ID: 1146978800

View in Genome Browser
Species Human (GRCh38)
Location 17:37140613-37140635
Sequence TTGTAGCCACAGTTGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 2, 1: 20, 2: 12, 3: 20, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146978798_1146978800 26 Left 1146978798 17:37140564-37140586 CCAAAAACAGGCTTAATTCACTT 0: 1
1: 0
2: 0
3: 23
4: 221
Right 1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG 0: 2
1: 20
2: 12
3: 20
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146978800 Original CRISPR TTGTAGCCACAGTTGGAGCC TGG Intronic
900329532 1:2127118-2127140 TTGTTGCCTCAGTGGGAGCCTGG + Intronic
904511402 1:31012094-31012116 TGGTAAGCAGAGTTGGAGCCAGG - Intronic
904786690 1:32988214-32988236 TTGTATACATAGCTGGAGCCTGG - Intergenic
905420728 1:37841656-37841678 TTATAGCCACAGTTGGAGCCTGG - Intronic
905694293 1:39963377-39963399 TTGTAGCCACAGCTGGAGCCTGG - Intronic
906302841 1:44696124-44696146 TTGCTGCCATAGTTGGGGCCAGG - Intronic
906325700 1:44843926-44843948 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
906950036 1:50326986-50327008 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
907039948 1:51250603-51250625 TTGTAGCCACAGCTGGAGCCTGG + Intronic
907315397 1:53567705-53567727 TTTTAGCCACAGCTGGGGCTAGG - Intronic
909700225 1:78513834-78513856 TTTGAGCCACAGGTGGAGTCCGG - Intronic
911737993 1:101358417-101358439 TTTCAGCCACAGTTAGAGCCCGG - Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
913100434 1:115559118-115559140 TTGTAGCCATTGTTGGAGTCTGG - Intergenic
914830106 1:151165119-151165141 CTGGAGCATCAGTTGGAGCCCGG - Exonic
915245512 1:154553464-154553486 TTTTAGGAACAGTTGGAGCAGGG - Intronic
916102801 1:161407060-161407082 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
916523109 1:165582451-165582473 TTGTAGCTACAGCTGGAGCCTGG - Intergenic
917924240 1:179775638-179775660 TTTTAGCCCCAGTTATAGCCTGG + Intronic
919548214 1:198949778-198949800 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
922730433 1:227946527-227946549 CCGTACCCACAGTTGGAGCCAGG + Intronic
1073078511 10:100839994-100840016 TAGTATCCACAGTTGGGGGCTGG - Intergenic
1073489531 10:103843802-103843824 TGGCAGCAACAGTGGGAGCCAGG - Intronic
1076761888 10:132610159-132610181 TTGGAGCCCCAGGTAGAGCCTGG - Intronic
1079058717 11:17229124-17229146 TTGTAGCCACAGCTAGAGCCTGG - Intronic
1080639843 11:34152296-34152318 TTGTAGGCCCTCTTGGAGCCAGG - Exonic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083348617 11:62011756-62011778 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1084130969 11:67133985-67134007 TTAAAACCACAGTTGGTGCCGGG - Intronic
1085475581 11:76786843-76786865 TTGTAGCCACACTGGGATCCTGG + Intronic
1085965032 11:81513165-81513187 TTTTAGCCACAGCTGAAGCAGGG - Intergenic
1091121366 11:133060602-133060624 ATGCAGCCACAGTAGGAGCAGGG - Intronic
1098614636 12:72507910-72507932 TTTTAGCCACTGCTGGAGCTAGG - Intronic
1101318684 12:103653456-103653478 TTGGAGCCACATTTGAATCCTGG - Intronic
1101506662 12:105353180-105353202 CTGTAGTCACAGCTGGATCCAGG + Intronic
1102478545 12:113204623-113204645 TTGTAGAAAAAGTTGGGGCCAGG + Intronic
1104265974 12:127232692-127232714 TTGTAGTCACAATTTGAGGCTGG + Intergenic
1106052944 13:26208401-26208423 ATGTAGCCACAGTTTGATGCTGG + Intronic
1106396402 13:29385100-29385122 TTGTACCAACAACTGGAGCCTGG - Intronic
1106433990 13:29707992-29708014 TTGCAGACAGAGGTGGAGCCGGG - Intergenic
1107374010 13:39782666-39782688 TTGGAGCCACAGTAGAAGACAGG + Intronic
1109725502 13:66335680-66335702 TTATAGCCACAGTGGTAGGCAGG + Intronic
1111336549 13:86833035-86833057 TTGTAGCATCTTTTGGAGCCAGG - Intergenic
1112790307 13:102995510-102995532 TTTTAGCCACGGCTGGAGCTGGG + Intergenic
1113945347 13:114040914-114040936 CTTTAGCCACAGTCGGAGCCGGG + Intronic
1114250515 14:20956062-20956084 TTGTCACCACAGTGGAAGCCAGG + Exonic
