ID: 1146968610

View in Genome Browser
Species Human (GRCh38)
Location 17:37054213-37054235
Sequence CCTGGGGCCCAGGAGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 762
Summary {0: 1, 1: 0, 2: 5, 3: 89, 4: 667}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146968610_1146968622 27 Left 1146968610 17:37054213-37054235 CCATGCTGCTCCTGGGCCCCAGG 0: 1
1: 0
2: 5
3: 89
4: 667
Right 1146968622 17:37054263-37054285 AGGGAGTGGAAGAGTCAGCCAGG 0: 1
1: 0
2: 3
3: 48
4: 414
1146968610_1146968621 13 Left 1146968610 17:37054213-37054235 CCATGCTGCTCCTGGGCCCCAGG 0: 1
1: 0
2: 5
3: 89
4: 667
Right 1146968621 17:37054249-37054271 GTCTGTCTCAGAGAAGGGAGTGG 0: 1
1: 0
2: 3
3: 52
4: 398
1146968610_1146968619 7 Left 1146968610 17:37054213-37054235 CCATGCTGCTCCTGGGCCCCAGG 0: 1
1: 0
2: 5
3: 89
4: 667
Right 1146968619 17:37054243-37054265 TGCTTTGTCTGTCTCAGAGAAGG 0: 1
1: 1
2: 3
3: 30
4: 316
1146968610_1146968620 8 Left 1146968610 17:37054213-37054235 CCATGCTGCTCCTGGGCCCCAGG 0: 1
1: 0
2: 5
3: 89
4: 667
Right 1146968620 17:37054244-37054266 GCTTTGTCTGTCTCAGAGAAGGG 0: 1
1: 0
2: 0
3: 18
4: 248
1146968610_1146968623 30 Left 1146968610 17:37054213-37054235 CCATGCTGCTCCTGGGCCCCAGG 0: 1
1: 0
2: 5
3: 89
4: 667
Right 1146968623 17:37054266-37054288 GAGTGGAAGAGTCAGCCAGGAGG 0: 1
1: 0
2: 1
3: 20
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146968610 Original CRISPR CCTGGGGCCCAGGAGCAGCA TGG (reversed) Intronic
900161714 1:1227192-1227214 CCTGGGGTGCAGGAGCAGGTAGG - Intronic
900203661 1:1421987-1422009 CCTGGGGGCCTGGGGCAGGATGG + Intergenic
900393163 1:2442643-2442665 CCTTGGGTGCAGAAGCAGCATGG + Intronic
900397766 1:2460228-2460250 CCTGGGACCCCGGGGCAGCATGG - Intronic
900398737 1:2464150-2464172 TCTGGGGCTCAGAAGCAGCTGGG + Intronic
900408779 1:2503717-2503739 ACTGGGCCCCAGCAGCAGCAGGG + Intronic
900480333 1:2895082-2895104 CCAGGAGCCGAGGAGCAGCGCGG - Intergenic
900529288 1:3144850-3144872 CCTGGTGGCCAAGAGCAGAAGGG - Intronic
900535115 1:3173186-3173208 CCTGAGCCCCGGGGGCAGCAAGG - Intronic
900541488 1:3205162-3205184 CCGGGGGGCCAGGGGCAGAAGGG + Intronic
900606517 1:3525992-3526014 GCAGGGGCCCAGCAGCTGCAGGG - Intronic
900697857 1:4023329-4023351 CCTGGGTCACGGGAGCTGCAGGG - Intergenic
900711364 1:4116632-4116654 CCAGGAGCCAAGGAGCACCAAGG - Intergenic
901137922 1:7009659-7009681 TCTGGGGGACAGAAGCAGCAGGG - Intronic
902301474 1:15505618-15505640 CCTGAGTCCCACCAGCAGCAAGG + Intronic
902530260 1:17086297-17086319 CGTGGGGAGCAGAAGCAGCAAGG + Intronic
902663323 1:17920490-17920512 CCTGGAGCAAAAGAGCAGCACGG - Intergenic
902839222 1:19064916-19064938 ACTGAGGCCCAGGAGGGGCAGGG - Intergenic
902939864 1:19793161-19793183 GGTGGGGTCCAGGAGCTGCAAGG - Intronic
902940004 1:19794091-19794113 GGTGGGGTCCAGGAGCTGCAGGG - Intronic
902943055 1:19814366-19814388 CCGGGGGCCCAAGGGCAGAAAGG + Exonic
903016353 1:20364673-20364695 GATGGGGCCCTAGAGCAGCAGGG + Intergenic
903170978 1:21553453-21553475 CCTGTGTCCCAGGAACATCAGGG - Intronic
903596737 1:24501383-24501405 GATGGGGAGCAGGAGCAGCACGG + Intergenic
903678682 1:25082821-25082843 GCTGGGGGCCAGGAGCAGGTGGG + Intergenic
904253178 1:29238600-29238622 CCTATGGCCCCGGAGCTGCAGGG - Intronic
904424895 1:30416889-30416911 GCTGGGGGCCAGGAGCTGCCAGG + Intergenic
904688652 1:32277437-32277459 CCTAGGGCTCAGGGGCAGAAGGG - Intronic
905253804 1:36666718-36666740 CCCTGGGCCCAGGAGAAGGAAGG + Intergenic
905629495 1:39510860-39510882 TCTGGGTCCCAGGACCAGCCGGG + Intronic
906195826 1:43930319-43930341 CAAGGGCCCCAGGGGCAGCAAGG + Exonic
906252209 1:44319357-44319379 CTTGGAGACCAGGAGCAGAATGG - Intronic
906762266 1:48386875-48386897 CCTGGAGCCCAGTGGCAGCAGGG + Intronic
906920976 1:50064064-50064086 CCCAGAGGCCAGGAGCAGCATGG + Intronic
907051834 1:51334899-51334921 CCTGGGGGCCAGGAACGGCCTGG - Intronic
908128748 1:61054049-61054071 CCTGAGGCGCAGGAGCTGCTCGG - Intronic
909342260 1:74545314-74545336 CCTGAGAACCAGGAGCACCAAGG - Intergenic
909562992 1:77025815-77025837 GCTGGGGCCCTGTAGCTGCAGGG - Intronic
911672867 1:100627114-100627136 CCTGGGCCCCTGGTGCAGGATGG - Intergenic
911857188 1:102894322-102894344 CCTGGAGTCCAAGAGCAGCCTGG + Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916170618 1:161999003-161999025 GCAGCGGCCCAGGAGCAGCGAGG + Intronic
916786468 1:168090597-168090619 CCTGGGGCACAGCAGCAGCACGG - Exonic
919086902 1:192931178-192931200 GTTTGGGCCCTGGAGCAGCAGGG - Intergenic
919170887 1:193952628-193952650 CCATGAGCCCAGGACCAGCAAGG - Intergenic
919474417 1:198017026-198017048 CCTGAGGACCAGGAGCACCAAGG + Intergenic
919601121 1:199623814-199623836 CCTGGGGGCCAAGAGAAACATGG - Intergenic
919960594 1:202464101-202464123 CCTGGGGCTCAGGTGTAGCAGGG - Intronic
920107660 1:203565784-203565806 CCTGGGGCACAGGAAGAGAAGGG - Intergenic
921196142 1:212759908-212759930 CCTGGGGCCACCCAGCAGCAAGG + Intronic
921850623 1:219928856-219928878 CCTGAGGGCCAGGAGAAGCGGGG - Intronic
922132618 1:222794926-222794948 CTTGGGGCCCGGGAGCAGGTGGG + Intergenic
922362283 1:224834122-224834144 CCAGGGGCACAGGAGGAGGAAGG - Intergenic
922454617 1:225764672-225764694 CCTGGGGGACAGGAGGAACAGGG + Intergenic
922473126 1:225888780-225888802 CCATGGGACCAGGGGCAGCAGGG + Intronic
922554165 1:226520402-226520424 CCTGGGGCCCAGCCTCAGCGGGG + Intergenic
922976229 1:229785655-229785677 CCTTGGGGACAGGAGCTGCAGGG + Intergenic
923032824 1:230263440-230263462 GCTGGCCCACAGGAGCAGCAAGG - Intronic
924416847 1:243864839-243864861 CCTGGGAACCTGGAGCACCAAGG - Intergenic
924619753 1:245650277-245650299 CTTGGTGCCCAAGAGCAGTAAGG - Intronic
924948687 1:248863438-248863460 CTTGGGGGCCAGGAGCAGCCAGG + Intergenic
1062823709 10:553167-553189 ACTGGGGCCCAGGAAGAGCTGGG + Intronic
1063371034 10:5523377-5523399 CCTGGGGCCCAGGGGTGGCGTGG - Intergenic
1063602755 10:7497165-7497187 CCTGGGCCCCAGGAGCACTCAGG - Intergenic
1064212524 10:13372288-13372310 CCTAGGGCCAGAGAGCAGCAGGG - Intergenic
1065725830 10:28667273-28667295 CCTGGGGCCCAGCATTAGCTTGG - Intergenic
1065971793 10:30811488-30811510 CCTGGGAGCCAAAAGCAGCAAGG - Intergenic
1066057126 10:31692384-31692406 CATGTGGACCAGGAGCAGCAGGG - Intergenic
1067061378 10:43079675-43079697 CCCGGGGCCCAGGGGCAGAGAGG - Intronic
1067438377 10:46294451-46294473 GCTGGAGCCCAGGCCCAGCAGGG + Intronic
1067553806 10:47253918-47253940 GCTGGAGCCCAGAAACAGCAGGG - Intergenic
1067719914 10:48720322-48720344 TCTGTGTCCCAGGAACAGCAGGG - Intronic
1068549068 10:58385662-58385684 CCTGTGCCCTAGGGGCAGCAGGG + Intronic
1068638359 10:59373342-59373364 CCTTGGGCCCTGAAGCAGTAGGG + Intergenic
1068900957 10:62268733-62268755 CCGGGGGCGCAGGAGGAGCCGGG + Intergenic
1069652508 10:70059943-70059965 GCCGGGGCCCAGGAGCTACAGGG + Intronic
1069842225 10:71347013-71347035 CCTAGAGCCTAGGAGGAGCAGGG - Intronic
1070610232 10:77927238-77927260 CCCGAGGCCCAGGCGCAGCCGGG + Intergenic
1070826532 10:79393607-79393629 CGAGGGACCCAAGAGCAGCAGGG - Intronic
1071531489 10:86392934-86392956 CATGGGGCCCAGGACCCACAGGG - Intergenic
1071666519 10:87564021-87564043 CCTGGGGCTCAGCAGCTCCAGGG + Intergenic
1071776194 10:88790832-88790854 CCTGGGCTCAAGGAGCAACATGG + Intergenic
1072120978 10:92405481-92405503 CCAGGGCCCTTGGAGCAGCATGG + Intergenic
1072437710 10:95428988-95429010 CCTGGGGCCTAGGAGCCCCTGGG - Intronic
1073112728 10:101072196-101072218 CCTGGGGCGGGGGAGCAGCAGGG + Intergenic
1074596998 10:114876732-114876754 CCTGGGGCCAGGGCTCAGCACGG + Intronic
1075007626 10:118842187-118842209 CTTGGGGCCCAGGAGCAGGTGGG + Intergenic
1075399714 10:122152037-122152059 GCTGGGGCCCAGGGCCAGAAGGG + Intronic
1075415236 10:122258024-122258046 CCTGGGGCCCTGGAGAAGTGGGG + Intergenic
1075450252 10:122546357-122546379 CCTGGGGGCCAGCAGAGGCATGG + Intergenic
1075625693 10:123963062-123963084 CCTCTGCCCCAGGAGCAGTATGG + Intergenic
1075985908 10:126784787-126784809 CCTGGGGTCCAGGACCAGTTTGG + Intergenic
1076667944 10:132103435-132103457 CCTGGGGGAGAGGAGCAGCTGGG + Intergenic
1076879292 10:133231970-133231992 CCTTTGACCCAGGAGTAGCATGG + Intergenic
1077144105 11:1037132-1037154 CCTGGGATTCAGGTGCAGCAGGG - Intergenic
1077169177 11:1158764-1158786 CCTGGGCTCCTGGAACAGCAGGG + Intronic
1077251638 11:1563385-1563407 CCTGTGGCCCAAAAGCAGCCTGG - Intronic
1077319922 11:1936534-1936556 CGGCTGGCCCAGGAGCAGCAGGG + Intronic
1077363731 11:2152938-2152960 CCTGTGGCCCATGAACAGGAGGG + Intronic
1077364402 11:2155725-2155747 CCTCGGCCGCAGGAACAGCAAGG - Intronic
1077554051 11:3217597-3217619 CCTGTGACTCAGGTGCAGCAGGG + Intergenic
1078097727 11:8310952-8310974 CTGGGGGCCCAGGAGGGGCAGGG - Intergenic
1078537516 11:12186888-12186910 CCACGGGCCCATGAGCAGCTGGG + Intronic
1078931325 11:15913967-15913989 CCTGGGGAGCACGAGCAGCAAGG - Intergenic
1079115907 11:17640596-17640618 CCTGGGGCCCCTCAGCAGCCTGG - Intronic
1079182894 11:18209282-18209304 CCTGGTGCGCAGGAACCGCAGGG + Exonic
1080333827 11:31174110-31174132 CTTGGGAGCCAGGAGCAGAAAGG + Intronic
1080816981 11:35767899-35767921 CTTGGGGCCAAGGACCATCAGGG - Intronic
1081235058 11:40637028-40637050 TCTGGGCCCCCAGAGCAGCAAGG + Intronic
1081477423 11:43448251-43448273 CCTGGGGGCCATGGTCAGCATGG - Intronic
1081537660 11:44007140-44007162 CCTAGGGCCAGGGAGCTGCAGGG + Intergenic
1081864576 11:46352497-46352519 CCTGAGGCCCAGGCCCAGCCAGG + Intronic
1083491262 11:63016388-63016410 CCTGGGCCCCTGGGGCAGCCAGG + Intergenic
1083827100 11:65210143-65210165 CCTGGGGCATAGGAGCAGTGGGG - Intronic
1083878085 11:65535228-65535250 CTTTGGGGCCAGGAGCAGCATGG - Exonic
1083966477 11:66046842-66046864 CCTGGGTCCCAGGAGGGGTAAGG + Intronic
1084008302 11:66334597-66334619 CCCGAGCCCCAGGAGCTGCAGGG - Exonic
1084012953 11:66362868-66362890 CCTGGGGCCCAGGCCCAGCTGGG + Exonic
1084051439 11:66602746-66602768 CCTGGGCCCCAGGTGGGGCAGGG + Intronic
1084195964 11:67523718-67523740 CCTGGGTCCCAGGAGGAGGAAGG + Intergenic
1084334223 11:68447346-68447368 CTTGGGTCCCTGGAGCAGCAGGG + Intronic
1084459617 11:69289206-69289228 TCTCTGCCCCAGGAGCAGCAGGG + Intergenic
1085035453 11:73297200-73297222 CCTGTGGCCCAGGAGCGGCGTGG + Exonic
1085055227 11:73399319-73399341 GCTGAGGGCCAGGAGCAGGAGGG - Intergenic
1085593660 11:77789399-77789421 CCTGGGGCCCAGTGCCACCAGGG + Intronic
1086392495 11:86379765-86379787 CCAGGAGTCCAGGATCAGCATGG + Intronic
1086690108 11:89780202-89780224 CCTCGGGCCCCTCAGCAGCAAGG + Intergenic
1086698555 11:89872770-89872792 CCTCGGGCCCCTCAGCAGCAGGG - Intronic
1086707614 11:89971726-89971748 CCTCGGGCCCCTCAGCAGCAAGG + Intronic
1086715746 11:90059755-90059777 CCTCGGGCCCCTCAGCAGCAAGG - Intergenic
1087112232 11:94483253-94483275 GCTTGGGCCCAGGACCAGCTGGG + Intronic
1087826254 11:102767983-102768005 CCCAGAGCCCAGGAGCGGCAGGG - Intergenic
1088650969 11:111958071-111958093 CTTGGGGGCCAGGAGCAGGCAGG + Intronic
1088651017 11:111958252-111958274 CTTGGGGGCCAGGAGCAGGCAGG + Intronic
1088915865 11:114227286-114227308 CATGGGGCCCAGGAGGTGGATGG - Intronic
1089299463 11:117489933-117489955 CCTGGGGCACTGGAGGAGGACGG - Intronic
1089349937 11:117816518-117816540 CCTGGGGCCATGGATCAACAGGG + Intronic
1089505288 11:118958294-118958316 CCTGGGGCCTGGGAGCAGGTGGG - Exonic
1089643239 11:119861288-119861310 CCTGGGGCCCAGGATGGGGAGGG - Intergenic
1090358947 11:126159761-126159783 CCAGGGGCCCAGGCTCAGCACGG - Intergenic
1091286871 11:134412588-134412610 GCTGGGCGCCAGGAGCAGCCAGG - Intergenic
1091320641 11:134646894-134646916 CCTGGGCTCCAGGTGCAGAAGGG + Intergenic
1091695332 12:2624432-2624454 CCAGGGGCCGAGGCTCAGCAAGG + Intronic
1092094081 12:5827597-5827619 CCTTGGCCCCAGGAGCAGCGGGG - Intronic
1092149895 12:6240705-6240727 CCTAGGGCCACAGAGCAGCAAGG - Intergenic
1092868696 12:12786921-12786943 CCGGCGGCCCGGGAGCCGCATGG + Exonic
1094069763 12:26400173-26400195 CCTGAGGCCCTGGTTCAGCACGG + Exonic
1094852664 12:34389222-34389244 CCTGGGGCCCAGGAGACCCTGGG + Intergenic
1094856539 12:34405417-34405439 CCTGGGGCCCAGGGGACCCAGGG + Intergenic
1095982336 12:47980624-47980646 CCTGGGGCCAAGGGTGAGCAAGG - Exonic
1095984297 12:47989227-47989249 CCTTGGCTCCAGGAGCACCAGGG + Exonic
1096196844 12:49654081-49654103 GCAGGGTCCCAGGAGCATCAAGG + Intronic
1096557988 12:52415555-52415577 GCTGGGGCCCAGGGGCTGGAGGG - Intergenic
1098798426 12:74922743-74922765 CCTGGAGCCTAGGTGCAGCCTGG - Intergenic
1098986183 12:77014811-77014833 ACTGGGGCCAAAGAGCAGAAGGG + Intergenic
1101433466 12:104645612-104645634 CTTGGAGGCCAGGACCAGCAGGG - Intronic
1101514770 12:105424626-105424648 CGTGGGACCCAAGAGCAGAAGGG - Intergenic
1101603552 12:106231280-106231302 CCTTGGCCTCAGGAGCAGCCTGG - Intergenic
1102432625 12:112895619-112895641 CCTGGGGCAGAGGATCGGCACGG + Intronic
1102455251 12:113066872-113066894 CTTGGAGCCCAGGAGCTGCCGGG + Intronic
1102479099 12:113208634-113208656 CCTGGGGCCCAGGGTCACCCAGG + Intronic
1102955180 12:117054370-117054392 TCTGTGGACCAGCAGCAGCAGGG - Intronic
1103610683 12:122122444-122122466 CCTGGAGCCCAGGAGTTGGAGGG - Intronic
1104751956 12:131245508-131245530 CCTGGGCCCCTGCAGCACCAGGG - Intergenic
1104980101 12:132569860-132569882 CCTGGGCCACAGGAGGGGCAGGG + Intronic
1105302691 13:19150361-19150383 CCCAGGGCACAGGAGCATCAAGG + Intergenic
1105772029 13:23621015-23621037 CATGGGGCAGAGGAGCTGCAAGG - Intronic
1105804758 13:23946502-23946524 GCTGGGGGCCTGGAGCTGCAGGG - Intergenic
1106100832 13:26694345-26694367 CCTGGTGCCCAGGGGCATCTCGG - Intergenic
1107135330 13:36938252-36938274 CGAGGGGCTGAGGAGCAGCAGGG - Intergenic
1107434239 13:40367672-40367694 CCTAGGGCATAGGAGCATCAGGG + Intergenic
1107792772 13:44018677-44018699 GCTGGGGCCCAGGAGGGGAAAGG + Intergenic
1108017112 13:46087103-46087125 CTTGGGGGCCAGGAGCAGGCAGG - Intronic
1109396629 13:61766818-61766840 CCTGGGGGCCAGGAACAGGCAGG - Intergenic
1109470538 13:62799021-62799043 CTTGGGGACCAGGAGCAGGGAGG + Intergenic
1109563387 13:64078791-64078813 CCTGGGGGCCAGGAACAGTCAGG - Intergenic
1111002569 13:82205140-82205162 CTTGGGGACCAGGAGCAGGCAGG + Intergenic
1111512769 13:89287731-89287753 CTTGGGGGCCAGGAGCAGGCAGG - Intergenic
1112466218 13:99647076-99647098 CCTCAGGCCCATGAGCACCATGG - Intronic
1113082809 13:106535501-106535523 CCTGGGGGCCGGGAGCCGCGCGG - Intergenic
1113592795 13:111512733-111512755 CCTGGGTCCCAGGAGGAGGAGGG + Intergenic
1113740188 13:112707063-112707085 CATTGGGCCCAGGAGCCGCTGGG + Intronic
1114194540 14:20465646-20465668 ACTGAGGCCCAGGAAGAGCAAGG - Intergenic
1116992052 14:51286978-51287000 GCTGGTTCCCAGGAGCTGCAGGG - Intergenic
1117920369 14:60721997-60722019 ACAGGGGCCCAGAAGCGGCAAGG + Intronic
1118332200 14:64823484-64823506 CCTGGGAGCCAGAGGCAGCAGGG + Intronic
1118445145 14:65843793-65843815 CCTGGACCCCAGGAGCATCGTGG - Intergenic
1118674984 14:68174292-68174314 CCTGGAGCCCAGGAGTTCCAGGG + Intronic
1119712354 14:76831333-76831355 CCTGGGCCCCAGGGGTACCAAGG + Exonic
1120521223 14:85530301-85530323 CCTGGTGCCCAGCAGCGGCGAGG + Exonic
1121252987 14:92513592-92513614 GCTGGGGCCAAGGCGCCGCACGG - Intergenic
1121585560 14:95060773-95060795 CCTGGGGCCCTGGAGCAGGTGGG - Intergenic
1121610054 14:95272371-95272393 ACTGGGACCCAGGAACAGAATGG + Intronic
1121905048 14:97732162-97732184 CCTGGGGACCAGGGGCAGCCAGG + Intergenic
1122062142 14:99143202-99143224 CCAAGGGCCCAAGGGCAGCATGG - Intergenic
1122142180 14:99668952-99668974 CCTGGGGCCCAGGGCCAGGGTGG + Intronic
1122146430 14:99691626-99691648 CCTGGGGCCCAGGAGCCCTGGGG - Intronic
1122260535 14:100517726-100517748 CCTCAGCCCCAGGAGCAGCTGGG - Intronic
1122397353 14:101442634-101442656 CCTGTGGCCCAGGCGCACCAAGG + Intergenic
1122770116 14:104094050-104094072 CCTGGGGCCTGGGAGCATCTGGG + Intronic
1122789106 14:104176898-104176920 CCTGGAGCAGAGGAGCAGCCCGG + Exonic
1122789160 14:104177117-104177139 CCTGGCGCACAGCAGCAGCAAGG + Exonic
1122823040 14:104356598-104356620 GCTGGGGCCCAGCAGCTCCAGGG + Intergenic
1122954193 14:105062216-105062238 GCAGGGGCCCAGGGCCAGCAGGG - Intronic
1122987230 14:105218084-105218106 TGTGGGACCCAGGGGCAGCAGGG - Intronic
1123056470 14:105572876-105572898 CCTGGGGCCCAGCAGCCGTGGGG + Intergenic
1123057463 14:105578931-105578953 CCTGGGGCCCAGCAGCCGTGGGG - Intergenic
1123080903 14:105693004-105693026 CCTGGGGCCCAGCAGCCGTGGGG + Intergenic
1123081739 14:105698864-105698886 CCTGGGGCCCAGCAGCCGTGGGG - Intergenic
1123105365 14:105838961-105838983 CCTGGGGCCCTGGAGCATGGTGG + Intergenic
1124071245 15:26394892-26394914 TCTGGGGCCCAGAAGCAGGCAGG - Intergenic
1124340537 15:28886813-28886835 CCTGCAGCCCAGGAGCAACGGGG - Intronic
1124966556 15:34436827-34436849 CCTGCAGCCCAGGGGCAACAAGG + Intronic
1125234133 15:37491773-37491795 CCTGGGGCAGAGGAGTAACAGGG + Intergenic
1125508963 15:40282761-40282783 CGTGCGGCCCAGGAGCGGCGGGG - Intronic
1125525002 15:40369042-40369064 CCAGGTGCCCAGGAGCAGTGTGG - Exonic
1127351650 15:58158842-58158864 CCTGGGGCCAGGGACCACCAGGG - Intronic
1127883429 15:63178217-63178239 CCTGGGACTCAGGAGAAGCCTGG + Intergenic
1127921294 15:63496359-63496381 AATGGAGCCCAGAAGCAGCAAGG - Intergenic
1128104061 15:65029927-65029949 CCTTGAGCCCAGGAGCAGTGAGG - Intergenic
1128116804 15:65112774-65112796 CCTGGGGGCGAGGAGCAGTTTGG - Intronic
1128285921 15:66436984-66437006 TGTGGATCCCAGGAGCAGCAGGG - Intronic
1128359657 15:66953108-66953130 CCCGGGGCTCAGAAGCAGCCTGG - Intergenic
1128654878 15:69453185-69453207 CCGGGGGCCCAGGACCTGCCCGG - Intronic
1129330385 15:74824118-74824140 CCTGGGGCCTGGGATCATCAAGG - Intronic
1129524384 15:76204583-76204605 CCTGTGGCCCAGCTTCAGCAGGG + Exonic
1129674679 15:77626108-77626130 ACTGAGGCCCAGGAGCATCAGGG + Intronic
1129844113 15:78760391-78760413 CCTGGGGAGGAGGAGCAGGAAGG + Intronic
1129918626 15:79298482-79298504 CCTGGGGCGGTTGAGCAGCAGGG - Intergenic
1130081489 15:80737817-80737839 CCTGAGCCACAGGAGCAGAAGGG + Intronic
1130467620 15:84200306-84200328 GCTGGGGCACAAGAGCACCAGGG - Intergenic
1130496645 15:84473236-84473258 GCTGGGGCACAAGAGCACCAGGG + Intergenic
1130546101 15:84858317-84858339 CCGGGGGCCCAGGAAAAGCCTGG + Exonic
1130564170 15:84980736-84980758 CCTGGGGCCCATGAGGACCCCGG - Intronic
1130589912 15:85204904-85204926 GCTGGGGCACAAGAGCACCAGGG - Intergenic
1131171826 15:90184630-90184652 CCTGTGGCCCAGGTCCAGCGAGG + Intronic
1131261307 15:90889455-90889477 CCCTGGGCCCAGCAGGAGCAAGG - Intronic
1131983334 15:98017196-98017218 CCTGGGGCCTAGGACAGGCATGG - Intergenic
1132070877 15:98775659-98775681 CCAGGGACCCAGCACCAGCAGGG - Intronic
1132085005 15:98901265-98901287 ACTGGGGAGCAGCAGCAGCAGGG - Intronic
1132333090 15:101026085-101026107 CCTGTGGCCCTGGAGCCGGAGGG - Exonic
1132496516 16:265945-265967 CTTGGGCCTCAGGAGCAGCAAGG - Exonic
1132657214 16:1046373-1046395 CCACGGGCCCAGGAGCAGGGCGG - Intergenic
1132758225 16:1496259-1496281 CCTGGGGTCCTGGAGCAGCTCGG + Intronic
1132761551 16:1510927-1510949 CCTGGGGCCCAGGCCCCTCAGGG + Exonic
1132771222 16:1564581-1564603 CCTGGGTCCAAGGGGCAGCATGG - Intronic
1132818194 16:1845820-1845842 CCTGGGGTCCAAGGGCATCATGG - Intronic
1133232858 16:4374578-4374600 CTCGGGGCCCAGGGCCAGCAGGG - Intronic
1133598852 16:7319592-7319614 TCTGAGGCCCAGGAAAAGCATGG - Intronic
1134031417 16:10995411-10995433 CCAGGGGCCCAGGAGCATGTTGG + Intronic
1134043514 16:11085196-11085218 CCTGGGTTCCAGGAGGATCACGG + Intronic
1134080790 16:11323664-11323686 CAGGGGACCCAGGAGCTGCATGG - Intronic
1134109604 16:11506874-11506896 CCGGGGGCCCAGGAGCTGCTTGG + Intronic
1134636878 16:15799374-15799396 GCTTGGGCCCAGGGGCAGAAAGG - Intronic
1135128027 16:19827777-19827799 CCTGCGAGCCAGGAGCACCAAGG - Intronic
1136020968 16:27439828-27439850 CCCAGGGCCCAGGAGGAGGAAGG - Intronic
1136146807 16:28320936-28320958 CCTCGGACCCGGGAGCAGCCCGG + Exonic
1136666837 16:31819686-31819708 GCCGGAGCCCAGGAGCAGCCAGG - Intergenic
1136686112 16:31995888-31995910 CCTGGGCCCCAGGGGCTGCCGGG - Intergenic
1136768331 16:32810983-32811005 GCTGGGCTCCAGGAGCAGCCCGG - Intergenic
1136786725 16:32939417-32939439 CCTGGGCCCCAGGGGCTGCCGGG - Intergenic
1136883047 16:33914373-33914395 CCTGGGCCCCAGGGGCTGCCGGG + Intergenic
1137434563 16:48445049-48445071 CCTGGGGCCCAGGAGCTGGCAGG + Intronic
1137553657 16:49456718-49456740 CCTGGGGCCAAGAAGCCTCAAGG + Intergenic
1137613927 16:49835943-49835965 CCTGGGCCCAAGGAGCAGTTTGG + Intronic
1137709011 16:50553834-50553856 CCTGGTGCCCATGAGCAGAGGGG - Intronic
1138151168 16:54658527-54658549 ACAGTGTCCCAGGAGCAGCAAGG + Intergenic
1138191936 16:55020786-55020808 CCTGGGACCCAGCTGCAGCATGG - Intergenic
1138878229 16:60979177-60979199 GCGGGAGCCCAGGAGCAGGATGG + Intergenic
1139324120 16:66138745-66138767 CCTGGGGCCAAGAAGCCGCTAGG - Intergenic
1139546704 16:67653113-67653135 CCGGGGGCCCAGGGGCGGCAGGG - Exonic
1139552516 16:67682809-67682831 ACTGAGGCCCAGGAGCATTAAGG - Intronic
