ID: 1146966307

View in Genome Browser
Species Human (GRCh38)
Location 17:37033958-37033980
Sequence ACTCCAGGTAGAGCAAGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146966301_1146966307 27 Left 1146966301 17:37033908-37033930 CCTTCAGCAAACTTTTTGTATTT 0: 1
1: 2
2: 24
3: 243
4: 965
Right 1146966307 17:37033958-37033980 ACTCCAGGTAGAGCAAGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 155
1146966303_1146966307 -2 Left 1146966303 17:37033937-37033959 CCAGAACTGTGTTATGTTGCCAC 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1146966307 17:37033958-37033980 ACTCCAGGTAGAGCAAGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 155
1146966300_1146966307 28 Left 1146966300 17:37033907-37033929 CCCTTCAGCAAACTTTTTGTATT 0: 1
1: 0
2: 4
3: 64
4: 581
Right 1146966307 17:37033958-37033980 ACTCCAGGTAGAGCAAGCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146966307 Original CRISPR ACTCCAGGTAGAGCAAGCAA GGG Intronic
900482741 1:2907164-2907186 GCTCCAGGTGGAGCCAGCATAGG + Intergenic
900940155 1:5793367-5793389 CCTCCAGGTAGCGCATGGAAGGG + Intergenic
903335833 1:22623917-22623939 ACACCAGGCAGGGAAAGCAAAGG + Intergenic
904361058 1:29971989-29972011 ACTCCAGGAAGCACAAGTAAAGG - Intergenic
904476068 1:30765288-30765310 ACTCCAGGTGGGGAAAGCAGAGG + Intergenic
907270310 1:53287368-53287390 ACCCCAGCTAGCACAAGCAAGGG + Intronic
907883325 1:58571411-58571433 ACTCCAGCTAGAGCCAACACTGG + Intergenic
909615624 1:77605505-77605527 ACTCCAGCCAGAGCAATTAAGGG + Intronic
910372937 1:86537277-86537299 ACTCCAGGGTGAGCCAGCCATGG - Intergenic
912074594 1:105856698-105856720 ACTGCAGGAAGAGAAAGAAAGGG - Intergenic
912126429 1:106544608-106544630 CCTCCAGGTAGAACACGGAAGGG + Intergenic
913610749 1:120507571-120507593 ACTTCAGGTGGAGAAAGAAAGGG + Intergenic
913984057 1:143549319-143549341 ACTTCAGGTGGAGAAAGAAAGGG - Intergenic
914580441 1:149014668-149014690 ACTTCAGGTGGAGAAAGAAAGGG - Intronic
919791368 1:201292849-201292871 GCTCCACGAAGAGCAAGCCATGG - Intronic
922221771 1:223613771-223613793 ACTCCAGTTAAAGCAAGAGAAGG + Intronic
922568657 1:226618726-226618748 ACTCCAGGTCCAGCAGGCACAGG - Intergenic
924898945 1:248373667-248373689 ACACCAGCCAGAGCAAGTAAGGG - Intergenic
1063354811 10:5388097-5388119 ACTACATAGAGAGCAAGCAATGG + Intergenic
1066569358 10:36754307-36754329 ACTCCATCTAGAGAAAGGAAGGG + Intergenic
1068741263 10:60474240-60474262 AGTCCAGGTAGTGCAGGAAAGGG + Intronic
1070429467 10:76322514-76322536 ACTGTAGGTAGAGCAAAAAATGG - Intronic
1073155445 10:101342795-101342817 AATCCAGGCACAGAAAGCAAGGG + Intergenic
1074256711 10:111810257-111810279 ACTCCAGGTATTGAAGGCAAGGG + Intergenic
1076482827 10:130796087-130796109 ACACCAGGGAGAGCAAGGATGGG + Intergenic
1078169950 11:8922094-8922116 ACTGCCAGTAGGGCAAGCAAAGG + Intronic
1080812747 11:35721936-35721958 ACTCCAGTGAGGGCAGGCAAGGG - Intronic
1085036129 11:73301159-73301181 ACTCCTGGAAGAGTAAGCAAAGG - Intergenic
1085683110 11:78596574-78596596 GTTCCAGGTAGAGGAAGCAGTGG + Intergenic
1086155496 11:83661054-83661076 ACTACAAGCAGAGCAAGCAAAGG - Intronic
1086569546 11:88266332-88266354 ACACCAGTTAGAGCAGCCAAGGG + Intergenic