1115289277 14:31751984-31752006 TTTTAGCCATGGCTGGAGCCTGG + Intronic
1116696379 14:48183230-48183252 TTTTAGCCATAGCTGGAGCTGGG - Intergenic
1117331047 14:54712193-54712215 TTGGAGCCACTGTTGTAGTCTGG + Intronic
1118725670 14:68627387-68627409 GTGTGTCCACAGTTGGAGCAGGG + Intronic
1119403082 14:74377728-74377750 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120098559 14:80418084-80418106 TTATATCCACACTTGAAGCCAGG - Intergenic
1121310102 14:92931322-92931344 GTGAAGCCACAGACGGAGCCAGG + Exonic
1122183830 14:99974332-99974354 TAATAGCCATAGCTGGAGCCTGG + Intronic
1122912131 14:104835999-104836021 TTGTAGCCACAGCAGGAGCCTGG + Intergenic
1129452835 15:75660239-75660261 TTGTGGCCACAGATGGGGGCTGG + Exonic
1130214797 15:81958107-81958129 CTGTAGCCAAAGTTGGATTCAGG - Intergenic
1130765858 15:86870414-86870436 TTCTTGCCACAGTTGGATGCAGG - Intronic
1131889646 15:96958819-96958841 TTGTAGCTGGAGCTGGAGCCAGG + Intergenic
1135325494 16:21522915-21522937 TGGAAGCAACAGTAGGAGCCGGG + Intergenic
1135331950 16:21567763-21567785 TAAAAGCCACAGCTGGAGCCAGG - Intergenic
1135978752 16:27129845-27129867 TTTCAGGCACAGTTGGATCCAGG + Intergenic
1137451329 16:48577529-48577551 TTGCAGCCACAGCTGCAGCCTGG + Intronic
1138484793 16:57332378-57332400 TTGTAGCCACAGTTGGAGCCTGG + Intergenic
1139740968 16:69034500-69034522 CTGTAACCACAGCTGGAGCCTGG - Intronic
1142038492 16:87877502-87877524 TGGAAGCAACAGTAGGAGCCGGG + Intergenic
1146221027 17:31020710-31020732 TTTTAGGCACAGCTGGATCCCGG + Intergenic
1146576935 17:34002385-34002407 CTGTAGCATCAGTTGGATCCAGG + Intronic
1146899567 17:36574464-36574486 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG + Intronic
1148138761 17:45313062-45313084 TTGTAGCCTCATTTGGAGTATGG + Intronic
1148377168 17:47159196-47159218 TTGTAGCCACAGCTGGAGCCCGG + Intronic
1148961563 17:51397567-51397589 TTGGGGCCAGAGTTGGAGCCAGG + Intergenic
1149166236 17:53756994-53757016 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1150366726 17:64594425-64594447 TTTTAGGCACAGCTGGATCCCGG - Intronic
1151348202 17:73516201-73516223 TGGTAGAGACAGCTGGAGCCTGG + Intronic
1152008118 17:77695091-77695113 TTGAAGCCAGAGTAGGAGGCAGG - Intergenic
1153107958 18:1549993-1550015 TTTTGGCCACAGCTGGAGCTGGG - Intergenic
1153343964 18:4006529-4006551 TTGCAGTCACAGTTGGAGGAGGG + Intronic
1156317951 18:35988473-35988495 TTGGAGTCAAACTTGGAGCCAGG + Intronic
1157222882 18:45839910-45839932 TTGTGGCCACAGCAGCAGCCAGG - Intronic
1158412545 18:57220924-57220946 TTGTTGCTACAATTTGAGCCAGG + Intergenic
1158641880 18:59210726-59210748 TTCTAGCCAAAGTGTGAGCCAGG + Intergenic
1158687851 18:59630807-59630829 TTGTACCCACAGTGGGATTCAGG + Intronic
1159601345 18:70431098-70431120 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1160742080 19:691148-691170 TTGTAACCACAGCTGGAGCCGGG - Intronic
1161709329 19:5838963-5838985 TTGAAGCCACAGGTGGGGCAAGG - Exonic
1162674093 19:12285158-12285180 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1162742118 19:12779234-12779256 CTGTGGCCACAGCTGGACCCCGG + Intronic
1163296061 19:16413549-16413571 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1164789646 19:30965154-30965176 TTGTACCCTCTGTTGGAACCAGG - Intergenic
1166313814 19:41977752-41977774 TTGCAGCCACAGAGGTAGCCAGG - Intronic
1166520641 19:43477991-43478013 TTGGAGACTCAGTTGGAGTCAGG - Intronic
1167019676 19:46863757-46863779 TTATGGCCACAGTTGGACCTAGG + Intergenic
1167604535 19:50474909-50474931 CTGGAGCCACAGTGGGACCCTGG + Intronic
927801178 2:26101322-26101344 TAGCAGCCACAGCTGGAGCCTGG + Intronic
928914908 2:36460134-36460156 ATGTAACCACAGCTGCAGCCAGG - Intronic
933659636 2:84916638-84916660 TTGTAGCCACATCTGAAGCCTGG - Intergenic
936024232 2:109019092-109019114 TTGTAGCCACAGAGGAGGCCCGG + Intergenic
938291573 2:130153516-130153538 TTGTTGCCACTGTTGTAGGCTGG - Intronic
