ID: 1146967572

View in Genome Browser
Species Human (GRCh38)
Location 17:37045929-37045951
Sequence TCTGATTTGCAGAGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 391}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146967568_1146967572 17 Left 1146967568 17:37045889-37045911 CCTGGCAGGTGTTTAGGACAGAT 0: 1
1: 0
2: 3
3: 15
4: 115
Right 1146967572 17:37045929-37045951 TCTGATTTGCAGAGGCAGGAAGG 0: 1
1: 0
2: 0
3: 35
4: 391
1146967569_1146967572 -9 Left 1146967569 17:37045915-37045937 CCTTTTGCTGAATTTCTGATTTG 0: 1
1: 0
2: 2
3: 43
4: 482
Right 1146967572 17:37045929-37045951 TCTGATTTGCAGAGGCAGGAAGG 0: 1
1: 0
2: 0
3: 35
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146967572 Original CRISPR TCTGATTTGCAGAGGCAGGA AGG Intronic
900546700 1:3233432-3233454 TGTGAGTGGCAGCGGCAGGAGGG - Intronic
901232282 1:7647839-7647861 TCTGGGTGGCCGAGGCAGGAGGG + Intronic
903888510 1:26554987-26555009 TCTGGTTGGCAGAGGCAAGAGGG + Intronic
904471601 1:30739893-30739915 CATGATTTGCAGGGACAGGAAGG + Exonic
904755329 1:32765715-32765737 TCTGCTCTGGAGAGGCAGGGTGG + Intronic
905257688 1:36695568-36695590 TCTGCTTAGCTGAGGGAGGAGGG + Intergenic
905279380 1:36839186-36839208 TGTCATTTGCAGAGGCAAGCTGG - Intronic
905410177 1:37763291-37763313 TGTGATTTGAAGATGGAGGAGGG - Intronic
905946306 1:41904207-41904229 TCTGATTGGCAGCAGCAGGAGGG + Intronic
906050705 1:42869001-42869023 TCTTAGTTCCAGAGGGAGGAAGG + Intergenic
906203935 1:43976931-43976953 TCTGCTTTGCAGAGTGGGGATGG + Intronic
906692481 1:47801686-47801708 TCTGAAGTCCAGAGGGAGGAGGG - Intronic
907580586 1:55568696-55568718 TATGCTTTGCAGATGAAGGAAGG + Intergenic
907597568 1:55733710-55733732 TCTTAGTTCCAGAGGAAGGAAGG + Intergenic
907705626 1:56830224-56830246 TCTGATTGGTGGAGGCAGGGGGG - Intergenic
908633564 1:66137175-66137197 GCTTATTTGAAGAGCCAGGAAGG + Intronic
908800368 1:67873780-67873802 TGTGATTTCCACAGGCAGGCTGG + Intergenic
910242682 1:85104361-85104383 TCTGATAGGCTGAGGCAGGGAGG - Intronic
910602760 1:89049576-89049598 CCTGATTAGCAGAGGCAGGTGGG - Intergenic
910667070 1:89737158-89737180 GGTGCTGTGCAGAGGCAGGATGG - Intronic
911026388 1:93440005-93440027 TATTTTTTGTAGAGGCAGGAGGG + Intergenic
911313925 1:96332869-96332891 TATGATTAGCAGAGGCTGGGAGG - Intergenic
911483401 1:98474191-98474213 TCTAAGTTGCAGAGGCAGAGTGG - Intergenic
911883894 1:103272999-103273021 TCTGATGTTCAAGGGCAGGAAGG - Intergenic
915354383 1:155247463-155247485 TCTGATTTGCAAGGGCACTATGG - Exonic
915708365 1:157869175-157869197 CCTGAGTTCCAAAGGCAGGAGGG + Intronic
916145093 1:161731210-161731232 TTTGATTTTCAGAGTCAGGTTGG - Intergenic
916157352 1:161866629-161866651 TATGATTTGGAGAGGGAGGTTGG + Intronic
916873245 1:168940146-168940168 TATTGTTTGCAGAGGCAGGTAGG + Intergenic
917187430 1:172375393-172375415 TCTAATTTGATGAGGCTGGAAGG - Intronic
918049798 1:180964286-180964308 TCAGGTTTGCAAATGCAGGATGG - Intergenic
918059442 1:181048814-181048836 TCAGGTTTGCAAATGCAGGATGG - Intronic
920264217 1:204709855-204709877 TCTGATTGGCAAAGGCATAAAGG - Intergenic
921075701 1:211698731-211698753 TCTTTTTTGCAGAGGGAGGGAGG + Intergenic
921621104 1:217327298-217327320 TCTGATTTACAGATGAAGGAAGG + Intergenic
922581257 1:226699951-226699973 TCTGATGTTCAAGGGCAGGAAGG + Intronic
924361573 1:243247042-243247064 ACTGATTTGAGGAAGCAGGAGGG - Intronic
1063539720 10:6919896-6919918 TCTCATTTGAAAAGTCAGGATGG + Intergenic
1063785736 10:9380721-9380743 TCTGATGTCCAAGGGCAGGAGGG - Intergenic
1063848516 10:10159701-10159723 TCTGAATTCCAAAGGGAGGAAGG + Intergenic
1063866647 10:10372590-10372612 ACTGCATTCCAGAGGCAGGATGG - Intergenic
1064477345 10:15705428-15705450 TTTCATCTGCAGTGGCAGGAGGG - Intronic
1065045384 10:21743642-21743664 TCTCATTTGGAGAGGATGGAGGG + Intergenic
1067280003 10:44864151-44864173 TCTGCTTTGCGAAGGAAGGATGG - Intergenic