1087060306 11:93970740-93970762 ACTCCAGTTAAATCAGGCAATGG - Intergenic
1088858908 11:113781648-113781670 ATTGCAGGCAGAGCAAGCAAAGG - Intergenic
1090358191 11:126154717-126154739 ACTCAAGGGAGAGCAGGGAAGGG - Intergenic
1096548586 12:52357486-52357508 ATGCCAGGCAGAACAAGCAATGG - Intergenic
1099189948 12:79552265-79552287 ACTGGAGGTAAAGCAAGCATAGG + Intergenic
1099586240 12:84518830-84518852 ACTCCAGATATAGCAAGTAGAGG - Intergenic
1101553262 12:105783369-105783391 ACTTCAGGTAGAGAAAGAAAAGG + Intergenic
1104506504 12:129337235-129337257 AGTCCATGTAGATCAAGCATAGG - Intronic
1107081222 13:36376871-36376893 GCTTCAGGTGGAGCAAGGAAGGG - Intergenic
1108784639 13:53881277-53881299 AATCCTCGTAGAGCAAGAAAAGG - Intergenic
1109479927 13:62938395-62938417 ATTCCAGGCAAAGGAAGCAAAGG - Intergenic
1111916561 13:94366887-94366909 AAACCAGGTAGAGCTTGCAAAGG + Intronic
1113431762 13:110256543-110256565 ATTCCAGAAAGAGAAAGCAAGGG + Intronic
1113639171 13:111944824-111944846 AGCCCAGGTAGAGCAAACTAGGG - Intergenic
1113732692 13:112653351-112653373 AAACCAGGAAGAGCAAGAAAAGG + Intronic
1115767797 14:36641949-36641971 ACTCAAGGAAGAGAAAGGAAAGG - Intergenic
1116874427 14:50096995-50097017 ACTCTTGGTTGGGCAAGCAAAGG + Intergenic
1118907597 14:70033856-70033878 TCTCCAGGTGGAGGAAGAAATGG - Intergenic
1124861607 15:33447518-33447540 ACTCCAGTCAGAGCAGGCATTGG + Intronic
1128625144 15:69193712-69193734 TCTCCAGGTAGTACAAGCACAGG - Intronic
1129186747 15:73911898-73911920 ACTCCAGGTAGAGCGTCCAAGGG - Intergenic
1142978744 17:3659635-3659657 TCTGCATGTACAGCAAGCAAAGG - Intronic
1143157996 17:4850939-4850961 ACACCAGAGAGAGCAAGGAAGGG - Intronic
1146052709 17:29566417-29566439 GCTCCAGGGCGAGCAAGCAAAGG + Exonic
1146966307 17:37033958-37033980 ACTCCAGGTAGAGCAAGCAAGGG + Intronic
1148258945 17:46162421-46162443 ACTCCAGGTATACCCAACAAAGG + Intronic
1148357107 17:46982779-46982801 ACTCAAATGAGAGCAAGCAAAGG + Intronic
1153225767 18:2898433-2898455 TCTCCCGGTAGAGGAAGGAAGGG + Intronic
1155375027 18:25147918-25147940 ATTCCAGGTAGAGCCAGGCATGG - Intronic
1159727704 18:71983214-71983236 ACTCCAGCTTGGGCAACCAAGGG - Intergenic
1162833415 19:13300978-13301000 ACTCCAGGCTGGGCAACCAAGGG - Intronic
1166351481 19:42200562-42200584 ACTCCCAGTAGAGCCAGCACAGG - Intronic
925676632 2:6368787-6368809 ATTCCATGGAGAGCAAGGAAGGG + Intergenic
925872270 2:8281710-8281732 GCTGCAAGTACAGCAAGCAAAGG - Intergenic
926018241 2:9473541-9473563 GCCCCTGCTAGAGCAAGCAAAGG - Intergenic
928851984 2:35759294-35759316 ACACCAGCTAGAGCAACCAAGGG - Intergenic
931722275 2:65075905-65075927 ACTCCAGCTAGAGGAAGGGAGGG + Intronic
932033102 2:68210637-68210659 ACTCTAGGTAGTTGAAGCAAAGG + Intronic
932230562 2:70080846-70080868 ATTCCAGGCAGAGGAAGCAAAGG - Intergenic
934163211 2:89271858-89271880 ACTCCAGGCAGAGCAGGAACTGG + Intergenic
934604298 2:95682565-95682587 AGTCCAGGGAAAGGAAGCAAAGG - Intergenic
935312085 2:101794352-101794374 ACTCCAAGTTGAGCAATCACTGG - Intronic
936175009 2:110212219-110212241 ACTCCAGGAAGAGCCGGCCATGG + Intergenic
937768101 2:125685411-125685433 ACTCCAGGTGGATCAAGAGAAGG + Intergenic
939239906 2:139544152-139544174 GCTCTTGGAAGAGCAAGCAAGGG - Intergenic
940039837 2:149348574-149348596 AAGGCAGGTAGAGCAAGCCAGGG + Intronic
