1169235045 20:3924189-3924211 TACCAAGAGCACCTGCAGCCTGG - Intronic
1169560679 20:6797591-6797613 TTCCATGAGCAGTCTCACCCAGG - Intergenic
1170586886 20:17741498-17741520 TTGCCTGAGCACTTGCTCACAGG - Intergenic
1175599053 20:60257855-60257877 TTGCATGAGCAGGTGCACACAGG - Intergenic
1177330741 21:19657845-19657867 TTAGAAGATCACTTGCACCCAGG - Intergenic
1178102443 21:29284325-29284347 TTCCTTGAGCTCTTGCTACCTGG + Intronic
1181313842 22:21959762-21959784 TGCCCTGAGCACTCGCACCCAGG + Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1185156825 22:49198082-49198104 TTCCAGGAGCACTTCCACCCGGG - Intergenic
950662349 3:14474324-14474346 TGCCATGAGGACCGGCACCCAGG - Intronic
953712586 3:45287246-45287268 TTCAATGAGCACTTCATCCCAGG + Intergenic
962168701 3:133077851-133077873 TTCCCTGAGCTCTTGCTCCCAGG + Intronic
964679066 3:159317688-159317710 TTCCATGAGCACAAGCCCACTGG + Intronic
964754095 3:160078929-160078951 ATCCATGAGGTCTTACACCCTGG + Intergenic
968839353 4:2990624-2990646 CTACATGAGAACTTACACCCAGG - Intronic
971035254 4:22685903-22685925 TCCCATGAGGATTTGCACACTGG - Intergenic
972627651 4:40816955-40816977 ATCCATTAGCACTGGCACCAGGG + Intronic
975166771 4:71186789-71186811 TTCCGTGAGCCCCCGCACCCCGG + Intergenic
975172891 4:71253029-71253051 TTCCCTGTGCACTTCCACACAGG - Intronic
979919828 4:126481783-126481805 TACCCTGAGCTCTTTCACCCTGG - Intergenic
983628124 4:169823928-169823950 TTCCATCAGCACTTGCTGACCGG + Intergenic
986128207 5:4903195-4903217 TTCAATGAGCACTTTGACCCTGG + Intergenic
988632324 5:32944556-32944578 TGCAATGAGCACTTGAGCCCAGG - Intergenic
994093938 5:95832071-95832093 TTCCATGTGCACTTGCCCATGGG - Intergenic
997126138 5:131228803-131228825 TCCCTTGAGCACATGCACCAAGG + Intergenic
997207172 5:132056768-132056790 TTCCGTGAGCCCTTGGACCGAGG - Intergenic
997738793 5:136235589-136235611 TTTCATGAGCTCTGGAACCCAGG + Intronic
997842605 5:137256000-137256022 TTCCATGGGCACTGGCAGCCTGG - Intronic
998006377 5:138659674-138659696 TTCCAAATGCACTTGCACTCAGG + Intronic
998060808 5:139117465-139117487 TTCAATGGGCTCCTGCACCCTGG - Intronic
1007075243 6:39062044-39062066 ATCCATTAGCTCCTGCACCCTGG - Intronic
1010465646 6:76165256-76165278 CTCCATGAGAACGTGCACACTGG - Intergenic
1015837038 6:137431607-137431629 TTGAAAGAGCACTTGCTCCCAGG + Intergenic
1016928137 6:149374310-149374332 TAGCAGGAGCACTTGAACCCAGG - Intronic
1016964365 6:149704706-149704728 TTACCTGAGCACTTGAACCCAGG - Intronic
1021777810 7:24070929-24070951 TTCAATGAGCCCTTTCACACTGG + Intergenic
1023601628 7:41886610-41886632 TTCTATGAACCCTTGCACCCTGG + Intergenic
1024351654 7:48371971-48371993 TTTCATGAGCACTTGTATCCTGG - Intronic
1028842089 7:95439762-95439784 TTCCAGGAGCCATTGAACCCTGG + Intergenic
1029405353 7:100371635-100371657 TCCCATGAGCACCTGCACTAAGG + Intronic
1031122719 7:117739721-117739743 TTCCATGTGCCCTTAAACCCCGG + Intronic
1036842528 8:12135646-12135668 TTTCATGAGCCCTTGAAGCCAGG - Intergenic
1037728336 8:21502760-21502782 TTCAATGAGCATTTTCACCTGGG - Intergenic
1039463494 8:37765083-37765105 TTGCTTGATCACTTGAACCCAGG + Intronic
1042850596 8:73212326-73212348 TTCCAGGACCACTTGGACACTGG - Intergenic
1043542983 8:81283045-81283067 AACCAAGAGCACTGGCACCCTGG - Intronic
1043565180 8:81539873-81539895 CTGCCTGAGCACTTGCCCCCAGG + Intergenic
1049611747 8:143559097-143559119 TACCATGAGCACCTCCAGCCAGG - Intronic
1050063091 9:1730896-1730918 TTCCATGAGCAACTCCTCCCTGG - Intergenic
1051398698 9:16656190-16656212 TTCCCTGAGCACCTACACACAGG - Intronic
1052387191 9:27835869-27835891 TTCTATCTGCACATGCACCCTGG - Intergenic
1052818921 9:33123788-33123810 GCCCATGAGCAATGGCACCCTGG + Intronic
1055504186 9:76931287-76931309 CACCATGAGCACTTCCACCATGG - Intergenic
1056295610 9:85190421-85190443 CACCATGAGATCTTGCACCCTGG + Intergenic
1057125683 9:92614201-92614223 TCACATGTGCACTTGAACCCAGG + Exonic
1060155883 9:121319337-121319359 TGCCATCAGCACTAGCCCCCTGG - Intronic
1060293730 9:122328914-122328936 TTCCAGGATCACTTGAACCCAGG - Intergenic
1061351548 9:130069331-130069353 TTCCATTAGCACTGACACCGTGG - Intronic
1062100322 9:134724656-134724678 TTCCCAGAACACTGGCACCCTGG + Intronic
1062167629 9:135115827-135115849 TCACATGAGCCCGTGCACCCAGG - Intronic
1187477587 X:19625858-19625880 TTCCAAGAGCACTTGGCCCAGGG + Intronic
1189593688 X:42542344-42542366 TTCCATGAGCATTTTCAGCCAGG + Intergenic
1191995348 X:67089336-67089358 CACCATGATCACTAGCACCCAGG - Intergenic
1196111482 X:111951583-111951605 TTCCATAAGCATCTGCACCATGG + Intronic
1196275790 X:113763919-113763941 TTCCATGAGCATGAGCAGCCTGG - Intergenic
1196859741 X:120015780-120015802 TTCCTTGACCACTCCCACCCTGG + Intergenic
1201057274 Y:10007758-10007780 ATGCATGAGCATTTGAACCCAGG + Intergenic
1201272950 Y:12273066-12273088 TACCATGAGCAGTTGCACGAAGG - Intergenic