1067419510 10:46134052-46134074 ACTGATGTGGAGGGGCAGGAAGG + Intergenic
1067504862 10:46840649-46840671 ACTGATGTGGAGGGGCAGGAAGG + Intergenic
1067860362 10:49840447-49840469 TCTGACTTTCAGAGTCAGGTAGG + Intronic
1068425577 10:56859334-56859356 GCTGATGGGCAGAGGCTGGAAGG - Intergenic
1068966544 10:62917529-62917551 TATGATTTGCAGAGACAGTGGGG - Intronic
1069745435 10:70712123-70712145 TGTGATTTGCAGAGTCTGGGTGG - Intronic
1069848784 10:71391505-71391527 TGTGCTGTGCAGAGGCAGCAAGG - Intergenic
1069945438 10:71982285-71982307 GCTGGTTTGCAGATGGAGGAAGG + Intronic
1070359689 10:75675535-75675557 TTTAATTTCCAGAGGCAGCATGG + Intronic
1071668333 10:87582548-87582570 GCTGATTTGCAGAAGCAAAATGG - Intergenic
1073541624 10:104319869-104319891 CCTGAATTCCAGAGGGAGGAGGG - Intronic
1073579702 10:104653961-104653983 AATGATTACCAGAGGCAGGAAGG - Intronic
1074441533 10:113481410-113481432 TCTGAAGAGGAGAGGCAGGATGG + Intergenic
1075344266 10:121670704-121670726 GCTGATTTGGAGAGCCAGGAGGG - Intergenic
1075945277 10:126427653-126427675 TCTGATGTCCAACGGCAGGAGGG - Intronic
1076471650 10:130723259-130723281 CCTGAATTCCAGAGGAAGGAAGG + Intergenic
1077558195 11:3237604-3237626 CCTGAATTCCAAAGGCAGGAAGG + Intergenic
1078011833 11:7578346-7578368 AGTGTTTTTCAGAGGCAGGAAGG + Intronic
1078268286 11:9771311-9771333 TCTAAATGGCAGGGGCAGGATGG - Intergenic
1078475989 11:11630639-11630661 TCAGATTTGGAGGGGTAGGAAGG - Intergenic
1081156287 11:39695933-39695955 TATGATCTGCAGAGTCAAGACGG - Intergenic
1081587837 11:44399266-44399288 TCTGAGAGGCCGAGGCAGGAGGG + Intergenic
1083221451 11:61255524-61255546 TCCTATTTGCAGAGGCAGGTGGG + Intergenic
1087348454 11:97000861-97000883 GCTGATTTGAAGAGGAATGAGGG + Intergenic
1088052170 11:105530245-105530267 TCTGGTTTGGAGAGTCTGGAGGG + Intergenic
1088541567 11:110919043-110919065 GCTGGTCTCCAGAGGCAGGAGGG + Intergenic
1088712672 11:112522818-112522840 TCTGAGTTCCAGAAGCAGAATGG + Intergenic
1088817939 11:113434093-113434115 TCTGAGCTGGAGTGGCAGGAAGG - Intronic
1089072003 11:115707795-115707817 TCTGATTTGCAGTCACATGATGG - Intergenic
1089215472 11:116832138-116832160 ACTGATGGGCAGGGGCAGGATGG - Intronic
1089689668 11:120179434-120179456 TCTGATTTAATGAGGCAGCAAGG - Intronic
1090212081 11:124928187-124928209 TCTGATGCGCAGAGCCAGTAGGG - Intronic
1090704367 11:129323109-129323131 GCTGATCTGCAGAGGCACGCAGG + Intergenic
1091995408 12:4989023-4989045 GCTGATAGGCAGAGGCAGAAAGG - Intergenic
1094057745 12:26283944-26283966 TCTGATGTCCAAGGGCAGGAGGG - Intronic
1094095577 12:26700604-26700626 TCTGCTTTATGGAGGCAGGAGGG - Intronic
1094701819 12:32877816-32877838 ACTGAACTGCAGAGTCAGGAGGG + Intronic
1096046438 12:48566773-48566795 TCTGGTTTCCAGAGACAGGAAGG + Intergenic
1099240659 12:80134843-80134865 TCTGATATGCAGAGATATGAGGG - Intergenic
1101040843 12:100753938-100753960 TCTGTGTTTCAGAAGCAGGATGG - Intronic
1102027545 12:109722109-109722131 TCTGACGGGCAGAGCCAGGAAGG + Intronic
1103060973 12:117858429-117858451 TCTGATGTGCATATGCAAGATGG + Intronic
1104211856 12:126696603-126696625 GCTGAACTGCAGAGGCAGGAAGG + Intergenic
1104745971 12:131210798-131210820 TGTGAAGAGCAGAGGCAGGAGGG + Intergenic
1105023656 12:132834630-132834652 TGTGCTTTGCAGAGGGAGCAAGG - Intronic
1105836361 13:24215768-24215790 TCTGCTTGGCAGAGGCAGACTGG - Intronic
1106051535 13:26194765-26194787 TCTGATGTTCAAGGGCAGGAAGG + Intronic
1106450384 13:29876421-29876443 TCAGCTTTGGAGAGGCAGAATGG + Intergenic
1106625723 13:31419170-31419192 TCTAAATTGCAGAGGAAGGGAGG + Intergenic
1108490790 13:50979126-50979148 TCTGATTTGAAGATGGAGGTGGG + Intergenic
1108585669 13:51867674-51867696 TCTGATTCTCAGAGGAAGCAGGG + Intergenic
1110647053 13:77899633-77899655 ACTGATTGGCTGAGGCAGTAGGG + Intronic
1110738733 13:78969243-78969265 TATTATTTGTAGAGGCAGGATGG - Intergenic
1111818364 13:93183416-93183438 TGTGCTTTGCAGATGGAGGAAGG - Intergenic
1114522307 14:23347207-23347229 TCAGATCTGCAGAAGCAAGAGGG + Exonic
1115215099 14:31006310-31006332 TCTGAAAGGCTGAGGCAGGAGGG + Intronic
1115649110 14:35390526-35390548 TCTGCATTACAGAGGCAGGATGG + Intergenic
1116759890 14:48998939-48998961 TCTGATGTTCAAGGGCAGGAAGG - Intergenic
1116813599 14:49563305-49563327 TTTGGATGGCAGAGGCAGGAGGG + Intergenic
1117664202 14:58039328-58039350 TCTGATAAACAGAGGCAAGATGG - Intronic
1119185740 14:72641187-72641209 AGTGATTTGGAGAGGCATGAGGG - Intronic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1119867432 14:77985583-77985605 TGTGATTCACAGAGGCAGGAGGG + Intergenic
1121317291 14:92969890-92969912 TCTGATTTGGAAAGGCAGAGAGG - Intronic
1121564898 14:94901884-94901906 TCTGCTTTGCAGAAGCTGGGAGG + Intergenic
1121898280 14:97669326-97669348 TCTTATTTGCAGAGTAATGATGG + Intergenic
1121957017 14:98223510-98223532 CCAGGTTTGCAGAGTCAGGAGGG - Intergenic
1122243917 14:100387764-100387786 CCTTATTCTCAGAGGCAGGAGGG - Intronic
1122282851 14:100634462-100634484 ACTGAACGGCAGAGGCAGGATGG - Intergenic
1122563511 14:102634263-102634285 TTTGGTTGGCCGAGGCAGGAGGG + Intronic
1122628371 14:103096004-103096026 CCTTATTTGCAGGGGCTGGAAGG + Intergenic
1124008115 15:25810801-25810823 ACTCATTTTCAGAGCCAGGAAGG + Intronic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1126450841 15:48807127-48807149 TCTGAGAAGCAGAGGCTGGAGGG - Intronic
1126765148 15:52004149-52004171 TCTGAGTCACAGAGGGAGGAGGG + Intronic
1128725199 15:69982840-69982862 TCTGAGGAGCAGAGGCAGGGTGG + Intergenic
1128770095 15:70275620-70275642 TCAGGGTTGCAGAGGCAGAAAGG + Intergenic
1128787054 15:70405379-70405401 TCTGAATAGCAGAGAGAGGAAGG + Intergenic
1129439381 15:75569130-75569152 TCTGATATACCAAGGCAGGATGG + Intronic
1129915632 15:79267467-79267489 TTTGAGTAGCTGAGGCAGGAAGG + Intergenic
1130126272 15:81096726-81096748 TGTGAGTTTCAGAAGCAGGAAGG - Intronic
1130263939 15:82381584-82381606 TCTGATTTGCACAGGGACCAGGG - Intergenic
1130813706 15:87408243-87408265 TGTGATTTGCAGTGGGAGAAAGG - Intergenic
1132028970 15:98425278-98425300 TCTGATATGCAGGGGAGGGAAGG + Intergenic
1133383900 16:5353504-5353526 TCCCATTTGCAAATGCAGGATGG + Intergenic
1134248099 16:12554994-12555016 TCTTTCTTGCAGAGGCAGGCAGG + Intronic
1134659211 16:15971176-15971198 TCTGATTTGCATAGGCCTCAGGG + Intronic
1135186560 16:20320719-20320741 TGTTATTTGGGGAGGCAGGATGG + Intronic
1135247414 16:20868992-20869014 GCTGATGTGCAGAGGAGGGAGGG - Intronic
1135314406 16:21432332-21432354 TCTGGATTCCAGAGGGAGGAAGG + Intronic
1135367328 16:21864608-21864630 TCTGGATTCCAGAGGGAGGAAGG + Intronic
1135444485 16:22506550-22506572 TCTGGATTCCAGAGGGAGGAAGG - Intronic
1136311075 16:29411027-29411049 TCTGGATTCCAGAGGGAGGAAGG + Intergenic
1136324519 16:29512818-29512840 TCTGGATTCCAGAGGGAGGAAGG + Intergenic
1136439204 16:30252799-30252821 TCTGGATTCCAGAGGGAGGAAGG + Intronic
1136571275 16:31098455-31098477 TCTGGTTTGAAGATGGAGGAAGG + Intergenic
1137065554 16:35838438-35838460 TCTGAAAGGCAGAGGCAGGATGG + Intergenic
1140928991 16:79609753-79609775 TCTGGCTTGGAGATGCAGGAGGG - Intergenic
1141901227 16:86992262-86992284 TCTGAATTCCAAAGACAGGAGGG + Intergenic
1144567761 17:16374083-16374105 TCTGACTTGCCCAGGCTGGAGGG - Intergenic
1144755449 17:17677761-17677783 CCTCATGAGCAGAGGCAGGAAGG + Intergenic
1145791328 17:27629246-27629268 TCTGACTGGGAGGGGCAGGAAGG - Intronic
1146541718 17:33701836-33701858 ACTGATGTGCAGAGGCAGGCTGG - Intronic
1146715197 17:35080114-35080136 TCTAATTTGGAGAGAGAGGAAGG - Intronic
1146967572 17:37045929-37045951 TCTGATTTGCAGAGGCAGGAAGG + Intronic
1148748592 17:49931878-49931900 TCGGCTTGGCAGAGCCAGGAGGG - Intergenic
1149036304 17:52138181-52138203 TGTGCTTTGAAGAGGAAGGAAGG - Intronic
1149628126 17:58094557-58094579 TTTGATTTGCAGTGGCAGAGAGG + Exonic
1149932377 17:60769226-60769248 TGTGATAGGCAGGGGCAGGATGG + Intronic
1150538059 17:66065403-66065425 TCTGTTAGGCAGAGGCAGAATGG - Intronic
1151215849 17:72575857-72575879 ACTCACTTGCAGAGGCAGGAGGG + Intergenic
1151809090 17:76425855-76425877 TCTGAGTTAGAGAGACAGGATGG - Intronic
1154266159 18:12881011-12881033 TCTGTTAGGCAGTGGCAGGAGGG - Intronic
1155043501 18:22084512-22084534 ACTATTTTGCAGAGGCAGCAGGG - Intergenic
1155958109 18:31970964-31970986 TCTGACTTTCAGAAGGAGGATGG - Intergenic
1157056739 18:44238285-44238307 TCTGATTTAAAAAGGCAGGAAGG - Intergenic
1158366348 18:56741467-56741489 TCAGATTTGTAGGAGCAGGAAGG - Intronic
1160417225 18:78719913-78719935 TCTGATTTTCAGACCCAGGTGGG + Intergenic
1160543740 18:79639303-79639325 CCTGAATTCCAGAGGGAGGAGGG - Intergenic
1163290508 19:16376568-16376590 TCTGATGTGAGGAGGCAGGATGG - Intronic
1166391454 19:42411016-42411038 TCTGATTCCCAGAGACAAGAGGG - Intronic
1166643565 19:44514381-44514403 TCTGCTTTGGAGGGGCAGGAGGG + Intronic
1166919227 19:46217452-46217474 GCTGCATAGCAGAGGCAGGAAGG + Intergenic
1167367565 19:49062950-49062972 TCAGAGTTGCACAGGAAGGACGG - Intronic
1167409539 19:49336915-49336937 CCAGATCTGCAGAGGCACGAAGG - Exonic
1167718639 19:51161627-51161649 TCTGATTTGAAAAGGCATGATGG - Intergenic
925093187 2:1171852-1171874 TCACATTTGCAGAGGCAGATTGG + Intronic
925519783 2:4730644-4730666 TCTGCTTTGCTGAGACAGAAAGG - Intergenic
925644102 2:6018406-6018428 TCTGATGTCCAAGGGCAGGAGGG - Intergenic
925984008 2:9200571-9200593 GCTGATGTGCACAGGCAGGGAGG + Intergenic
927054375 2:19355996-19356018 TCTGATTTCCAGCGCCTGGAAGG - Intronic
927238285 2:20898226-20898248 TCTGATGTGAAGATGCAGCAGGG + Intergenic
927425165 2:22973415-22973437 TCTGATGTTCAAGGGCAGGAAGG - Intergenic
927443261 2:23135032-23135054 TTGGATTTGCAGGGGCAGCAGGG + Intergenic
928295923 2:30083950-30083972 TGTAAATTGCAGAAGCAGGAAGG + Intergenic
928329399 2:30346373-30346395 TCTGATTTCTGGAGGCAGCATGG - Intergenic
931062836 2:58549976-58549998 ACAAATTTGTAGAGGCAGGAAGG + Intergenic
932134039 2:69213047-69213069 TCTGAGAAGCTGAGGCAGGAGGG - Intronic
932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG + Intronic
933991182 2:87634897-87634919 TCTGGCTGGTAGAGGCAGGAGGG + Intergenic
935956022 2:108377420-108377442 TCTGATTATCAGGGGCAGAATGG + Intergenic
936251333 2:110870445-110870467 ACTGAATTCCAGGGGCAGGAGGG + Intronic
936302657 2:111315926-111315948 TCTGGCTGGTAGAGGCAGGAGGG - Intergenic
937111109 2:119367608-119367630 CCGGATTGGCAGAGGCAGGCGGG - Exonic
937151747 2:119691060-119691082 GTTGATTTTCTGAGGCAGGAAGG + Intergenic
937377451 2:121347360-121347382 TCTGGGGTGCAGAAGCAGGAGGG + Intronic
937547353 2:123038915-123038937 TCTGATTGGCCGAGGCTGGTGGG - Intergenic
938337702 2:130513812-130513834 CCTGATTTGAACAGGAAGGAGGG - Intergenic
938352137 2:130606923-130606945 CCTGATTTGAACAGGAAGGAGGG + Intergenic
939496525 2:142933512-142933534 CTTAGTTTGCAGAGGCAGGAGGG + Intronic
940074920 2:149731062-149731084 GCAGATTTGCAGATGCAAGATGG + Intergenic
940711439 2:157167149-157167171 TCTGATGTCCAAGGGCAGGAGGG - Intergenic
940744564 2:157553250-157553272 TCTGATTATCAAAGGCAGGGAGG + Intronic
940846885 2:158651482-158651504 ACTGATTTGGACAGGCAGGTGGG - Intronic
941857045 2:170241921-170241943 TGTGAGATGCAGAGGCAGCAGGG + Intronic
942515906 2:176753003-176753025 TTTGAATTGCAGGGGCTGGAGGG + Intergenic
943029015 2:182664612-182664634 TTTGGTTTGAAGAGGAAGGAAGG + Intergenic
943732455 2:191317050-191317072 TTTGATTTGCGGAGGCCGAAGGG + Intronic
943785653 2:191875645-191875667 GCTGAGTGGCAGAGCCAGGATGG - Intergenic
945212077 2:207394287-207394309 TCTGTATTGCATAGTCAGGAAGG + Intergenic
946015863 2:216603289-216603311 TTTGATTCTCAGAGGCAGGGAGG + Intergenic
946028793 2:216689232-216689254 CCTGATGTGGAGAGGCAGGCAGG - Intronic
946854424 2:223939183-223939205 TCTGATTTGGAAAGTCAGGTGGG - Intronic
948041151 2:234902593-234902615 TCTGACCTGGAGAGGGAGGAGGG + Intergenic
948233796 2:236371440-236371462 TGTGCTTTCCAGAGGCAGGGGGG + Intronic
948349129 2:237323726-237323748 TCTGATTTTCAGAGTCAGGCTGG - Intergenic
948645931 2:239404549-239404571 GCTGATCTTCACAGGCAGGAGGG + Intergenic
948860737 2:240751510-240751532 TCTGACTTGCTGCTGCAGGAAGG - Intronic
948873142 2:240813592-240813614 TCTGATATGCAGGGGCAGCTTGG + Intronic
1170269990 20:14515683-14515705 ACTGGTTAGCAGAGGCTGGATGG + Intronic
1170523687 20:17215312-17215334 CCTGGTCTGCAGAGGCAGGAAGG + Intergenic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1171235644 20:23522190-23522212 TCTGAATTCCAAAGGGAGGAGGG + Intergenic
1171265640 20:23769855-23769877 TGTGATTAGCAGAGGAAAGAAGG + Intergenic
1172101411 20:32485754-32485776 TCTCATTTTCAGAGTGAGGATGG - Intronic
1172175668 20:32970583-32970605 TCTGAATGGCGGAGCCAGGATGG - Intergenic
1173170016 20:40716311-40716333 TCTGTCTTGAAGAGTCAGGAAGG + Intergenic
1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG + Intronic
1175138821 20:56844449-56844471 TCTGAGTTGAAGACACAGGAAGG - Intergenic
1175593355 20:60211416-60211438 TCTGAGTTGTACAGCCAGGAAGG - Intergenic
1175630485 20:60531361-60531383 TGTGTTTTAAAGAGGCAGGATGG + Intergenic
1175771860 20:61629054-61629076 TCTGATCTGCACAGGCAGGCAGG + Intronic
1176343287 21:5717691-5717713 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1176501540 21:7606765-7606787 CCTTATTAGAAGAGGCAGGAAGG + Intergenic
1176537608 21:8115760-8115782 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1177242452 21:18477060-18477082 TCTGACTTGCAGAGTAATGAGGG + Intronic
1178145479 21:29734992-29735014 TCTGACTTGGATAGGCAGGGAGG - Intronic
1178438425 21:32579537-32579559 CCTGATTTGAAGAAACAGGATGG - Intronic
1179040768 21:37800617-37800639 TCGGTTTTGCAGAGACAGGCAGG + Intronic
1179165388 21:38931645-38931667 TCTGCTTTGCAGCGGCAGGCAGG - Intergenic
1179600531 21:42474654-42474676 TCTGACTTGCACAGGGAGGGTGG - Intronic
1179771845 21:43625702-43625724 GCTGATTTGCAGAGGCTTGGGGG - Intronic
1179928587 21:44551899-44551921 TGTGATTGGGAGAGCCAGGATGG + Intronic
1181086105 22:20440113-20440135 TCTGGTCTGCAGGGGCAGGAAGG - Intronic
1181685566 22:24525450-24525472 TGTGGTCTGCTGAGGCAGGATGG - Intronic
1182517544 22:30867551-30867573 TCTGTTCTGCAGAGACAGGCAGG - Intronic
1182670354 22:31990556-31990578 TCTGAGTGGAAGAGTCAGGATGG + Intergenic
1183037673 22:35152391-35152413 TCTGATTTGCATAGGCCTCAGGG + Intergenic
1183200535 22:36382976-36382998 TCTGAGAGGCTGAGGCAGGAGGG + Intronic
1183325404 22:37188617-37188639 TCTGAGTCACAGAGGCAGGGTGG + Intronic
1183747006 22:39697852-39697874 CCTCATTCGCAGAAGCAGGAAGG - Intergenic
1183811731 22:40263380-40263402 GCTGGTTTGGAGAGCCAGGAAGG - Intronic
1203242554 22_KI270733v1_random:32115-32137 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
949346353 3:3080407-3080429 TCAGTTTTGCAGAGGGAGGGAGG - Intronic
949360559 3:3227982-3228004 TCTGGTGTGGGGAGGCAGGATGG - Intergenic
950397996 3:12748876-12748898 TTGGATTTGGAGAGCCAGGAAGG + Intronic
950542305 3:13619849-13619871 TCAGGTTTGCACAGGTAGGAGGG - Intronic
950573830 3:13818907-13818929 TCTGACTTGCAGCGGGAGGGTGG + Exonic
953225261 3:41013096-41013118 TCTGATTAGCAGAATAAGGAAGG - Intergenic
954112281 3:48440775-48440797 TAGGATTTGCAGCGGCAGTAAGG + Intronic
954580320 3:51699689-51699711 TATGCTTGGCAGAGGGAGGAAGG + Intronic
954600816 3:51866734-51866756 CCTGATTAGCATATGCAGGAGGG - Intergenic
955611849 3:60765900-60765922 TCTGATGTCCAAGGGCAGGAGGG - Intronic
956039627 3:65132345-65132367 TGTGATTTGCAGATGGAGGTTGG + Intergenic
958180352 3:90051876-90051898 TTTGTATTGCAGGGGCAGGAAGG + Intergenic
958876952 3:99627336-99627358 TCTGATGGGGACAGGCAGGATGG - Intergenic
959605514 3:108237157-108237179 TCTGATTTTCTGAGGCACAATGG + Intergenic
959651960 3:108758740-108758762 TTTGATAGGCTGAGGCAGGAGGG + Intergenic
960096001 3:113690571-113690593 TCTGAATTGAAGAGGAGGGAAGG - Intronic
961602549 3:128072673-128072695 TGTGAATTGCTGAGGCAGGCAGG + Intronic
961612960 3:128155072-128155094 TTTCATTTGCAGAGATAGGAGGG - Intronic
962392333 3:134983642-134983664 TCTGCTTTGCACAGGCAGCATGG - Intronic
962414198 3:135167691-135167713 TCTGCTTTCTGGAGGCAGGAAGG - Intronic
962675936 3:137758559-137758581 TCTGATTTGCATTGGCAGTCAGG - Intergenic
963305610 3:143649142-143649164 TCTTAATTTCAGAGGCAGCATGG - Intronic
964161595 3:153652147-153652169 CATGATTTGGAGAGGCAAGAGGG - Intergenic
964547233 3:157848063-157848085 TCTATTTTTCCGAGGCAGGAGGG - Intergenic
964624942 3:158749791-158749813 TCTGATTTCCAAAGGTTGGAGGG - Intronic
965226383 3:165997855-165997877 TCTGATGTCCAAGGGCAGGAAGG + Intergenic
965552301 3:169979631-169979653 TGTGATTTTGAGAGGCAGGTGGG - Intronic
966638341 3:182160339-182160361 TCTGAATTGTAAAGGCATGAGGG - Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
969070791 4:4537058-4537080 ACTGCTGTGCAGAGGCAGCAGGG - Intronic
969319760 4:6404632-6404654 TCTGAGTTGCAGAGGGATGCTGG + Intronic
969352110 4:6603963-6603985 TCTGATTTGGAGAGGGAGGCTGG - Intronic
969842595 4:9893388-9893410 TCTCATTTGCAGGGGGAGGGCGG + Intronic
969844921 4:9912986-9913008 GCTGACTTGCAGATGCAGAAAGG + Intronic
970043240 4:11820561-11820583 TCTGAGTCTCAGAGGCTGGATGG + Intergenic
973823559 4:54684098-54684120 ACTCAGTAGCAGAGGCAGGAAGG + Intronic
973925392 4:55732064-55732086 TCTGACTAGCAGAGGTAGGTGGG - Intergenic
973961746 4:56117466-56117488 TCTGATTGCCAGAGGCTGGAAGG + Intergenic
973971461 4:56217708-56217730 CCTGAATTGCAAAGGGAGGAAGG + Intronic
974101648 4:57423584-57423606 TCTCATGTGATGAGGCAGGAAGG + Intergenic
974208230 4:58735480-58735502 TCAGATTAGCAGTAGCAGGAAGG - Intergenic
974335940 4:60544416-60544438 TCTGATTTGTAGAGATAGGAAGG - Intergenic
974669856 4:65015367-65015389 CCTGATTTCCAAAGGGAGGAAGG + Intergenic
975317364 4:72970002-72970024 ACTTATTGGCAGAAGCAGGAGGG + Intergenic
975325473 4:73053970-73053992 TCTCATTTCAAGAGTCAGGAAGG - Intergenic
976864657 4:89709421-89709443 GCTTATTTTCAGAGGCGGGAGGG + Intergenic
978212614 4:106156608-106156630 TCTGCTTTCCATAGGCAGAAGGG + Intronic
979438492 4:120722648-120722670 TCTGATTTGCAGACGCATTTGGG + Intronic
979749663 4:124263152-124263174 TCTGATATACAGAGGAAGAAAGG - Intergenic
981903311 4:149891528-149891550 TCTGAATTCCAAAGGGAGGATGG + Intergenic
982122074 4:152152282-152152304 TGTGTTTGGAAGAGGCAGGATGG + Intergenic
982122491 4:152156466-152156488 TGTGATTTTCAGAGGCAGAGAGG - Intergenic
983415181 4:167443360-167443382 TCTGATGTCCAAGGGCAGGAAGG - Intergenic
984210260 4:176838828-176838850 TGTGACTTGCACAGACAGGAAGG + Intergenic
984335722 4:178387470-178387492 TATGATTTGCACAGACAGAAAGG + Intergenic
984709362 4:182872260-182872282 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
984814543 4:183824417-183824439 TCTGATTTGAAAAGGCACGCTGG + Intergenic
984894887 4:184529573-184529595 TCTTGTGTGCAAAGGCAGGAAGG - Intergenic
985420979 4:189785089-189785111 TCTGATTTTCCAAGGCAGGTAGG - Intergenic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
986986563 5:13506939-13506961 GCAGATTTGCACAGGGAGGAGGG + Intergenic
987363682 5:17129277-17129299 TCTGATTTGCTGAGTAAAGATGG + Intronic
987933121 5:24427945-24427967 TCTGATCTGCAGAGAAAGTAAGG - Intergenic
988092642 5:26562857-26562879 TCTTAGTTCCAGAGGGAGGAAGG + Intergenic
988267538 5:28971783-28971805 TCTTAGTTCCAGAGGGAGGAAGG - Intergenic
988796742 5:34658200-34658222 TCTGAATTGAAGAGACAGAAAGG + Intronic
989106888 5:37871298-37871320 TCTGTGTTGCAGAACCAGGAAGG - Intergenic
989214289 5:38888158-38888180 TCTGATTTGCATAGGGCTGAGGG + Intronic
989328607 5:40228813-40228835 TTAGATTTGAGGAGGCAGGAAGG - Intergenic
992145166 5:73839644-73839666 TCTGAATGGCAGAGAAAGGACGG - Intronic
992238585 5:74739458-74739480 TCTAAATTGGAGAGGCATGATGG - Intronic
992497282 5:77306147-77306169 TCTGTTTTGCAGAGTCTGAATGG + Intronic
992768431 5:80024591-80024613 TATGATCTGGAGAGGCAGCACGG - Intronic
994605331 5:101960150-101960172 GCTGCTTTGCAGAGGTAGTAAGG + Intergenic
996147511 5:119993862-119993884 GCTGATCTGCAGAGAAAGGAGGG - Intergenic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
998797988 5:145839186-145839208 ACTGAGCTGCAGGGGCAGGAAGG - Intergenic
999116120 5:149164716-149164738 TCATATTTGGAGAGGGAGGAGGG + Intronic
999122001 5:149216945-149216967 TTTCATTTCCATAGGCAGGAGGG + Exonic
999207067 5:149856692-149856714 CCTGATTTGCAGAAGCAGTATGG + Intergenic
999301106 5:150490967-150490989 GCAGATTTGTAGAGGTAGGAGGG - Intronic
999690598 5:154142821-154142843 TGTGCTTTGAAGAGGGAGGACGG - Intronic
1000730760 5:164830920-164830942 TCTGATGTTCAAGGGCAGGAAGG - Intergenic
1002040515 5:176510598-176510620 TCTGATTTACAGATTCTGGATGG + Intergenic
1002043952 5:176531937-176531959 TCTGAGAGGCAGAGGCAGCAAGG - Intronic
1002151790 5:177239618-177239640 TCTTATGGGAAGAGGCAGGATGG - Intronic
1003075233 6:2977905-2977927 TCTGAATTCCAAAGGGAGGAAGG + Intergenic
1003758827 6:9151652-9151674 TCTTAGTTCCAGAGGGAGGAAGG + Intergenic
1004486999 6:16075963-16075985 TCAGAGTAGCAGAGGCAGAAGGG - Intergenic
1005187452 6:23179196-23179218 TCAGATTTGCCAAGGCAGGAAGG + Intergenic
1006648573 6:35532619-35532641 ACTGTTTTGCAGAGGCTGGAGGG - Intergenic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1008037889 6:46765234-46765256 TAGGATTTGGAGAAGCAGGAGGG - Intergenic
1008476019 6:51936715-51936737 TCTGAATTCCAAAGGGAGGAGGG - Intronic
1009380324 6:63020268-63020290 TCTAATTTGCAGTCCCAGGATGG - Intergenic
1009562368 6:65263791-65263813 CTTGATAGGCAGAGGCAGGACGG + Intronic
1009908819 6:69902265-69902287 GCTGCTTTGCAGAGTCAGCATGG + Intronic
1010124304 6:72414368-72414390 TCTGGTTTGCTGGGGAAGGAGGG - Intergenic
1010451665 6:76010934-76010956 TCTGATTCCCAGAAGAAGGAAGG + Intronic
1010650060 6:78443693-78443715 TCTGTCTTCCAGAGGCAAGAAGG + Intergenic
1011128245 6:84029576-84029598 TCCGATATGAAGAGGCAGCATGG - Intergenic
1011786973 6:90857867-90857889 TCTGAATTGGAGAGCCAAGAGGG + Intergenic
1013094236 6:106929822-106929844 TCTGAGTGGGAAAGGCAGGAGGG + Intergenic
1013912258 6:115290412-115290434 TGTGCTTTGCAGATGCAGAAAGG + Intergenic
1014028189 6:116672629-116672651 TCTGATGTCCAAAAGCAGGAAGG - Intergenic
1014389515 6:120843353-120843375 TCTGACCTGCAGGGGCAGAAGGG - Intergenic
1015029922 6:128582616-128582638 TCTTTTTTGCAGAGGCAAGTAGG - Intergenic
1015328609 6:131951483-131951505 TGTGAGTTGATGAGGCAGGAAGG - Intergenic
1016244770 6:141968741-141968763 TCTGATGTCCAAGGGCAGGAAGG - Intergenic
1016312123 6:142745538-142745560 TGTGATTGGCAGAGGGAGGAGGG + Intergenic
1016876701 6:148872785-148872807 TGTGTTTTGCAGATGGAGGAAGG - Intronic
1016948016 6:149551945-149551967 TGTGATAGGCAGAGGCAGAATGG + Intergenic
1018513738 6:164555258-164555280 ACTGATTTGCAAAGCGAGGAGGG + Intergenic
1021938620 7:25656287-25656309 CTTGATTTGCATGGGCAGGAAGG + Intergenic
1022177403 7:27885006-27885028 TCTGCTCTGCACAGGAAGGAGGG + Intronic
1022859625 7:34354224-34354246 TCTCATATGCAGAGGCCAGATGG - Intergenic
1022977150 7:35569271-35569293 TCTGTCTTGAAGAGGCAAGACGG + Intergenic
1024034511 7:45495806-45495828 CCTGAATTCCAGAGGGAGGAGGG + Intergenic
1024151407 7:46575597-46575619 TCTTACTTGAAGAGGGAGGATGG + Intergenic
1024883088 7:54111768-54111790 TGGGATGTGCAGAGACAGGAAGG - Intergenic
1025227709 7:57178913-57178935 TCAGCTCTGCCGAGGCAGGAAGG - Intergenic
1025230833 7:57202414-57202436 TCAGCTCTGCCGAGGCAGGAGGG - Intergenic
1025730168 7:64101402-64101424 TCAGCTCTGCTGAGGCAGGAAGG + Intronic
1026699560 7:72628047-72628069 TCTGAGAGGCCGAGGCAGGAGGG + Intronic
1027697180 7:81426385-81426407 TCTGATTTTAATAGGCAGGTAGG - Intergenic
1029349369 7:100002200-100002222 TCTTAGTTGCAGGGGCAGAATGG + Intergenic
1029842398 7:103379749-103379771 TTTGATTCACAGAAGCAGGAAGG + Intronic
1031640744 7:124161247-124161269 CCTGGGTTGCAGAGGCAGAAGGG - Intergenic
1033741676 7:144280884-144280906 TCTGCCTTTCAGAGGCAGGGAGG - Intergenic
1033752225 7:144368730-144368752 TCTGCCTTTCAGAGGCAGGGAGG + Intronic
1038142276 8:24858959-24858981 TCTGATTCCAAGAGGCTGGAAGG - Intergenic
1039414031 8:37378567-37378589 TCTGATGTCCAAGGGCAGGAGGG + Intergenic
1039786027 8:40834833-40834855 TCTGAGTACCAGAGGCAGGTGGG + Intronic
1039951826 8:42178991-42179013 TGTGATGTGCAGCGGCTGGATGG + Exonic
1040073100 8:43204449-43204471 TGTGGCTTGCACAGGCAGGAGGG + Intergenic
1043510695 8:80947399-80947421 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
1043877787 8:85506000-85506022 TCTGGTTTGGAGAGGCAAGAGGG + Intergenic
1045013990 8:97982912-97982934 TGTGGTCTGGAGAGGCAGGAAGG - Intronic
1045504531 8:102769179-102769201 TCTGATTTGAAGGAGGAGGATGG - Intergenic
1045842191 8:106593489-106593511 TCTGATTTGGCCAGGCACGATGG + Intronic
1046381213 8:113453281-113453303 TCTGATGTCCAATGGCAGGAAGG - Intergenic
1047160219 8:122369817-122369839 TCTGATGTCCAAGGGCAGGAGGG + Intergenic
1047965338 8:130042260-130042282 TCTGCTTGGCAGAGGCGGAAGGG + Intergenic
1048907749 8:139104708-139104730 TCTGAGATGCTGAGGCAGGGAGG + Intergenic
1050823443 9:9913620-9913642 TCTAATTTGCTGAGTCAGGAGGG + Intronic
1050997893 9:12242796-12242818 TCTGATTTGCCCAGCTAGGAAGG + Intergenic
1051014636 9:12460230-12460252 TGTGTTTTGCAGAGACAGAAAGG - Intergenic
1051070971 9:13166586-13166608 ACTGATTTCCAGAGGAGGGAAGG + Intronic
1051143444 9:14002783-14002805 TCAGATTTGTTGAGGCAAGAAGG + Intergenic
1051215789 9:14795905-14795927 TCTCATTTTAAGAGGCAGGGAGG - Intronic
1051565173 9:18489251-18489273 TTTGATTTTCACAGGGAGGAAGG - Intronic
1052372420 9:27680451-27680473 TCTGAGTGGCAGAGACATGACGG + Intergenic
1052728210 9:32255704-32255726 TCTAATTTACAGTGGCAGAAAGG + Intergenic
1054824310 9:69556785-69556807 TCTAATGTGCAGAGGCAGCGTGG + Intronic
1056380845 9:86055933-86055955 TCTGATTTCCAGAGGAAACATGG - Intronic
1056523927 9:87425273-87425295 TGAGATTTGCAAAGGAAGGAGGG + Intergenic
1056930079 9:90867000-90867022 TCTCATTGGCAGGGACAGGAGGG + Intronic
1057942714 9:99298910-99298932 ACTGTTTTCCACAGGCAGGAAGG + Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059765753 9:117382295-117382317 TCTGAGTTCAAGAGCCAGGAGGG + Intronic
1060767402 9:126305155-126305177 TCTGGTTTGCAGAGGGAGTGTGG - Intergenic
1062269207 9:135701017-135701039 TCTGAGTTCCCCAGGCAGGAGGG + Intergenic
1203458880 Un_GL000220v1:15198-15220 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1185632220 X:1523511-1523533 TGTGATTGCCAGAGGGAGGAGGG + Intronic
1186807731 X:13156565-13156587 TATGCTTTGCAGATGGAGGAAGG + Intergenic
1188074194 X:25755151-25755173 TCTGATTTGAAGAGACAGGGAGG + Intergenic
1188869025 X:35351274-35351296 CCAGAGTTGGAGAGGCAGGAAGG + Intergenic
1188990038 X:36807175-36807197 GCTGCTTTGGAGATGCAGGAAGG - Intergenic
1189502511 X:41576429-41576451 GCTGTGTTGGAGAGGCAGGAAGG - Intronic
1191629811 X:63311026-63311048 TCTTAGTTCCAGAGGGAGGAAGG - Intergenic
1192085926 X:68097313-68097335 TACTATTTGGAGAGGCAGGAGGG + Intronic
1192282349 X:69699965-69699987 CTTAGTTTGCAGAGGCAGGAGGG + Intronic
1194478268 X:94388082-94388104 TGTGGTTTTCAGAGGCAGGTGGG + Intergenic
1195676542 X:107511399-107511421 GCTGATTTCCAGAAGCAGCAGGG - Intergenic
1196092180 X:111756491-111756513 CCTGAGTTGTAGAGGCAGGTGGG + Intronic
1196634633 X:117988203-117988225 TCTAAGTTGCAAAGGCAGAAAGG + Intronic
1198223893 X:134627848-134627870 TCCCAATTACAGAGGCAGGATGG + Intronic
1199018629 X:142848689-142848711 TCTGATTTGCATAGGGCGCAGGG - Intergenic
1199597879 X:149522435-149522457 AGAGATTGGCAGAGGCAGGAAGG - Intronic
1200790862 Y:7298003-7298025 TCTGAAGTGCAGATGCAGCAGGG + Intergenic