941892616 2:170597333-170597355 ACTCCAGCTTGAGCAACAAAGGG + Intronic
1169928305 20:10805979-10806001 ACTCCAGTGAGAGCGATCAAAGG - Intergenic
1173021455 20:39271181-39271203 AATGCAGGGAGAGGAAGCAAGGG - Intergenic
1173213922 20:41061538-41061560 ATTCCAGGTAAGCCAAGCAATGG - Intronic
1173382396 20:42557781-42557803 TATCCAGGTAAAGGAAGCAAAGG - Intronic
1174582938 20:51585535-51585557 AGGACAAGTAGAGCAAGCAAGGG + Intergenic
1176161115 20:63649296-63649318 ACTCTGGAGAGAGCAAGCAAGGG + Intronic
1177995495 21:28090747-28090769 GCTCCAGGCAGAGCAACCTACGG - Intergenic
1181002402 22:19994045-19994067 ACTAGAGGGAGGGCAAGCAAAGG + Intronic
1182022167 22:27090470-27090492 ACCCCAGGAAGAGCAAGGCATGG + Intergenic
1183276599 22:36902010-36902032 ACTCCAGGTATCACATGCAAAGG + Intergenic
1184429011 22:44430351-44430373 ACTGCAGTCCGAGCAAGCAAGGG - Intergenic
1184996692 22:48212278-48212300 TCTCCAGGGAAAGCAAGCAAAGG - Intergenic
950042794 3:9930963-9930985 ACTCCTGGTACAGAAAGGAAAGG - Intronic
950451352 3:13067506-13067528 ATTCCAGGTAGTGCATGCAGTGG + Intronic
951347647 3:21565409-21565431 ACTCCAGCCAGAGCAACCATAGG - Intronic
951590182 3:24255984-24256006 ACTGCAGCTAGAGCAAGAAGAGG + Intronic
952509981 3:34043303-34043325 GCCCCAGGTAAATCAAGCAATGG + Intergenic
954127912 3:48543051-48543073 ACTCCAGGAAGAAGAAGGAAGGG + Intronic
954578387 3:51689588-51689610 ACTCCAGGTGAAGCAGGAAAGGG - Intronic
961663198 3:128481232-128481254 AGTCCAAGAAGAGCAAGAAAGGG - Exonic
963088887 3:141463701-141463723 TCTCGAGGTGGAGCTAGCAAGGG - Intergenic
963348062 3:144119727-144119749 ACTCCAGGAAGAGGCAGCTATGG + Intergenic
966663064 3:182436605-182436627 ATTCCTGGTGAAGCAAGCAAAGG + Intergenic
967452943 3:189647559-189647581 AATCCACGTAGAGCTTGCAATGG - Intronic
969445481 4:7242600-7242622 ACTCCAGAAAGAGAGAGCAAAGG - Intronic
970721541 4:18995165-18995187 AATCTAGGTGGAGCAAGCTATGG - Intergenic
972633866 4:40865199-40865221 TTTCCAGGGAGAGCAAGCCAGGG - Intronic
973967737 4:56181275-56181297 GTTCCAGGTAGAGGAAGCAGTGG + Intronic
976874739 4:89838328-89838350 AATCCAGGCACAGAAAGCAAAGG - Intergenic
982982114 4:162151834-162151856 TCTTCAGGTAGAGCAAATAAAGG - Intronic
983143961 4:164189237-164189259 ACTCCAGCTAGAGGTAGAAAAGG + Intronic
985273616 4:188216847-188216869 ACCCCAAGTAGAGCAAAGAAAGG - Intergenic
985535935 5:465789-465811 CCTCCAGGTAGAGCAGAGAAGGG - Exonic
986720523 5:10557804-10557826 ACTTCAGGGACACCAAGCAAGGG - Intergenic
987213651 5:15710314-15710336 ACTCCAGGAAGAGCAAGGAGAGG - Intronic
992941196 5:81763788-81763810 ACGCTAGGTAGAGTAAGGAACGG + Intergenic
993048362 5:82895016-82895038 ACTCAAGGGAGGGAAAGCAAAGG - Intergenic
993165417 5:84348000-84348022 ATTCCAGGTACTGGAAGCAATGG + Intronic
997742471 5:136269127-136269149 ACTCCAGGCACAGCAGGCTAAGG - Intronic
997755856 5:136398867-136398889 ACTCCATGTTTAGCAGGCAATGG + Intergenic
998421762 5:141994054-141994076 ATTCCAGGCAGAGACAGCAAGGG + Intronic
999141560 5:149365824-149365846 ACTCCATGTAGAGGAAGTGATGG + Intronic
999741680 5:154559989-154560011 ATTCCAGAAAGACCAAGCAAAGG + Intergenic
999894794 5:156020017-156020039 ATTCGAGGCAGAGGAAGCAAGGG - Intronic
