ID: 1146978794

View in Genome Browser
Species Human (GRCh38)
Location 17:37140455-37140477
Sequence ATGCATATTGATCTGTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146978794 Original CRISPR ATGCATATTGATCTGTAGCC AGG (reversed) Intronic
905240691 1:36579151-36579173 ATGCATGTGGATCTGTGCCCAGG - Intergenic
906984204 1:50665797-50665819 ATGCATATTATTTTGTAACCTGG - Intronic
910244161 1:85120942-85120964 ATGGATTGGGATCTGTAGCCAGG - Intronic
912734398 1:112137253-112137275 ATGGGTATTGAGCTGTAGCCAGG + Intergenic
915681664 1:157587277-157587299 CTGCACATGGATCTGTAGCGAGG + Exonic
922124444 1:222709135-222709157 ATGTATTTTCAACTGTAGCCGGG + Intronic
1063752552 10:8967267-8967289 ATGCAAGTAGAACTGTAGCCTGG - Intergenic
1063939711 10:11115112-11115134 CTGCATATTAATCTGCATCCTGG - Intronic
1068770576 10:60816060-60816082 ATTCATATTGATCTGTATATAGG + Intergenic
1074767061 10:116707248-116707270 CTGCATATTCATCTCCAGCCCGG - Exonic
1078941985 11:16016921-16016943 ATGCATATTGATAGATAGCACGG - Intronic
1080240516 11:30122074-30122096 ATGCATTTTGATCTGCTGTCTGG + Intergenic
1083381869 11:62275767-62275789 ATGTATATTCATCTGTTGTCTGG + Intergenic
1084343114 11:68521942-68521964 ATTAATATTGATCTGCAGCAAGG + Intronic
1088323434 11:108577153-108577175 ATGTAGGTTGATCTGTATCCTGG + Intronic
1089570312 11:119403626-119403648 ATGCTTTTGGATCTGAAGCCTGG + Intergenic
1089833886 11:121353069-121353091 AAGCATATTTATCAGTACCCTGG + Intergenic
1097527303 12:60753277-60753299 CTGCATTTTGATCTGAAGACTGG - Intergenic
1099279641 12:80627469-80627491 ATGCATCTTTATCAGGAGCCAGG + Intronic
1100582648 12:95949697-95949719 ATGCATATTGTTTTGTATTCGGG + Intronic
1100686474 12:96991913-96991935 ATGCACATTGATCCGTTGGCTGG + Intergenic
1100732980 12:97494145-97494167 ATGCATGTTCATCTGTCCCCAGG + Intergenic
1101428083 12:104604217-104604239 AGGCCTATTGAGCAGTAGCCTGG + Intronic
1110286371 13:73754311-73754333 TTGCATATTGTTCTGGAGACTGG + Intronic
1113380196 13:109797077-109797099 ATGCAAGTTCAGCTGTAGCCTGG + Intergenic
1113987187 13:114327592-114327614 AAGCATTCTGATGTGTAGCCAGG + Intergenic
1115610555 14:35045240-35045262 ATCCATATTGCTCTCTATCCTGG - Intronic
1120031552 14:79646988-79647010 AGGCAGACTGATCTGTGGCCAGG + Intronic
1121925402 14:97922838-97922860 ATGCATATGTATCTGTAGGTGGG - Intergenic
1128684456 15:69673347-69673369 ATGCAGATGGACCTGGAGCCTGG + Intergenic
1140521476 16:75585572-75585594 AGGCATTTTGCTCTGCAGCCGGG - Intergenic
1141782383 16:86171714-86171736 ATGTATATTGATCTCTCGCATGG - Intergenic
1143760423 17:9099023-9099045 TTGCATATTGTTTTGTAACCTGG + Intronic
1143788735 17:9276416-9276438 AAGCACATACATCTGTAGCCTGG - Intronic
1146552914 17:33797569-33797591 ATGCATGTTGATGTGAAGCTTGG + Intronic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1151904507 17:77038972-77038994 TTGCATCTTGATTTGGAGCCTGG + Intergenic
1152255714 17:79238339-79238361 AGGCATTTGGATCTGAAGCCAGG + Intronic
1153197269 18:2614409-2614431 CAGCATCTTGCTCTGTAGCCAGG - Intronic
1153714526 18:7833436-7833458 ATGCATATTGATTTTTGGCCAGG + Intronic
1159219534 18:65441316-65441338 ATGTATATTGAGAAGTAGCCGGG - Intergenic
930403590 2:50924897-50924919 ATGGCTATTTATCTGTAACCTGG + Intronic
933661206 2:84928455-84928477 ATGAGTATTGTCCTGTAGCCCGG - Intergenic
936101170 2:109581011-109581033 ATGCATATTATTCTTTAGCCAGG - Intronic
939493776 2:142904996-142905018 ATGCATCTTGATGGGCAGCCAGG - Intronic
940287437 2:152046693-152046715 CTGCCTGTTGAGCTGTAGCCAGG + Intronic
942020036 2:171858169-171858191 ATGCATACAGATCTGCAGACTGG + Intronic
1172314573 20:33943803-33943825 TTGCATATTGAGGTGTGGCCAGG - Intergenic
1174108168 20:48177737-48177759 ATGCATTTTGGTCTCTAACCTGG - Intergenic
949734754 3:7159320-7159342 AAGCAAATTGATCTTGAGCCAGG - Intronic
955331582 3:58051696-58051718 AAGCTTTTTGATGTGTAGCCAGG + Intronic
959949961 3:112168837-112168859 TGGCATATTGATCTGAAGACAGG + Intronic
961958625 3:130830432-130830454 ATGCATATAGAGCAGCAGCCAGG + Intergenic
965710218 3:171549383-171549405 AGGCAAATTGATCTGTAGTTGGG - Intergenic
967942265 3:194775393-194775415 ATGCTTCCTGCTCTGTAGCCAGG + Intergenic
968227520 3:196983645-196983667 ATGCACATGTATGTGTAGCCAGG - Intergenic
976615910 4:87076630-87076652 ATCCATATTAATCTTTAGCATGG + Intronic
976624271 4:87162346-87162368 CTACATATTGATTTGAAGCCAGG - Exonic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
978348394 4:107796084-107796106 CTGCATATAGATCATTAGCCTGG + Intergenic
978572623 4:110155651-110155673 ATGCATATTGAACTGTCTCGGGG - Intronic
979837360 4:125387742-125387764 ATGTATATTGATCTGTTGTATGG - Intronic
979915106 4:126421351-126421373 ATGCATATTGCCTTGGAGCCTGG - Intergenic
992005081 5:72469748-72469770 ATGCAAAATCATCTGGAGCCTGG + Intronic
993041006 5:82814690-82814712 ATGCAAATGGTTCTGTGGCCTGG + Intergenic
993335449 5:86652615-86652637 ATGCATATAGTCATGTAGCCAGG - Intergenic
999229794 5:150054967-150054989 CAGCATCTTGCTCTGTAGCCCGG - Intronic
999871271 5:155753804-155753826 ATGCATATCAATGTGTATCCAGG - Intergenic
1000038448 5:157466851-157466873 ATGCCTCTATATCTGTAGCCTGG - Intronic
1000268534 5:159660588-159660610 ATACATTTTTATCTTTAGCCTGG - Intergenic
1000621260 5:163489287-163489309 ATGGGTATTGGTCTGTAGCCCGG + Intronic
1004001168 6:11598508-11598530 ATGCAGCTTGTTCTCTAGCCAGG + Intergenic
1010154034 6:72771156-72771178 ATGCAGATTTAACTGTGGCCAGG + Intronic
1015370308 6:132443416-132443438 ATGCATACTTATCTGGACCCTGG - Intergenic
1021423196 7:20468684-20468706 ATGGAGTTTGATCTGTTGCCAGG + Intergenic
1023700770 7:42889998-42890020 TTGCATATTCATTTGTAGCATGG + Intergenic
1026780994 7:73267407-73267429 ATGGATCTTGCTCTGTTGCCTGG + Intergenic
1027021848 7:74820849-74820871 ATGGATCTTGCTCTGTTGCCTGG + Intronic
1027066173 7:75125068-75125090 ATGGATCTTGCTCTGTTGCCTGG - Intronic
1029616775 7:101664329-101664351 ATGCAAATTAATGAGTAGCCTGG - Intergenic
1030677592 7:112400268-112400290 CTGGAAATTGATGTGTAGCCAGG - Intergenic
1030988590 7:116272123-116272145 ATGCAGAATGATCTGGAGCTGGG - Intergenic
1032933529 7:136702016-136702038 ATCCATATTAATGAGTAGCCTGG + Intergenic
1034948373 7:155279330-155279352 ATACATTTTAATCTGAAGCCAGG + Intergenic
1035137695 7:156720908-156720930 ATCCCTATTTATCTGTACCCTGG - Intronic
1037077956 8:14745363-14745385 ATACATATTGATCTGTTGCCAGG + Intronic
1037698945 8:21254593-21254615 ATGCAAAATGATTTGTAACCTGG - Intergenic
1039181427 8:34871162-34871184 ATGCATACTGATCTGTAGTAAGG - Intergenic
1039483928 8:37897196-37897218 ATGCCTATTCATCTCTGGCCAGG + Intronic
1042905268 8:73766136-73766158 ATACATATTGACATATAGCCGGG - Intronic
1043221799 8:77674705-77674727 ATGCATATTCATCAGAAACCAGG - Intergenic
1044387250 8:91603492-91603514 CTGCATCTTGCTCTGTTGCCGGG - Intergenic
1045804170 8:106137616-106137638 ATGAATATTGATCTGTAAGTAGG + Intergenic
1051150814 9:14076986-14077008 ATTCACATTGATCTCTTGCCTGG - Intergenic
1053412830 9:37926766-37926788 ATGCATGGAGAGCTGTAGCCTGG + Intronic
1053808900 9:41832556-41832578 ATGAAGGTGGATCTGTAGCCTGG - Intergenic
1054621692 9:67354872-67354894 ATGAAGGTGGATCTGTAGCCTGG + Intergenic
1059084257 9:111283267-111283289 ATGCATATCAATCTGTTACCTGG + Intergenic
1061153172 9:128841047-128841069 CTGCATACTGTTCTGTTGCCTGG - Intronic
1061895116 9:133643138-133643160 ATGCATATGGGGCTGTGGCCGGG - Intronic
1186824496 X:13325787-13325809 CTGCATATTCATCTGTTGCTCGG - Intergenic
1189018618 X:37310651-37310673 ATGAACATTTATCTGTAGACTGG + Intergenic
1195962622 X:110401683-110401705 ATGCTTATTGATCTGACTCCAGG - Intronic
1196089754 X:111726917-111726939 ATGCATACTGTGCTGCAGCCTGG - Exonic
1199448599 X:147954778-147954800 ATCCATAATGATCTGTAATCTGG - Intergenic
1200736180 Y:6798575-6798597 AAGCATAAGGCTCTGTAGCCAGG - Intergenic