1139916221 16:70430088-70430110 CCGAGGGCCCAGGAGCATCAGGG - Intronic
1139949482 16:70662216-70662238 CCTGGGGGTCAGGAGCACCTTGG - Exonic
1140051909 16:71488992-71489014 CCTGGGCACCAGGAGAGGCAAGG - Exonic
1141179421 16:81742432-81742454 GCTGGGCCCCAGGAGTAGGATGG - Intronic
1141505027 16:84471349-84471371 CCTGGGGCTCAGCAGCACCAGGG + Intergenic
1141553048 16:84819053-84819075 GCTGGGGCCCAAGGGCAGGAGGG - Intergenic
1141673036 16:85502846-85502868 CCTGGGGACCAGGAGCAAGCAGG + Intergenic
1141962324 16:87417533-87417555 CCTCAGACCCAGGAGCAGAATGG - Exonic
1142033289 16:87848973-87848995 CCTGGGGGCCAAGGGCAGCAAGG + Intronic
1142196848 16:88742923-88742945 CCTGGGGCTGAGGGGCTGCAAGG + Intronic
1142264720 16:89058454-89058476 CCTGGGTCCCAGGGGCAGGGAGG - Intergenic
1142292158 16:89198165-89198187 CATGGTGCCCAGCAGCAGCACGG + Exonic
1203070723 16_KI270728v1_random:1072999-1073021 GCTGGGCTCCAGGAGCAGCCCGG - Intergenic
1203088961 16_KI270728v1_random:1201087-1201109 CCTGGGCCCCAGGGGCTGCCGGG - Intergenic
1142511189 17:394606-394628 CCTTAGGCCCAAGGGCAGCATGG - Intergenic
1142619220 17:1154331-1154353 CCCGGGGCCCACGGGCAGCCCGG + Intronic
1142880367 17:2878770-2878792 CCTGCTGCCCAGGAGCCCCACGG + Intronic
1143498420 17:7325294-7325316 CCTGGGCGGCAGGGGCAGCACGG + Exonic
1143735606 17:8910116-8910138 CCTGGGGCAGAGGAGCAGGGAGG + Intronic
1144790474 17:17855637-17855659 CCTGAGTCCCAGGAGCATAAGGG + Intronic
1144948591 17:18982252-18982274 CCTGGGGCTCAGCAGCAGGTGGG + Intronic
1145281642 17:21472269-21472291 CTTGGGGTCCAGAAGCAGCAAGG - Intergenic
1145367695 17:22278488-22278510 CCTGCGGAGCAGGAGCAGCTGGG - Intergenic
1145395794 17:22493354-22493376 CTTGGGGTCCAGAAGCAGCAAGG + Intergenic
1145737117 17:27240765-27240787 CCTGGGGCCCAGAGGAAGAAAGG - Intergenic
1146399210 17:32490128-32490150 GCTGGGCCTCAGGTGCAGCAAGG - Exonic
1146721806 17:35129303-35129325 CCTGGGCCCCAGCAGGAGCAGGG + Intronic
1146893934 17:36527550-36527572 CCTGGGGCTGAGGCGCAGCATGG + Exonic
1146968610 17:37054213-37054235 CCTGGGGCCCAGGAGCAGCATGG - Intronic
1147147074 17:38491556-38491578 CCTGGGCCCCAGGGGCTGCCGGG - Intronic
1147165696 17:38592072-38592094 CCTGGGGCCCTCTGGCAGCAGGG - Intronic
1147319297 17:39636406-39636428 CCAGGCACCCAGGAGGAGCAAGG - Exonic
1147337879 17:39738180-39738202 CCTGGGGCCCTGGTGCGGCTGGG - Intronic
1147674342 17:42194345-42194367 CCTGGGGCTCAGGAGGGACAAGG - Intronic
1147689036 17:42304300-42304322 CCTGGGGCCCATGTGGAGCTGGG + Intronic
1148436225 17:47687986-47688008 CCTGTGGCCAAGGAGCACCTGGG - Intergenic
1148878613 17:50707836-50707858 CCTGCGGGCCGGGAGCAGCAGGG - Exonic
1149459357 17:56814508-56814530 CCTTGGGCCCCGGAGCAGGCTGG - Intronic
1149607624 17:57936053-57936075 CCTGGAGCCAAGCAGCATCAGGG + Intronic
1149610260 17:57954556-57954578 CCTGGGGCACAGGAGCCGGCGGG + Intronic
1150622890 17:66821801-66821823 CCTGGGGCCCTGGAGGATCCAGG - Intergenic
1150952670 17:69821196-69821218 CCTGGGGCCCAGAAGCAGGCAGG + Intergenic
1151028945 17:70712786-70712808 CATCGGGCCCAGTAGCAACATGG + Intergenic
1151223540 17:72631707-72631729 CCCAGGGCTCAGGAGCCGCAAGG + Intergenic
1151365167 17:73612272-73612294 CCTGCAGCCCAGGTGCAGCTGGG - Intronic
1151365185 17:73612336-73612358 CCTGCAGCCCAGGTGCAGCTGGG - Intronic
1151464788 17:74277564-74277586 ACTTGGGCCCTGGAGCAGCTGGG - Intronic
1151493606 17:74446689-74446711 GCTGGGCCCCAGGAGCAGCCTGG - Intronic
1151961357 17:77407659-77407681 CCTGGGGCGGAGGAGCAGGCAGG - Intronic
1152205705 17:78973415-78973437 CCTGGGGAACAAGAGCAGCTAGG + Intronic
1152266437 17:79297506-79297528 CCAGGGTCCCAGGAGCAGGCTGG + Intronic
1152782893 17:82234232-82234254 CCTGGGGTCACTGAGCAGCAGGG - Exonic
1153225726 18:2898287-2898309 CCTGGGACCCAGGACTAGCCCGG + Intronic
1153649719 18:7229340-7229362 TCAGGGTCCCAGGAGCAGCAGGG + Intergenic
1154324877 18:13382799-13382821 CCTGGGCCTCAGGAGTAGCATGG + Intronic
1156012363 18:32510021-32510043 TCTGGGGCCACAGAGCAGCATGG - Intergenic
1157290296 18:46405311-46405333 CCTGGCTCCCAGCAGCAGCAGGG - Intronic
1157305464 18:46513903-46513925 CCTGGGGCTGGTGAGCAGCAGGG + Intronic
1157423730 18:47567586-47567608 CATGGGGCTGTGGAGCAGCAGGG + Intergenic
1157557347 18:48621563-48621585 CCTGGGCTCCAGGAGCAGCCTGG - Intronic
1157590690 18:48834839-48834861 CCCGGAGCCCGAGAGCAGCAGGG + Intronic
1158550208 18:58429533-58429555 CCTGGGAGCAAGGAGAAGCACGG - Intergenic
1160012321 18:75115552-75115574 GCTGGGTCCCAGCAGCAACAGGG - Intergenic
1160242589 18:77133662-77133684 CCAGGGGACCTGGAGCAGCCTGG + Intronic
1160584344 18:79904275-79904297 CCTGGGGCTCAGGGGCACCCAGG + Intronic
1160748128 19:720874-720896 CCTGGGCCCCAGGATCAGGCTGG - Intronic
1160856436 19:1220046-1220068 CCTGTGGTCCTGCAGCAGCAAGG - Intronic
1160963930 19:1737351-1737373 CCTGGGGCACAGCAGGTGCATGG - Intergenic
1161007476 19:1943822-1943844 CCTGGGGGCCTGGGGCAGCTCGG - Intronic
1161210515 19:3062954-3062976 CCCAGGGCCCTGGAGCAGCGGGG - Exonic
1161294443 19:3512617-3512639 CTTGGGTCCCTGGAGCTGCAGGG + Intronic
1161394283 19:4037175-4037197 CCTGGGGCTCAGCACCTGCAGGG + Intronic
1161453738 19:4360246-4360268 CCTTGGGCTCAGGAGCACCTGGG + Intergenic
1161573847 19:5044759-5044781 CCTGGGGCGCAGGAGAGGGATGG - Intronic
1161639826 19:5414954-5414976 CCAGGAGCTCAAGAGCAGCATGG - Intergenic
1161684415 19:5695919-5695941 CCTGCGGCCGAGGAGCAGATGGG - Intronic
1161701489 19:5798281-5798303 CCTGGGGCCCCTGAGCAGGTGGG + Intergenic
1161769430 19:6223284-6223306 CCTGGGTCCCAGGTACCGCACGG + Intronic
1162027198 19:7901049-7901071 TCTGGGGCCCAGGAGGATCTGGG + Exonic
1162041744 19:7975063-7975085 CCCCGGGCCTGGGAGCAGCACGG - Intronic
1162150721 19:8643646-8643668 CCTGAGAGCCAGGAGCACCAGGG - Intergenic
1162346092 19:10118998-10119020 CATGGGGATCAGGAGCGGCAGGG + Intronic
1162558036 19:11399869-11399891 CCTGGGGCCCTGGAGAGGCCGGG + Exonic
1162795026 19:13082551-13082573 CCCAGGGCTGAGGAGCAGCAGGG - Intronic
1162867757 19:13561746-13561768 CCTGAGAACCAGGAGCACCAAGG - Intronic
1162966180 19:14157193-14157215 CCTGGGGGCCGGGAGAAGAAGGG - Intronic
1163113878 19:15177975-15177997 CCTGGGGGGCAGGCGCAGCGCGG + Exonic
1163134232 19:15297860-15297882 CCAAGGGACCAGGTGCAGCACGG + Intronic
1163294139 19:16401419-16401441 ACAGAGGCCCAGGAGCAGAAGGG + Intronic
1163352978 19:16791020-16791042 CCAGGAGCTCAGGAGCAGCCTGG + Intronic
1163433996 19:17284245-17284267 CCTGGGGTCCAGCAGCAGATAGG - Exonic
1163468517 19:17483677-17483699 CCTGGGGCCCATGAGCCTCATGG + Intronic
1163520356 19:17788137-17788159 CCTGGGGCCCAGTGGCAACAGGG + Intronic
1163755392 19:19103662-19103684 CCTAGGGCCCAGAAGCAAGATGG + Intronic
1163799695 19:19356959-19356981 CCTGGGCCCCAGAAGCTGGAGGG - Exonic
1163801223 19:19367038-19367060 ATGGTGGCCCAGGAGCAGCAAGG + Intergenic
1164590667 19:29505155-29505177 GCTCAGGCCCAGGAGCTGCAGGG - Intergenic
1165092770 19:33395518-33395540 CCTGGGTGGCAGGAGCAGCGGGG - Intronic
1165360244 19:35332039-35332061 CCAGGGGCCGAGGAGATGCATGG - Exonic
1165388274 19:35524433-35524455 CCTGGCTCCCAGGGGCACCAGGG + Intronic
1165463613 19:35959185-35959207 CCCGGGGCAGAGGAGCTGCAGGG + Intergenic
1165712875 19:38024545-38024567 TCTGGGGCCCAGGGCCAGCTGGG - Intronic
1165740607 19:38203213-38203235 GCTGAGGGGCAGGAGCAGCATGG + Intronic
1165745418 19:38227812-38227834 CCTGGGGAGAAGGAGCTGCAGGG - Intronic
1165825173 19:38701647-38701669 CGTGGGGCCCAGGAGGATCCTGG - Intronic
1165900589 19:39167565-39167587 CCTGGGCCCCAGGGCAAGCAGGG + Intronic
1165902088 19:39173752-39173774 CAGGGGGCCCAGGAACAGCAGGG - Exonic
1165988070 19:39787917-39787939 CCTGGGGCCACTGGGCAGCAAGG - Intergenic
1166338647 19:42123754-42123776 CCTGGGGTCTAGGACCAGGAAGG - Intronic
1166806902 19:45492940-45492962 TTTGGGGCCCAGGAGCAGGGAGG - Intronic
1167156575 19:47742698-47742720 CCAGGGGGCCAGGAGCAGGCTGG - Exonic
1167221094 19:48198666-48198688 CCTTGGGCCCAAGAGCTGGAAGG - Intronic
1167774359 19:51545027-51545049 CCTGGAGCCCAGATGCAACAGGG + Intergenic
1167797592 19:51719800-51719822 CATGAGGCCCAGGATGAGCAGGG + Exonic
1168146497 19:54422313-54422335 GCTGCGGCCCAGCAGCTGCAGGG + Exonic
1168337722 19:55605754-55605776 CCGGGGGCCCGGGTGCAGCGGGG + Intronic
1168377460 19:55892502-55892524 GCTGGGGCCCAGGAGGTGGAGGG - Intronic
1168486486 19:56766872-56766894 GCTTGGGCCCAGGAGCTGGAGGG + Intergenic
1168723527 19:58568709-58568731 CCTGGGTCTCAGGAACAGGAAGG + Intronic
925082436 2:1081006-1081028 CCATGGCCCCAGGAGAAGCAAGG + Intronic
925179388 2:1807117-1807139 CCTGGGAGACAGGAGCAGCCTGG + Intronic
925470604 2:4157232-4157254 GCTGTGGCCTGGGAGCAGCATGG - Intergenic
925515196 2:4674256-4674278 CTTGGGGGCCAGGAGCAGGCAGG + Intergenic
925901586 2:8512992-8513014 TCAGGGGCACAGCAGCAGCAGGG - Intergenic
926105215 2:10145668-10145690 CCTGGGGCCCAGGACCACTGAGG - Intronic
926500864 2:13650690-13650712 CCTTGGGCCGAGGTGCAGCAAGG - Intergenic
926689915 2:15726001-15726023 CCGCGAGCCAAGGAGCAGCAAGG - Intronic
927755178 2:25702502-25702524 ACTGGGACCCAGGAAGAGCATGG - Intergenic
927800972 2:26099461-26099483 CCTGGGGACCAGGGGTAGCAGGG - Intronic
927809546 2:26173642-26173664 CGGGGGGCCCAGGGGCAGCGGGG - Intronic
928633712 2:33220756-33220778 CCTGAGGCCAAGGAGCTGAATGG + Intronic
930957152 2:57216999-57217021 CTTGGGGGCCAGGAGCAGGCAGG + Intergenic
931260912 2:60618306-60618328 TTTGGAGCCCAGGAGCAACAGGG + Intergenic
932363082 2:71126065-71126087 GCTTGAGCCCAGGAGCAACATGG - Intronic
932408519 2:71530396-71530418 GCAGGGACCCAGGAGCAGCCCGG - Intronic
932459418 2:71872731-71872753 CCTGGGGACATGGAGCAGAAGGG + Intergenic
932593381 2:73080129-73080151 CCTGGGCCTCAGGAGCCTCAGGG + Intronic
932596250 2:73095457-73095479 CCTCTGGGCCAGCAGCAGCATGG - Intronic
932626156 2:73297525-73297547 CCTGGGGCCATGGAGATGCAGGG + Intergenic
932701856 2:73997585-73997607 CCTGGGTCCCAGGATCTACAAGG + Intronic
932831071 2:74990676-74990698 CCAGGGGCAACGGAGCAGCAAGG + Intergenic
933721214 2:85398768-85398790 CTTGGGGCCCAGGACCTGCAGGG + Exonic
934026251 2:88003579-88003601 CCTCGGGGGCCGGAGCAGCAGGG - Intergenic
934567875 2:95350584-95350606 GCAGGGGGCCCGGAGCAGCAGGG + Intronic
934683440 2:96303158-96303180 CCTGGTCCCCAAGAGCAGCCTGG + Exonic
934769800 2:96900444-96900466 CCAGGTGCCGAGGGGCAGCAGGG + Intronic
935592037 2:104853327-104853349 CCTGCAGCCCAGGACCAGCGCGG - Intergenic
936288152 2:111197683-111197705 ACTGGGGCCCAGGGGAAGGAAGG - Intergenic
936444824 2:112587148-112587170 CATGGGGCCCAGGAGAAGGATGG - Intronic
937076713 2:119112646-119112668 CATGGGGACCAGGGGCAGCTAGG - Intergenic
937199507 2:120189915-120189937 ACTGGTTCCCAGGAGCAGAAGGG + Intergenic
937283603 2:120736469-120736491 CCTGGGGCTCTGGACGAGCAGGG + Intronic
937511267 2:122598153-122598175 GGTGGGGCCTAGGGGCAGCAGGG - Intergenic
938180768 2:129179698-129179720 CTTGAGGCCCAGGAGCAGGTGGG - Intergenic
939096042 2:137834570-137834592 CCTGCCGTCCAGGTGCAGCATGG - Intergenic
939161251 2:138592440-138592462 CCTGAGAACCAGGAGCATCAGGG + Intergenic
940694392 2:156959975-156959997 CTTGGGGGCCAGGAGCAGGCAGG - Intergenic
941015078 2:160346340-160346362 CATGGGGCCCTGGGGCAGCCTGG + Intronic
941634752 2:167924651-167924673 CCTGGGGCACATGAGTAGGAAGG + Intergenic
945766882 2:213991558-213991580 GCGGGGGTCCAGGAGCACCAGGG - Intronic
946167230 2:217871748-217871770 CCTGGGCCCCAGGAGATGAAGGG + Intronic
946169436 2:217885887-217885909 CCTGTGGCGTAGGGGCAGCAGGG - Intronic
946195462 2:218030175-218030197 CCGGGGAGCCAGGAGCAGCCAGG + Intergenic
946404356 2:219484553-219484575 CGTGGGGCCGAGGAGGAGGATGG + Exonic
946491359 2:220152164-220152186 GCTGGGCCCCAGGATCAGCATGG - Intergenic
948585190 2:239014933-239014955 CCAGGGACCCAGGTACAGCATGG + Intergenic
948757697 2:240168905-240168927 CCTTGGGGTCAGGAGCAGCTTGG + Intergenic
948822453 2:240557130-240557152 CCTGGGGCCCAGGGTTAGCCGGG - Intronic
948843808 2:240673234-240673256 CGTAGGGCCCTGGAGCAGAAGGG + Intergenic
948849955 2:240701070-240701092 CGTAGGGCCCTGGAGCAGAAGGG - Intergenic
948861726 2:240755830-240755852 CCTGGGGCCCAGGAGGTGCAGGG + Intronic
948918706 2:241051603-241051625 CCTGGGGCCTGGCTGCAGCAGGG - Intronic
1168750328 20:277430-277452 CCTGGGGCCCAGGTGCTTGAGGG - Intronic
1168940780 20:1709352-1709374 GCTGGGTCCCAGGAGGACCAGGG - Intergenic
1168970860 20:1929884-1929906 CAAGGGGCCCAGGAGCCTCAGGG - Intronic
1169200211 20:3705613-3705635 CTGGAGGCCCAGGAGCAGCCTGG + Intronic
1169889255 20:10434759-10434781 CCTGGAACCCAGAAGCAGGATGG - Intergenic
1170443324 20:16400035-16400057 CCTGTAGCCAAGGAGCAGCATGG - Intronic
1170500120 20:16966890-16966912 TCTGAGGCCCAGAAGAAGCAAGG - Intergenic
1171395282 20:24829176-24829198 CGTGGGGCCCAGGTGATGCAGGG + Intergenic
1171971567 20:31568259-31568281 CCTTGGGCCCCGGGGCAGTAGGG - Intronic
1172038726 20:32028938-32028960 CCTGAGGGCCAGGAGCTGGAGGG + Intronic
1172147638 20:32767943-32767965 GCTGGGGCCCAGTGGCAGCCTGG - Intronic
1172290097 20:33769939-33769961 CCTGGGATCCAGTAGCAGCAGGG + Intronic
1172836979 20:37879295-37879317 CCTGGGGCCCAGGAGAGCCTGGG + Intergenic
1173249019 20:41354841-41354863 ACTGCAGCCAAGGAGCAGCAGGG + Exonic
1173437903 20:43048964-43048986 CCTGACTCCCAAGAGCAGCAGGG + Intronic
1173604876 20:44324757-44324779 TCTGGGGCACAGGGTCAGCAGGG + Intergenic
1174168748 20:48603518-48603540 CCTGGGGCCCAACAGCTGCTGGG + Intergenic
1174282168 20:49447199-49447221 CCTGGGGCCCAGGGACACAAAGG + Intronic
1174599503 20:51712938-51712960 CCTGTGGCCCAGGAGCCAGAAGG + Intronic
1174809773 20:53635761-53635783 CCTGGAGCTCAAGAGCAGCCTGG + Intergenic
1175192385 20:57220033-57220055 CCTTGGTCCCAGGAGGAGAAGGG + Intronic
1175265660 20:57701985-57702007 TTTGGGGCCCAGGAGCACCCTGG - Intronic
1175413158 20:58784783-58784805 CAGGAGCCCCAGGAGCAGCACGG + Intergenic
1175681158 20:60989870-60989892 CCATGGGCCCTGGAGCAGCTGGG + Intergenic
1175715131 20:61250500-61250522 ACTGGGGTCCAGGAGCAGGTGGG - Intergenic
1175725208 20:61313293-61313315 CCGGAGACCCAGAAGCAGCAGGG + Intronic
1176074944 20:63244189-63244211 CCTGAGGTCCAGGAGAGGCAGGG - Intronic
1176095972 20:63344814-63344836 GCTCTGGCCGAGGAGCAGCAGGG + Exonic
1176111220 20:63411597-63411619 CCTGGGGCCCTGGTGGAGGAAGG + Intronic
1176276860 20:64277543-64277565 CCTGATGCCCAGCAGCAGCAGGG - Intronic
1176300044 21:5095113-5095135 CCAGGGTCCCGGGAGCTGCAGGG + Intergenic
1178095675 21:29212500-29212522 TCTGGGCCCCAGCAACAGCACGG - Intronic
1178413710 21:32386986-32387008 ACTGTGGGCCAGGTGCAGCACGG - Intronic
1179481606 21:41682092-41682114 CCAGGGGTCCAGGTGCAGAAGGG - Intergenic
1179503339 21:41823449-41823471 CCTGTGGCAGAGGAGCCGCATGG + Exonic
1179538432 21:42067773-42067795 CCAGGCCCCAAGGAGCAGCATGG - Intronic
1179570173 21:42273915-42273937 CCTGGGACCCAGGAGATGCTCGG - Intronic
1179766233 21:43575008-43575030 ACCAGGGCACAGGAGCAGCAGGG + Intronic
1179856978 21:44166798-44166820 CCAGGGTCCCGGGAGCTGCAGGG - Intergenic
1180002400 21:45001315-45001337 CCCGGGGCCTGGTAGCAGCAGGG + Intergenic
1180007131 21:45028012-45028034 TCTGGGGCCCAGGGGGAGCAGGG - Intergenic
1180147373 21:45928909-45928931 CCTGGGGCTCAGGAGGACCCTGG - Intronic
1180839773 22:18953887-18953909 CCTGGGTCCCAGGAGAAGTGTGG - Intergenic
1180883399 22:19222636-19222658 ACTGGGGCCCAGAGGCAGCCGGG + Intronic
1180948252 22:19708541-19708563 CCTGGGGCAAATGAGGAGCAGGG + Intergenic
1180979094 22:19870333-19870355 GCTGGGGGCCAGGACAAGCAGGG + Intergenic
1181049481 22:20231823-20231845 CCTGGGGCCCCTGGCCAGCACGG - Intergenic
1181109126 22:20591172-20591194 CCTGGGGCCCAGGTCCTGCCTGG - Intergenic
1181441155 22:22935806-22935828 GGTGTGGCCCAGGAGGAGCATGG + Intergenic
1181639811 22:24190519-24190541 CAGGGGGCCCAAGAGCGGCAGGG + Intergenic
1181782214 22:25201500-25201522 CCTGAGGCCCAGGAGTAGCCTGG - Intronic
1181973538 22:26712017-26712039 CCTGGGGCCCAAGTCCAGCTGGG - Intergenic
1182427513 22:30282780-30282802 CCTGGTGCCCAGCATCTGCAGGG - Intergenic
1182427846 22:30284283-30284305 CCTGGTCCCCAGGAGCAGGGCGG + Intergenic
1183276427 22:36900952-36900974 TCTGGGGGTCAGGAGCACCAGGG - Intergenic
1183530584 22:38351318-38351340 CCTGGGGCCCAGCCTCAGGAAGG - Intronic
1183710710 22:39501840-39501862 CCTGGGGAGTAGGAACAGCATGG + Intronic
1183832889 22:40428204-40428226 CCTGGGGCTTGGGACCAGCATGG + Intronic
1183931476 22:41238256-41238278 CCTGGGACCCAGGGCCTGCAGGG + Exonic
1183933910 22:41250947-41250969 CCTGGGGCCCACGAGCATCAAGG + Intronic
1183972854 22:41491301-41491323 CCAGGGGCCCATGAGCAGAAGGG + Intronic
1184068407 22:42133453-42133475 CCAGGGGCCCAAGAGCAGATTGG - Intergenic
1184138886 22:42566129-42566151 CCTGGGGTCCAGCTGGAGCAGGG - Intronic
1184164162 22:42717593-42717615 CCTCAGGCCCAGGAGAAGGAGGG - Intronic
1184688930 22:46108761-46108783 CCTGGGACCCAGGACGAGGAAGG - Intronic
1184729658 22:46365595-46365617 CCTCATGCCCAGGAGCTGCAAGG - Exonic
1184762334 22:46551607-46551629 CCTGGGACCCAGAAGCGGCTAGG - Intergenic
1184797724 22:46741503-46741525 CCAGGGGCCCAGGAAGAGAAGGG - Intergenic
1184987445 22:48145372-48145394 ACTTGGCCCCAGGAGCAGCAGGG - Intergenic
1185319099 22:50192337-50192359 CCGGGGGCCCAGGAGCCTGAGGG - Intronic
1185392074 22:50567688-50567710 CATGCGGCCTAGGAGCAACAGGG + Intergenic
950456780 3:13097429-13097451 CCTTGGGCACAGGACCTGCAGGG - Intergenic
950476883 3:13220340-13220362 CTTGGGGCCCAGGAGAAGAATGG + Intergenic
950883819 3:16345610-16345632 CCTGAGAACCAGGAGCAACAAGG - Intronic
950971691 3:17195457-17195479 CCTTGGTGCCAGGAACAGCAAGG - Intronic
952120021 3:30231385-30231407 CCTGGGGCCCAGGTGGAGGGTGG + Intergenic
952169249 3:30787709-30787731 CTTGAGGCCCAAGAGGAGCATGG - Intronic
952491325 3:33876463-33876485 CCTGGGGCCCAGGCCCAGAGGGG - Intergenic
952834380 3:37591090-37591112 CCTGGAGCCCAGGGGCAGGAGGG - Intronic
952960799 3:38588005-38588027 CCTGAGGAGCAGGAACAGCAAGG - Intronic
953916711 3:46925114-46925136 CATGGGGCCCTTGGGCAGCAGGG - Intronic
953927427 3:46989550-46989572 CCTGGGGCAAAGCAGCAGGAGGG - Exonic
954030873 3:47819033-47819055 CCTGGGACGCAGCAGCAGCATGG - Intronic
954097315 3:48338714-48338736 CTTGGGGCCCAGTGGCTGCAGGG - Intergenic
954390501 3:50265823-50265845 CCTGGGGCTGAGGAACAGAAAGG + Intergenic
954430833 3:50470149-50470171 CCAGGGGCCCATGTGCAGCCAGG + Intronic
954441748 3:50525967-50525989 CCTGGGACCCAGGAGCTGCTGGG + Intergenic
954463971 3:50643901-50643923 CCTGTGTCCCAGGAGTAGCCAGG - Intronic
954533549 3:51341172-51341194 TCAGAGGCCCAGGAGCAGCCTGG - Intronic
956728835 3:72178123-72178145 TCTGGGGCCCAGGGAAAGCACGG + Intergenic
959664571 3:108906226-108906248 CCTGGGGCAGAGGAACAGAAGGG + Intergenic
960947696 3:122978192-122978214 CCTGGGGCCCAGGTGGGGCCAGG - Intronic
961675221 3:128560864-128560886 CCTGGTCCCCAGTGGCAGCAGGG + Intergenic
962385766 3:134930955-134930977 CCTGGTGCCCAGCACCAGCCTGG + Intronic
963023904 3:140899753-140899775 CTTTGGGCCCAGGACCAACATGG + Intergenic
963129267 3:141843166-141843188 CCTGGGGCACAGGAGAATAAAGG - Intergenic
963351140 3:144152509-144152531 CCTGTGGCTCAGCAGCATCAGGG - Intergenic
963503085 3:146153007-146153029 CCAGAGGCCCTGGACCAGCAGGG + Intronic
965688942 3:171334538-171334560 CCTGGCACTCAGGAGCAGCATGG + Intronic
965879325 3:173369956-173369978 CCAGGAGCTCAGGAGAAGCAGGG - Intergenic
966297438 3:178440611-178440633 CCTGGGGCCCATGCGAAGCCAGG - Intronic
966551741 3:181212885-181212907 CCTGGGACCCAGGAGAAGAGAGG - Intergenic
966619868 3:181952333-181952355 TCTGGTGCCCAGGAGCACCATGG + Intergenic
967044998 3:185728242-185728264 GAAGGGGCCCAGGAGCAGCAAGG - Intronic
967466154 3:189808286-189808308 CCTGGGGCTCCTGAACAGCATGG + Exonic
967965380 3:194956470-194956492 CCTGGGGCCCAGGAGAGGAATGG - Intergenic
967977559 3:195044044-195044066 ACTGGGTCCCAGGAGATGCAGGG + Intergenic
968515324 4:1013222-1013244 CCTGGGACCCAGCCCCAGCAAGG + Intronic
968518855 4:1026713-1026735 CCTGGGGCCCGGGACCCGCCTGG + Exonic
968601091 4:1509639-1509661 CCCGGGGACGAGGGGCAGCACGG - Intergenic
968613181 4:1566280-1566302 CACGGTGCCCAGGAGCACCAGGG + Intergenic
968731720 4:2272248-2272270 CCTGGAGCCCTGGCCCAGCAGGG - Intronic
968947123 4:3670938-3670960 CCGGGGGCACAGGAGCAGTGGGG - Intergenic
968972225 4:3802053-3802075 CTTGGGGCCTGGGAGGAGCATGG - Intergenic
969072890 4:4553588-4553610 CCTGGAGGCCAGGAGAAGGAGGG - Intergenic
969163910 4:5287922-5287944 TCTGGGGGCTAGGAGGAGCAGGG - Intronic
969464652 4:7349176-7349198 GCTGGGGACCAGGGGCAGCATGG + Intronic
969533612 4:7742345-7742367 CCCGGGGCCCACGGGCAACATGG + Exonic
969841896 4:9888943-9888965 CCTGGCACCCAGGGGCAGCTCGG - Intronic
970433476 4:16010716-16010738 TCTTGAGCCCAGGAGCAACATGG - Intronic
972396961 4:38665128-38665150 TCTGGAGCCCAGGAGCTGCCAGG + Intronic
973757255 4:54087562-54087584 CCTGGGACACAGGAGCATCAGGG - Intronic
976647240 4:87399448-87399470 CTTGGGGGCCAGGAGCAGGTAGG + Intergenic
980622411 4:135325267-135325289 CCTGGAGTGAAGGAGCAGCAAGG + Intergenic
981748412 4:148072098-148072120 CCTGGGTGCCAGGGTCAGCAGGG - Exonic
982545084 4:156724139-156724161 CTTGGGGCCTAGGAGCAGGCAGG + Intergenic
985167223 4:187109562-187109584 TCTGGGTCCCAGGAGCAGTTGGG + Intergenic
985209483 4:187576975-187576997 CCTGGGGCCCAGTGGAAACAGGG - Intergenic
985524714 5:396101-396123 CCTGCAGCCCAGGAGCGGGAGGG + Intronic
985563711 5:604685-604707 CCAGGGGCCCGGGAGCAGTCAGG + Intergenic
985670761 5:1205463-1205485 CCTGGGGCTCAGGCTCAGCATGG - Intronic
985683726 5:1270960-1270982 CCTGCAGCCCAGGAGCCGGAGGG + Intronic
986636734 5:9829687-9829709 CCATGGGCCCAGGAGTGGCAGGG + Intergenic
987023223 5:13896361-13896383 CCTGAGGCTCAGGACCAGAAAGG - Intronic
988519982 5:31937206-31937228 CCCAGTGCCCAGGAGAAGCAAGG - Intronic
989748410 5:44860424-44860446 CCTGGGGCCTGGGAGCTGCAAGG + Intergenic
990977565 5:61572925-61572947 CCTGGAGCGCAGGAGTGGCAGGG + Intergenic
991359425 5:65803695-65803717 CTTGGGGGCCAGGAGCAGGCAGG - Intronic
991906988 5:71524502-71524524 CCTATGGCCCAGGCCCAGCAAGG + Intronic
992085904 5:73278265-73278287 CCTGGGGCCCAGTAACTGAAGGG - Intergenic
992627343 5:78648123-78648145 CGTGGGTCCCAGGCGCAGCTGGG - Intronic
992642716 5:78781957-78781979 CCCAGGTCCCAGGAACAGCATGG - Exonic
992748784 5:79843230-79843252 CTGGGGACCCAGCAGCAGCAAGG + Intergenic
993898868 5:93571086-93571108 CCTGGGGCCCTGCAGCACCGAGG + Intergenic
994212016 5:97097556-97097578 CCTGGGGGACAGGAGTAGGAGGG + Intronic
995466586 5:112456061-112456083 CCTCAGCCCCCGGAGCAGCAGGG - Intergenic
995830889 5:116354415-116354437 CCTGAGAACCAGGAGCACCAAGG - Intronic
996019699 5:118577746-118577768 GCTGGGGCCCAGGAGCTGTGAGG - Intergenic
997336711 5:133113815-133113837 CCAGGGAGCCAGGAGCATCATGG - Intergenic
997384086 5:133458879-133458901 CCAGGAGCTCTGGAGCAGCAGGG + Intronic
997579349 5:135007552-135007574 CCCCGGGCCCAGGAGGAGTAGGG - Intronic
997654967 5:135547801-135547823 CCTGACGCCCACCAGCAGCAGGG - Intergenic
997781841 5:136667315-136667337 CCTGGGGCCCAGTGGCATCGGGG + Intergenic
998037717 5:138930964-138930986 CCTGAGCCCCAGGAGGAGCTTGG - Intronic
998352883 5:141512573-141512595 CCGGGGACCCAGGGGCAGAAGGG - Exonic
998389924 5:141780722-141780744 CTTCAGGCCCAAGAGCAGCAAGG + Intergenic
1000266171 5:159640590-159640612 CTTGGGGGCCAGGAGCAGGCAGG + Intergenic
1001286510 5:170427664-170427686 CCTGGGGCCCAGCAGCAGGCCGG - Intronic
1001817387 5:174681364-174681386 CCAGGCGGCCAGTAGCAGCAGGG - Intergenic
1002046157 5:176542946-176542968 CCTGGGTCCCAGCCGCAGCTGGG + Intronic
1002322989 5:178386747-178386769 CATGGGCTCCAGGAGCAGAAAGG + Intronic
1002562704 5:180093094-180093116 CCTGGGGCCCAGGCCCAGGGAGG - Intergenic
1003193595 6:3895412-3895434 CCGGGGGCGGAGGAGCAGAAAGG - Intergenic
1003667863 6:8128358-8128380 GCTGGGACCCAAGAGCAGCATGG + Intergenic
1004016572 6:11737328-11737350 CCTGGGGCTCAGGAACAAGATGG - Intronic
1004260631 6:14104521-14104543 CCTGGGGCTCAGGAGCAAGGTGG - Intergenic
1004493473 6:16140699-16140721 CCTGGGGCATAGCAGCTGCAGGG + Intronic
1004721608 6:18272606-18272628 CCTGAGAACCAGGAGCACCAAGG - Intergenic
1005723764 6:28628932-28628954 CCTGAGAACCAGGAGCATCAAGG + Intergenic
1005776631 6:29139229-29139251 CCTGGGGCTGAGGAACAGGATGG + Intergenic
1006083715 6:31581819-31581841 CCCGGGGCACAGGCCCAGCAAGG - Exonic
1006154233 6:32005687-32005709 CAGCAGGCCCAGGAGCAGCATGG - Intergenic
1006160537 6:32038421-32038443 CAGCAGGCCCAGGAGCAGCATGG - Exonic
1006284263 6:33080987-33081009 CCCAGGGCGCAGGAGCAGCCGGG + Intronic
1006286952 6:33104023-33104045 AGTGGGGCCCATGAGCAGCCAGG + Intergenic
1006843580 6:37047691-37047713 CCGGGGGTCTAGGAGCAGCAGGG - Intergenic
1006993296 6:38234345-38234367 CCTGGGCCCAAGCAGCTGCAGGG - Intronic
1007341674 6:41194591-41194613 CCAGGGACCCAGGAGGACCATGG - Exonic
1007618401 6:43196312-43196334 CCTGGAGCACAGGAGTAGCAGGG - Intronic
1011071607 6:83391737-83391759 CCTGGAGACCAGAAGCAGGATGG - Intronic
1013164191 6:107575043-107575065 CCTGGGGCGCACGAGCAGTGTGG + Intronic
1013374747 6:109503738-109503760 CCAGGTGCCCAGCAGCTGCAGGG - Intronic
1014726881 6:124981910-124981932 CCTCAGCCCCAGGAGCAGCTGGG - Intronic
1015283226 6:131456584-131456606 CGTGGGTCCCAAGAGCAGAAGGG + Intergenic
1015663589 6:135603098-135603120 CTTTGGGCCCAGGAGCAGGCGGG + Intergenic
1017522464 6:155214052-155214074 CTTGGGGGCCAGGAGCAGGAAGG - Intronic
1017787473 6:157768374-157768396 CCTGGGGCTCAGCAGCACCCTGG + Intronic
1017805241 6:157940076-157940098 GCTGGTGCTCAGGGGCAGCAAGG + Intronic
1018203804 6:161417969-161417991 CCTGGGGGCCAGGCCCAGGAGGG - Intronic
1018898672 6:168039498-168039520 CCTGGGCCCCGGAGGCAGCAAGG + Intronic
1019056789 6:169229521-169229543 CCTGGGTTCCAGGAGCAGCGAGG - Intronic
1019130474 6:169869407-169869429 CCTGGGGCCCTGGAGAGGCACGG + Intergenic
1019140144 6:169937722-169937744 CCTGCAGGCCTGGAGCAGCAGGG + Intergenic
1019183604 6:170208265-170208287 TTTGGGGCCCAGGCGCAGAAGGG - Intergenic
1019411162 7:907373-907395 CCCAGAGCCCAGGAGCACCAGGG + Intronic
1019443054 7:1056999-1057021 CCTGGAGCCCAGGCTCTGCAAGG + Intronic
1019587655 7:1813924-1813946 CCTCTGCCCCAGGGGCAGCAGGG - Intergenic
1020013904 7:4820304-4820326 CCGGGAGCCCAGGAGCCCCAGGG + Intronic
1021217894 7:17940149-17940171 CCAGGGCCCGAGGAGCAGCGGGG - Intronic
1022304002 7:29129186-29129208 GCTGGGGTCAAGGAGTAGCAGGG + Intronic
1022423478 7:30246110-30246132 CCTGGGTGCCATGAACAGCAGGG - Intergenic
1022495451 7:30850301-30850323 CCTGCAGCCCAGGAGCCCCAAGG - Intronic
1022822432 7:33974411-33974433 CTTGGGGTCCGGGAGCTGCATGG - Intronic
1023223257 7:37943063-37943085 GCTGAGGCTCAGCAGCAGCAGGG + Intronic
1023287178 7:38631706-38631728 CCCTGGGCCCAGGGGCAGCTCGG + Intergenic
1023856867 7:44189389-44189411 CCTGGGGCTCAGGCGCCGCTCGG + Intronic
1023897196 7:44443780-44443802 CCTGGGGCCCAGGTGCTGCTCGG + Intronic
1023909287 7:44542045-44542067 CCCTGGGCCCAGGTGGAGCAGGG - Intergenic
1023999791 7:45182812-45182834 CCTTTGGCCCTGGAGAAGCATGG + Intronic
1024189960 7:46996121-46996143 CCTGGGAACCTGAAGCAGCAGGG - Intergenic
1024576334 7:50767630-50767652 CCTGCTGGCCAGGAGCCGCAGGG - Intronic
1024786320 7:52911537-52911559 CTTGGGGACCAGGAGCAGGCTGG - Intergenic
1024863844 7:53880389-53880411 CCTGGGTCCCAGTGCCAGCAGGG + Intergenic
1024991024 7:55234561-55234583 CCTGGGAAACAGGAGCAGGAGGG + Intronic
1025739669 7:64184394-64184416 CCTGCAGCCCGGGTGCAGCAGGG - Intronic
1025924869 7:65949581-65949603 ACTTGAGCCCAGGAGCAACATGG + Intronic
1026634296 7:72067777-72067799 CTTGGGCCCCAGGTCCAGCAAGG + Intronic
1026911296 7:74093318-74093340 CCTGGAGCCCAGGACAAGTAGGG - Intronic
1028111662 7:86949507-86949529 CTTGGGGGCCAGGAGCAGGCAGG + Intronic
1029151958 7:98486595-98486617 ACTGGGGCCCAGGATGGGCAAGG + Intergenic
1029159305 7:98540553-98540575 CCTGGGGCCCTGGGGCTGCCTGG + Intergenic
1029705887 7:102275379-102275401 CTTGGGCCCAAGGAGCATCAGGG - Intronic
1030598786 7:111570119-111570141 CCCCGACCCCAGGAGCAGCATGG + Intergenic
1031786453 7:126040405-126040427 CTTGGGGGCCAGGAGCAGGCAGG + Intergenic
1031977569 7:128103754-128103776 CCTGAGGCCCAGGAGAGGCCGGG + Intergenic
1032080701 7:128857096-128857118 CCTGGGGGCCAGAGGTAGCAAGG - Exonic
1032091551 7:128914063-128914085 CCTGGGGGCCAGAGGTAGCAAGG + Intergenic
1032658436 7:133956038-133956060 CTTGGGGGCCAGGAGCAGGCAGG - Intronic
1032906470 7:136373213-136373235 CCTGGGGCCCAGGAGAATGTTGG + Intergenic
1033313858 7:140282096-140282118 CCAGGAGCCCAGGAGCAGAGTGG - Intergenic
1034154783 7:148947847-148947869 CCTTGGGCATAGCAGCAGCAGGG - Intergenic
1034271243 7:149804283-149804305 CCTGGGCGCCAGGAGCAGGCTGG + Intergenic
1034545581 7:151786580-151786602 CCTCGGGCCCAGGGGCTGCATGG + Intronic
1034574362 7:151984675-151984697 CGTGGGTCACAGGGGCAGCAGGG - Intronic
1035183100 7:157105083-157105105 CTTAGGGCCTAGGAACAGCAGGG - Intergenic
1035479078 7:159167579-159167601 CTTGTTGCCCAGGAGCAGCCAGG - Intergenic
1036221629 8:6925908-6925930 GCTGATGCCCAGGAGCAGCGTGG - Exonic
1036229555 8:6988165-6988187 GCTGCAGCCCAGGAGCAGCCTGG - Intergenic
1036232006 8:7007268-7007290 GCTGCAGCCCAGGAGCAGCCTGG - Intronic
1036234807 8:7029382-7029404 GCTGCAGCCCAGGAGCAGCTTGG - Intergenic
1036638266 8:10566070-10566092 CCTTGGGCCCAGGAGGAATAAGG + Intergenic
1037600727 8:20391651-20391673 TCTGGGGCCCAGGAGTTGGAGGG - Intergenic
1037823717 8:22148214-22148236 GCTGGGGGCCAGGAGTAGCTGGG + Exonic
1037926438 8:22847213-22847235 TCAGGGGCCCTGGGGCAGCAGGG + Intronic
1037947794 8:22999960-22999982 GCTGGAGCCCAGCAGCAGCGCGG + Intronic
1038013917 8:23497396-23497418 CCTGGGACCCAGGCTCAGCTGGG - Intergenic
1038413178 8:27374121-27374143 CCTGAGGCTGAGGGGCAGCAGGG + Intronic
1042059110 8:64798486-64798508 GCAGAGGGCCAGGAGCAGCAGGG + Exonic
1042246292 8:66712386-66712408 CCTGGGGCCCAAGACCGGCGCGG - Intronic
1042411806 8:68474867-68474889 CTTGGTGCCCAGGAGAAGCAAGG + Intronic
1044616679 8:94149606-94149628 CCAAGGGCCAAGGAACAGCATGG + Intronic
1046678417 8:117138655-117138677 TCTCTAGCCCAGGAGCAGCAAGG + Intronic
1046918295 8:119700308-119700330 CCTGGGTCCCAGGAACTCCAAGG + Intergenic
1047354589 8:124108478-124108500 CCTGGGGCCCAGAAGGAGATGGG - Intronic
1047428448 8:124767845-124767867 CCTGGGGGCTAGCAACAGCAGGG + Intergenic
1048312822 8:133339002-133339024 CCTGGGGCCTTGGAGGAGAAGGG - Intergenic
1049220262 8:141425718-141425740 ACTGAGGCCCAGGCGCAGCTGGG - Intronic
1049251957 8:141593983-141594005 CAGGGGTCCCAGGAGCAGAACGG + Intergenic
1049428977 8:142550530-142550552 CCTGGGGCTGGGGGGCAGCATGG + Intergenic
1049433454 8:142575718-142575740 GCAGGGGCCCGGGATCAGCAGGG + Intergenic
1049450029 8:142655628-142655650 GTTGAGGCTCAGGAGCAGCAGGG - Intergenic
1049564396 8:143330755-143330777 CCGGGGGCTCTGGGGCAGCAGGG - Intronic
1049749754 8:144277543-144277565 ACTGCGGCCCATGAGCAGCGAGG - Intronic
1049825261 8:144663589-144663611 CGTGAGGCCTAGGAGCAGGAAGG - Intergenic
1050130418 9:2406551-2406573 CTGGGGGGCCAGGAGCAGGAAGG + Intergenic
1051003820 9:12317649-12317671 CCAGTGGTCCAGAAGCAGCATGG + Intergenic
1051440283 9:17075711-17075733 CCTGAGAGCCAGGAGCACCAAGG + Intergenic
1051911169 9:22154880-22154902 CCTGCAGGCCAGGTGCAGCAGGG - Intergenic
1052744795 9:32430129-32430151 CCTGGGGCCCAAGAACAGGTGGG - Intronic
1053408985 9:37903735-37903757 CCTGGTGCACAGGAACCGCAGGG - Exonic
1055021508 9:71675353-71675375 CCTGGGGCAGTGGAGGAGCATGG - Intergenic
1056692189 9:88816904-88816926 CCAGGGGACCAGGTGTAGCAGGG + Intergenic
1057024000 9:91722259-91722281 CTGGGGGCCCTGGAGCAGCAGGG - Intronic
1060250873 9:121986069-121986091 CCTGGGCCAGAGGAGGAGCATGG - Intronic
1060358303 9:122931353-122931375 CCTGGGGCCCTGGATCAACCGGG - Intronic
1060756590 9:126218592-126218614 CCTGAGGCCGAGGGGAAGCAGGG + Intergenic
1060822948 9:126671971-126671993 GCTGGGGCTCGGGAGCATCAAGG - Intronic
1060839740 9:126784062-126784084 CCTGGCTCCCAGTAGCAACATGG + Intergenic
1061071570 9:128314015-128314037 CCTGGGGCTGTGGAGCAGCTGGG - Intronic
1061249907 9:129420548-129420570 GCTTGAACCCAGGAGCAGCACGG + Intergenic
1061870571 9:133518129-133518151 CCTGGGACCCCAGAGCAGGAGGG - Intronic
1061916895 9:133760066-133760088 CCAGGGGGCCAGGAGCAGCAGGG + Intergenic
1061924199 9:133798035-133798057 CCTGGGACTCAGGAAGAGCAGGG - Intronic
1062030015 9:134358037-134358059 CCTCGGGCCAGCGAGCAGCAGGG - Intronic
1062193675 9:135260763-135260785 CCAGGGGCCAAGGAGGGGCAAGG + Intergenic
1062282833 9:135759630-135759652 CCTGGGGCCCAGGAGCTGGGGGG - Intronic
1062325836 9:136012120-136012142 CATGGGCCCCAGGAGCGGCCGGG - Intronic
1062368547 9:136224200-136224222 CCTGGGGCCCAAAGACAGCAGGG + Intronic
1062413906 9:136438621-136438643 CCTGGCGCCCATCCGCAGCAAGG - Exonic
1062545788 9:137063275-137063297 CCTGCAGACCAGGTGCAGCAGGG + Exonic
1062551832 9:137091302-137091324 CCTAGTGTCCAGGAGCAGCTGGG + Intronic
1185614317 X:1411500-1411522 ACTGGGCTCCAGGAGCAGCCTGG + Intronic
1189023805 X:37370639-37370661 CCTTGGGGCCAGGAGCAGACAGG + Intronic
1189858979 X:45252727-45252749 CCTGGGGCCCAGCAGCACTGAGG - Intergenic
1190477468 X:50842138-50842160 CCTGGGGCCCAGGCAAAGCAAGG + Intergenic
1190864817 X:54375614-54375636 CCTTGGCCCCCGGAGCAGCTGGG + Intergenic
1192172750 X:68867197-68867219 CCTGTGGGCCTCGAGCAGCATGG + Intergenic
1192395265 X:70774162-70774184 CCTGGGGCCCAGCAGCACCAGGG + Intronic
1192808355 X:74529220-74529242 CATCAGGCCCAGGAGCAGGAAGG - Exonic
1193724852 X:85026315-85026337 CCAGGGGCCCAGGAGAATAAAGG - Intronic
1195564364 X:106323863-106323885 TCTGGGGCCCAGGGCCAGCCTGG - Intergenic
1196140169 X:112252855-112252877 CCTGGGATCCAGGATCACCAAGG - Intergenic
1196389969 X:115196558-115196580 CCAGGGGCACATGAGCACCAAGG + Intronic
1197024097 X:121726724-121726746 CTTGGGGCACAGTAGCAGAATGG - Intergenic
1197064338 X:122220773-122220795 TCAGGGGCCCAGGACCAGCATGG + Intergenic
1197678664 X:129358714-129358736 CCTGAGAACCAGGAGCACCAAGG + Intergenic
1199558505 X:149136590-149136612 CCTGGGGCCATAGAGCAGAATGG - Intergenic
1199770031 X:150969378-150969400 CCTGGGGCCCAGGAGACACCAGG - Intergenic
1200057914 X:153471040-153471062 CCTGGTTCCCAGGAGGACCAAGG + Intronic
1200136510 X:153877709-153877731 CAGGGGGCTGAGGAGCAGCAGGG - Intronic
1200256420 X:154585340-154585362 CCCGGGGCGCAGGGGCAGCAAGG + Exonic
1200261349 X:154619063-154619085 CCCGGGGCGCAGGGGCAGCAAGG - Exonic
1200267332 X:154653360-154653382 CCCGGGGCGCAGGGGCAGCAAGG - Exonic
1200711001 Y:6485003-6485025 CTTGGGACCCTGGAGCAGAATGG - Intergenic
1200895935 Y:8376133-8376155 CCTGTGGTCCAGGAGAAGAAAGG + Intergenic
1201022933 Y:9676983-9677005 CTTGGGACCCTGGAGCAGAATGG + Intergenic
1201351149 Y:13042571-13042593 CCTTGGCTCCAGGGGCAGCAAGG - Intergenic
1202575072 Y:26315520-26315542 CCTGGGGCTCGGGTGTAGCAAGG + Intergenic