1000118324 5:158174075-158174097 ACTCCAGCAAGGGCAAGCATGGG + Intergenic
1000651401 5:163822524-163822546 ACACCAGGTAGGGCAGCCAAGGG - Intergenic
1002688726 5:181036111-181036133 ACGCCAGGTAGAGTGAGCATTGG - Intergenic
1005466290 6:26117710-26117732 GCTCAAGGTATATCAAGCAATGG + Intronic
1008181540 6:48336527-48336549 ACTCCAGTTAGAGAAATTAAAGG - Intergenic
1009412464 6:63381772-63381794 GCTCCAGACACAGCAAGCAATGG + Intergenic
1012191698 6:96287691-96287713 ACCCAAGGTAGTGCAGGCAATGG - Intergenic
1012493630 6:99810689-99810711 ATTCCCTGAAGAGCAAGCAATGG - Intergenic
1012663682 6:101938368-101938390 ACTCCAGATAGATCAGGAAAAGG + Intronic
1013691752 6:112652837-112652859 ACTCTGGTGAGAGCAAGCAACGG + Intergenic
1016826169 6:148390336-148390358 ACCCCAGGAAGAGCTAGCACTGG - Intronic
1017798454 6:157869522-157869544 ACTCTAGGGAGAGAAACCAATGG - Intronic
1017979380 6:159386225-159386247 TCTCCAGTTAGAGGAGGCAACGG + Intergenic
1020711274 7:11608541-11608563 CCTCCAGGTTGTCCAAGCAATGG - Intronic
1026973289 7:74480695-74480717 CCTCCTGGTAGAGCAGGCATGGG + Intronic
1034099051 7:148436100-148436122 ACACCAGGAAGAGCCAGCATGGG + Intergenic
1034920424 7:155075672-155075694 AATCCAGGTACAACAAGAAATGG + Intronic
1035784312 8:2249382-2249404 ACTCCAGGAAGAGGAACCAGGGG + Intergenic
1035808347 8:2471837-2471859 ACTCCAGGAAGAGGAACCAGGGG - Intergenic
1036058025 8:5281555-5281577 ACTGCAGGAAGAGAAAGAAATGG + Intergenic
1037184194 8:16041794-16041816 ATTCAAGGTAGAAAAAGCAAAGG - Intergenic
1037793235 8:21966919-21966941 ACTCCAGGCAGAGAAAGCCTTGG + Exonic
1039365106 8:36920943-36920965 AATCCAGTCATAGCAAGCAATGG + Intronic
1040589225 8:48774120-48774142 AGTGCAGGCAGAGCAATCAAGGG - Intergenic
1041290575 8:56304497-56304519 ACTCCATGGAGAGCAGGGAAGGG + Intronic
1043300461 8:78724230-78724252 AGTCCAGGTAATACAAGCAAAGG + Intronic
1047406902 8:124593098-124593120 ACACCAGGGAGAGCCAGCAGAGG + Intronic
1048370870 8:133775013-133775035 TCTCCAGGTAGAGGAACCAGCGG - Intergenic
1050649036 9:7755344-7755366 AAGCCAGGGAGAGCAAGCAAGGG + Intergenic
1050785042 9:9390098-9390120 ACTCCAGGTACAGAGAGCAGAGG + Intronic
1053361050 9:37486778-37486800 ACCCCAGGAAGAGGAATCAACGG + Exonic
1057916266 9:99057930-99057952 ACTCAAAGTAGCTCAAGCAAAGG + Intronic
1057957051 9:99418500-99418522 ACTACAGTGAGAGCAAGGAAAGG + Intergenic
1058010327 9:99969786-99969808 ACACCAGCTATAGAAAGCAAAGG - Exonic
1058604902 9:106710448-106710470 AGTCCTGGTAGAGGAAGCAAAGG + Intergenic
1185841337 X:3394515-3394537 ACTCCAGCCATAGCAATCAAAGG - Intergenic
1188612367 X:32116184-32116206 ATTCCAGGCAGAGGAAACAAGGG - Intronic
1189762191 X:44333048-44333070 GCTGCAGGTAGAGGCAGCAATGG + Intronic
1190394864 X:49971633-49971655 ACTCCAGGTGCAGCAGGCCAAGG - Intronic
1195626577 X:107010057-107010079 ACTCCAGGAAGAGAAAGACAGGG - Intergenic
1195655395 X:107327364-107327386 ACTCCAGGAAGAGAAAGACAGGG - Intergenic
1196411022 X:115418599-115418621 GCTCAAGGTAGAGGAACCAACGG - Intergenic
1197578077 X:128246691-128246713 AAAGCAGGTAGAGCCAGCAAAGG + Intergenic
1199216158 X:145262620-145262642 ACACCAGCTAGAGCAATCAGAGG + Intergenic
1199920870 X:152402091-152402113 ACCACAGGTAGAAGAAGCAAAGG + Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic