ID: 1146978578

View in Genome Browser
Species Human (GRCh38)
Location 17:37138208-37138230
Sequence ATGGCCAATCTGAATGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146978575_1146978578 14 Left 1146978575 17:37138171-37138193 CCTGACTGTGTACATTAGCTGAT 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1146978578 17:37138208-37138230 ATGGCCAATCTGAATGAGAAGGG 0: 1
1: 0
2: 1
3: 13
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146978578 Original CRISPR ATGGCCAATCTGAATGAGAA GGG Intronic
902743357 1:18455891-18455913 AAGGCCAATCTGACTGGGCATGG - Intergenic
903284171 1:22266860-22266882 ATGGTCAATATGAATAATAAGGG - Intergenic
905989890 1:42327349-42327371 TTGGCCTTTCTGAATGAGGATGG - Intronic
906858551 1:49333795-49333817 ATGGCCAAACTGAACAAGGAGGG - Intronic
907865390 1:58394991-58395013 ATGGCAAATCTTAGTCAGAATGG + Intronic
908635641 1:66161137-66161159 ATGCCCAATTTGAATGCCAAAGG - Intronic
910742122 1:90530893-90530915 ATGACCAAGCTGAAACAGAATGG - Intergenic
910789090 1:91032324-91032346 ATTACACATCTGAATGAGAATGG + Intergenic
912467448 1:109883740-109883762 AAGGCCAATCTGAATGAATTTGG - Intergenic
912978373 1:114349538-114349560 AAGGCAAAGCTGAATGTGAAGGG + Intergenic
913374547 1:118136248-118136270 ATGGACCATCTGAATGAATATGG + Intronic
914504583 1:148277924-148277946 ATGGCCAAATTGCATAAGAAAGG + Intergenic
914509715 1:148320353-148320375 ATGGCCAAATTGCATAAGAAAGG - Intergenic
914922792 1:151859006-151859028 CTGGCCATTCTGGATGAGGAAGG + Intergenic
915516272 1:156414437-156414459 TTGGGGAGTCTGAATGAGAAGGG - Intronic
917437367 1:175034962-175034984 ATTGCCAAACTAAATGGGAAAGG + Intergenic
922437549 1:225621246-225621268 ATGGCCATACTGAGTCAGAAGGG - Intronic
922818453 1:228468035-228468057 ATGGCCAGTCTGGGGGAGAATGG + Intergenic
922964484 1:229676806-229676828 AGTGCAAATCTTAATGAGAAAGG - Intergenic
923409153 1:233690350-233690372 ATGGCCAATGTGAGTTACAAAGG + Intergenic
1064301134 10:14123896-14123918 ATGGCCAATCTCAGTATGAAAGG - Intronic
1064705644 10:18069916-18069938 ATGGCAAAGCTGAAAGAGCATGG + Intergenic
1066625684 10:37403024-37403046 AGGGCTATTCTGAATGAGGAAGG + Intergenic
1071878685 10:89870704-89870726 ATGGTGCATCTGAATTAGAAGGG - Intergenic
1072802704 10:98404466-98404488 ATGTGGAGTCTGAATGAGAAGGG + Intronic
1075526755 10:123193663-123193685 AGGGCCAAACTGAATTAGGAGGG - Intergenic
1076934998 10:133562019-133562041 CAGGCCAAACTGAAAGAGAAAGG + Intronic
1080084965 11:28268443-28268465 ATGTACAATCAGAATGATAATGG - Intronic
1081207272 11:40291009-40291031 ATGGCCAAACAGCATGAGACAGG - Intronic
1084343133 11:68522285-68522307 ACTGCCAATCTGTATGAGAATGG + Intronic
1085642614 11:78202153-78202175 ATGGCCAATCTCAGTCACAAAGG + Intronic
1086881095 11:92154353-92154375 ATAGGGAATTTGAATGAGAATGG - Intergenic
1086971489 11:93085811-93085833 ATGGCCACTCCTAATGACAAAGG - Intergenic
1087587169 11:100136866-100136888 ATGTCCAATCTAAATAAGAAAGG - Intronic
1087818651 11:102687316-102687338 ATTGCCAAACTGAGTGAGGAAGG + Intergenic
1093109080 12:15127479-15127501 ATTGCAAACCTGATTGAGAAAGG + Intronic
1093467859 12:19468747-19468769 ATGCCCAAAGTGAATAAGAATGG - Intronic
1097010409 12:55949733-55949755 ATGGCCAATATGCATAGGAAAGG - Intronic
1097819214 12:64110663-64110685 ATGGAGATTCTGAATAAGAATGG - Intronic
1098095405 12:66949660-66949682 ATGGCCCATCAGAAAGAAAAGGG - Intergenic
1098529874 12:71529597-71529619 AAAGCCATTCTGTATGAGAATGG - Intronic
1098642797 12:72858815-72858837 ATACCCAAGCTGAATTAGAATGG + Intergenic
1099126630 12:78767636-78767658 ATGGCCAATACGCATAAGAAAGG - Intergenic
1107113031 13:36718221-36718243 ATGAGCAATTTGAGTGAGAAAGG - Intergenic
1107175812 13:37396540-37396562 TTGGCAACTCTGAAAGAGAAAGG + Intergenic
1107530559 13:41278699-41278721 TTATCCTATCTGAATGAGAATGG - Intergenic
1107625245 13:42275206-42275228 AAGGCCAATCTGAAAGAAACTGG - Intronic
1111110239 13:83698952-83698974 ATTGCCACTCTGAATAAGATGGG - Intergenic
1112997837 13:105596221-105596243 ATGAGAAATCTAAATGAGAAAGG + Intergenic
1114186220 14:20404423-20404445 ATGGAGAATGTGATTGAGAAGGG - Intronic
1114854159 14:26417417-26417439 ATGGCACATCTGAAAGAGCAAGG - Intergenic
1116430457 14:44840041-44840063 CTGGCTAATATGAATGAGGAGGG + Intergenic
1119177381 14:72579165-72579187 ATGGCCTATCCTAAGGAGAAGGG + Intergenic
1120080206 14:80207676-80207698 TTGGCCAATCTGAATATAAATGG - Intronic
1120320334 14:82951415-82951437 ATGGTCAATCTACATGACAAGGG + Intergenic
1120550713 14:85869004-85869026 ATGGCAAATACGCATGAGAAAGG + Intergenic
1120960990 14:90124632-90124654 GTGGGCAACCTGAATGAGCAAGG + Intronic
1122832959 14:104411739-104411761 ATGGCAGATCTAAATGTGAATGG + Intergenic
1123966393 15:25463822-25463844 ATGGCAGATCTGGATGAGAGGGG + Intergenic
1124652761 15:31485369-31485391 CTTGCCAAACTGAGTGAGAAAGG - Intronic
1125750366 15:42023679-42023701 CTGGCCTATCTGATTGGGAAGGG - Intronic
1126750336 15:51870510-51870532 CTGGCCAAAATGATTGAGAAGGG - Intronic
1131801390 15:96073102-96073124 ATGGCCAAACTGAATGATTAAGG + Intergenic
1133178331 16:4033109-4033131 ATGGCCATTCTTTATGAGTAAGG + Intronic
1139665753 16:68454250-68454272 ATGGCCAGTTTGAAGGAGACAGG + Intergenic
1141289814 16:82707381-82707403 CTGGCCAATGAGAATGAGCAGGG + Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1143730415 17:8879539-8879561 AGGGCCAATCTGATACAGAAGGG + Exonic
1144365264 17:14537787-14537809 TTGGACAATCGGAATGTGAAAGG + Intergenic
1146978578 17:37138208-37138230 ATGGCCAATCTGAATGAGAAGGG + Intronic
1153393247 18:4587979-4588001 ATTGCCAACCTGCATGAGGAAGG - Intergenic
1153867539 18:9286588-9286610 ATGGCCAATCAGCATATGAAAGG - Intergenic
1155667178 18:28325474-28325496 ATGGGAAATCTGACTGAGAGAGG - Intergenic
1156507331 18:37606281-37606303 AAGGCACATCTGGATGAGAAGGG - Intergenic
1156652161 18:39237251-39237273 GTGGCATACCTGAATGAGAAAGG + Intergenic
1157319392 18:46622714-46622736 ATGCCCATTGTGAATGAGCAGGG + Intronic
1157584204 18:48790892-48790914 ATGGCCCAGCAGAAGGAGAAGGG - Intronic
1157669416 18:49515737-49515759 ATGTCCTATAAGAATGAGAATGG + Intergenic
1158601482 18:58859720-58859742 AGGGCCTACCTGAAGGAGAAGGG - Intergenic
1163461536 19:17440894-17440916 TTAGCCAATGTGAATAAGAAGGG + Intronic
1164877766 19:31704407-31704429 AAAGACAATCTGAATGTGAATGG - Intergenic
1166537177 19:43581568-43581590 TTGACCAATCTTACTGAGAATGG + Exonic
1167744936 19:51345221-51345243 GTGGCCAAGCTGAAGGAGATTGG - Exonic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
926895737 2:17686147-17686169 ATGCTCAACCTGTATGAGAAAGG - Intronic
928051559 2:28001924-28001946 ATGTCCAAACTGTATCAGAAAGG + Intronic
928926226 2:36582338-36582360 AAGGCAAATCTGAAGGAGATGGG + Intronic
929279963 2:40066789-40066811 AGGGCCAATCAGAAGGTGAAGGG - Intergenic
929862972 2:45694968-45694990 ATAGCCAAACTGAAGGAGAAGGG - Intronic
929983431 2:46701319-46701341 ATAGCTAAACAGAATGAGAATGG + Intronic
930505527 2:52279025-52279047 ATGGCCAATAAGAATGTGAAGGG - Intergenic
931511894 2:63006637-63006659 ATCTCCACTCTGAATGAAAATGG - Intronic
932121719 2:69106878-69106900 AGAGCCAATCTGAAAGAGAATGG + Intronic
934977346 2:98812442-98812464 ATGGCCAATGGGAATGCAAATGG - Intronic
935596598 2:104883405-104883427 ATGGCCAATTTGAAGAAGAAGGG - Intergenic
937904123 2:127043720-127043742 ATGGCCAGTGTGCATGGGAATGG - Intergenic
938229178 2:129643495-129643517 ATGGCCAATGTTGATGAAAATGG + Intergenic
939563739 2:143762300-143762322 AGAACTAATCTGAATGAGAAAGG - Intronic
941422274 2:165297403-165297425 ATGGTCAAAATTAATGAGAAAGG - Intronic
941620441 2:167771862-167771884 AATGCCAATATGCATGAGAAGGG - Intergenic
943437497 2:187885066-187885088 TTGGCCAAGCTGAATAAGATGGG - Intergenic
944354699 2:198773354-198773376 ATGGTCAATCTCAATGTGAAGGG + Intergenic
946497196 2:220206396-220206418 TTGGGAATTCTGAATGAGAAAGG + Intergenic
947849588 2:233274984-233275006 ATGGCAGAGCTGACTGAGAAAGG + Intronic
1169035123 20:2444172-2444194 ATGGCAAATCTAACTGTGAAGGG + Intergenic
1169279948 20:4258345-4258367 ATGGCCAAGCTCAATGTCAAGGG - Intergenic
1174564941 20:51457827-51457849 CTGGCCAATTAGAATGGGAATGG + Intronic
1178815318 21:35924061-35924083 ATGGCCAAGCTGAAAGTCAAGGG - Intronic
1180031731 21:45214151-45214173 ATGGCAAATCAGCATGTGAAAGG - Intronic
1181504002 22:23338540-23338562 CTGGCAAAGCTGAAAGAGAAGGG - Intergenic
1181873394 22:25921243-25921265 ATGGCCAATCTGAAAGCCAAAGG - Exonic
949414046 3:3798089-3798111 ATGGATAATCTGCATGAAAAGGG + Intronic
950259517 3:11534166-11534188 ATGTTCAATCTGAATGAGAAAGG + Intronic
951693219 3:25418792-25418814 CTGGCCAAACTGACTCAGAAAGG + Intronic
954284070 3:49606406-49606428 AAGAACAATATGAATGAGAAAGG - Intronic
954747971 3:52797735-52797757 AAGGCCAATGGGAATGAGATGGG - Intronic
956030949 3:65037282-65037304 TTAGACAATCTGAATGAGAGTGG - Intergenic
958157555 3:89773995-89774017 ATTCTCATTCTGAATGAGAAAGG - Intergenic
960707481 3:120494649-120494671 TTGGCCCATCTGAGTGGGAAGGG - Intergenic
960744496 3:120872176-120872198 CTGGCCAATCAGCAAGAGAAAGG - Intergenic
960955981 3:123031213-123031235 ATGGCCATTCTAGCTGAGAATGG + Intergenic
970279418 4:14437622-14437644 ATAGCCAACCTGAATGTAAAGGG - Intergenic
971605929 4:28657291-28657313 AGGGACAATCTGAAAGAGTAAGG + Intergenic
971766523 4:30839264-30839286 ATAGCCAAAAGGAATGAGAAGGG + Intronic
976806702 4:89055331-89055353 AAGGCCAACCTTAAGGAGAAGGG + Intronic
978180250 4:105785952-105785974 ATGAACAATCTGAAAGTGAAAGG + Intronic
978298540 4:107237911-107237933 ATGGCCATTCTGACTGGGATAGG + Intronic
981200770 4:141976961-141976983 ATGGCAAATCTTTTTGAGAAGGG - Intergenic
981342380 4:143636365-143636387 ATGGTCAAGCTGAAGGAGACAGG + Intronic
981697149 4:147570328-147570350 AAGGCCATACTGAATTAGAATGG - Intergenic
982053947 4:151529017-151529039 ATGACCCATCTAACTGAGAAGGG - Intronic
985084221 4:186296454-186296476 GGGGCCAATTTAAATGAGAAGGG + Intergenic
986618050 5:9640048-9640070 ATGGTTAATCTTAGTGAGAAAGG - Intronic
987768799 5:22272551-22272573 ATGGTTAAGCTTAATGAGAAAGG - Intronic
992154412 5:73940704-73940726 ATGGCCAAGCCCAATGAGAAAGG - Intronic
995297985 5:110541987-110542009 ATGGCCAATATTACTGAAAATGG - Intronic
995954858 5:117765027-117765049 TAGGCCATTCTGAATGAGACAGG + Intergenic
997489878 5:134264957-134264979 ATGGCCAATAAGCATGTGAAAGG + Intergenic
999273463 5:150312371-150312393 ATGGTCAATCTGTCTCAGAATGG - Intronic
999511883 5:152260756-152260778 ATGGGGAATGTGAGTGAGAATGG + Intergenic
1001459536 5:171898083-171898105 ATGGTAAATCTGAATGTGACTGG - Intronic
1001859167 5:175038074-175038096 ATGGCCAAGCTCAATGTTAAAGG + Intergenic
1003477821 6:6500698-6500720 ATGGCAAATTTGAAAGATAAAGG + Intergenic
1005258496 6:24031103-24031125 ATGGAGAATTTAAATGAGAATGG - Intergenic
1005268363 6:24137218-24137240 ATGGCAAGACTTAATGAGAAAGG + Intronic
1005610030 6:27514822-27514844 AGGGCTATTCTGAAAGAGAAAGG - Intergenic
1007184562 6:39958048-39958070 ATGGCCATCCTGAATAAGAGAGG + Intergenic
1007868422 6:45002906-45002928 ATTGCCCAACTGAAAGAGAAGGG + Intronic
1010685329 6:78847839-78847861 ATGGTCAATTTGAAAAAGAATGG - Intergenic
1010817978 6:80382348-80382370 ATAGGCTCTCTGAATGAGAAGGG - Intergenic
1011878001 6:91986052-91986074 ATTGACCATCAGAATGAGAATGG + Intergenic
1015678932 6:135781878-135781900 CTGGCACATATGAATGAGAATGG + Intergenic
1016916632 6:149250057-149250079 ATAGCAAAACTCAATGAGAAGGG + Intronic
1018357411 6:163032798-163032820 ATGGTCAAACTGAATAAGATTGG - Intronic
1018566083 6:165155155-165155177 ATTGCCAATCTAAATGTGAGAGG + Intergenic
1019834127 7:3363970-3363992 ATGGCCAAAATGAAAGATAATGG - Intronic
1020542588 7:9477748-9477770 ATGGCAAGATTGAATGAGAAGGG - Intergenic
1024054706 7:45652636-45652658 ATGACCGATCTGCATGAAAAAGG - Intronic
1025741475 7:64200751-64200773 ATGGTCAAACTGATTAAGAATGG - Intronic
1027971970 7:85095277-85095299 ATGGCAAATATGAATGATAATGG + Intronic
1028304035 7:89239225-89239247 ATGCCCAAACTGAATGGGACAGG + Intronic
1031109373 7:117587677-117587699 ATGCTCAATCTGAATTTGAAAGG - Intronic
1033490026 7:141834323-141834345 GTAACCAATCTGAATGAGCAAGG - Intergenic
1034119234 7:148611739-148611761 ATGGCAAATCTGAAAGAGCTTGG + Intronic
1036507602 8:9369584-9369606 CTGGTCAAACTGAATTAGAAGGG - Intergenic
1040706976 8:50140359-50140381 ATGGGAAATCTGGCTGAGAAAGG - Intronic
1041010667 8:53539600-53539622 AAGGCAAATCGGAATGTGAAAGG + Intergenic
1041427241 8:57736132-57736154 ATAGCCAAACTGAATGAAATTGG - Intergenic
1041640682 8:60197380-60197402 ATGGACAATCATAATGATAAAGG + Intronic
1042789487 8:72587930-72587952 ATTGAAAATCTGAAAGAGAATGG + Intronic
1042943946 8:74136458-74136480 ATGGACCATCTGCATGAAAATGG + Intergenic
1047627292 8:126669092-126669114 AGGGCCAATTTGAATGAAAAAGG + Intergenic
1048014582 8:130485988-130486010 ATGGCCAATAGGAAGCAGAATGG - Intergenic
1051602989 9:18892696-18892718 CTGGCCAATCAGAATGTGAAAGG - Intronic
1052471442 9:28900657-28900679 CTGGACAAGCTGAATGATAAAGG + Intergenic
1052663535 9:31466665-31466687 ATGGTCAAACTGATTGAGATTGG - Intergenic
1055666331 9:78556655-78556677 CTTGCCAATCAGAATCAGAAAGG - Intergenic
1188982197 X:36736416-36736438 ATGGCCAACCACACTGAGAAGGG - Intergenic
1189385125 X:40531011-40531033 ATGGGCAATCTCAAAAAGAACGG - Intergenic
1190458708 X:50649484-50649506 ATTGCCAATATGACTGAAAATGG - Intronic
1190941259 X:55043638-55043660 ATGGCCATTCTGCAGGAGTAAGG - Intergenic
1194426266 X:93742227-93742249 ATGGCCAGTGAGAATGAAAATGG + Intergenic
1197583706 X:128316828-128316850 TTCACCAACCTGAATGAGAATGG + Intergenic
1198043376 X:132876201-132876223 ATGGGCAATTTGTGTGAGAATGG + Intronic
1199399345 X:147378196-147378218 AGGGCCAATGGGAATGAGTAGGG - Intergenic
1200779578 Y:7202170-7202192 ATTGCCAATCTTTCTGAGAAAGG + Intergenic
1201979826 Y:19894388-19894410 CTGGAGTATCTGAATGAGAAGGG + Intergenic