938464978 2:131519447-131519469 TTGTTGCCACTGTTGTAGGCTGG + Intergenic
939796292 2:146648135-146648157 TTGAAGCCACAGATGGATTCGGG - Intergenic
942195958 2:173520330-173520352 GTGTAGCCTCAGAAGGAGCCAGG + Intergenic
944644388 2:201763549-201763571 TTGTAGCCACAGCTAGAGCCTGG - Intronic
946488022 2:220119663-220119685 TTGTTGTCACAGCTGGAGACAGG + Intergenic
946608463 2:221432367-221432389 TTGTAGCCACATTTGGATTCAGG - Intronic
946707873 2:222476383-222476405 TTGAAGTCCCAGGTGGAGCCAGG - Intronic
948460963 2:238129801-238129823 CTGTAGCCACAGGTGGCTCCTGG + Intronic
1171963048 20:31509071-31509093 TTGCAGCCCCTGCTGGAGCCTGG - Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1173314542 20:41931441-41931463 TTTGAGCCACAGCTGGAGCTGGG + Intergenic
1175099468 20:56568187-56568209 TTGTATCCACGGGTGGATCCTGG + Intergenic
1179133549 21:38660473-38660495 CTGTAGCCAGCGTGGGAGCCGGG + Intronic
1180076760 21:45467093-45467115 TTGCAGCCACAGTCTGGGCCAGG - Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181068369 22:20317174-20317196 CTGTAGGCACAGCGGGAGCCAGG - Intronic
1181544233 22:23592014-23592036 GCGTAGCCACAGAAGGAGCCTGG - Intergenic
1181981375 22:26769232-26769254 TTGTACCCACAGCCAGAGCCGGG + Intergenic
1184757271 22:46524144-46524166 TTGTAGCGACAGGAAGAGCCAGG - Intronic
1184798074 22:46743247-46743269 ATGGGGCCACATTTGGAGCCTGG + Intergenic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949826845 3:8174565-8174587 ATGTAGCCAGAGTTGGAGGTGGG - Intergenic
951319063 3:21223123-21223145 TAGTAGACACATTTGGAGCAGGG - Intergenic
954796711 3:53165162-53165184 TTGTAGCAGCAGCGGGAGCCAGG + Intronic
954914851 3:54139978-54140000 TTTAAGCCACTGGTGGAGCCAGG - Intronic
954958999 3:54548269-54548291 ATGTAGCCACATTAGGAGCAAGG + Intronic
955476362 3:59340409-59340431 TGGCACTCACAGTTGGAGCCTGG - Intergenic
958928050 3:100180051-100180073 TTTTAGTCACAGCTGGAGCTGGG + Intergenic
964523714 3:157594846-157594868 TTGTAACCACAGTTGGAGGCAGG + Intronic
968512157 4:1000536-1000558 TTGTGGCCACGGTTCCAGCCTGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970469267 4:16360516-16360538 ATGTAGACAGAGTTGGAGCTGGG - Intergenic
972879850 4:43410046-43410068 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
976000799 4:80371166-80371188 TTTGAGCCACAGCTGGAGCTGGG + Intronic
977242776 4:94593189-94593211 TTGCAGCTACAGTTGCATCCAGG - Intronic
983657527 4:170098327-170098349 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
985561329 5:587675-587697 TTGTGGCCAGAGCTGGAGCCGGG - Intergenic
988265938 5:28951228-28951250 TTATAGCCACAGTGGAAGCCTGG - Intergenic
988554302 5:32223063-32223085 ATGTAGCCACCTTTGGAACCTGG + Intergenic
989895930 5:47082941-47082963 TTGAAGCCTCAGTTGGAAACGGG - Intergenic
991324570 5:65416195-65416217 TTGTAGTCACAGCTGGAGCCTGG - Intronic
992520592 5:77546239-77546261 TTGTAGCCACAGCTGGAGCCTGG - Intronic
995092512 5:108194747-108194769 TTGGAGCCAAGGTTAGAGCCAGG - Intronic
995732846 5:115264653-115264675 TTGTAGCCACCGCTGGAGCCTGG + Intergenic
997789313 5:136743039-136743061 TTTTAGTCACAGCTGGAGCTGGG - Intergenic
999348388 5:150844483-150844505 TAGCAGCCACAGATGAAGCCTGG + Intergenic
999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG + Intronic
1000671896 5:164073381-164073403 TTGTTGTCACAGTTGGAGGTAGG - Intergenic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1003181523 6:3795964-3795986 CTGCAGCCACAGCTGGAGTCTGG + Intergenic
1004543462 6:16573777-16573799 TTGTAGGCACAGTGGCAGCAGGG - Intronic
1006976243 6:38104926-38104948 GTGTAGCAACTGTTGGAGACAGG + Intronic
1007669327 6:43538827-43538849 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG + Intergenic
1012477516 6:99630841-99630863 TTGTTGGCACAGTTGGAAGCTGG + Intergenic
1013052447 6:106549392-106549414 TCATGGCCACAGGTGGAGCCAGG + Intronic
1013290879 6:108717693-108717715 CTGCAGCCACAGTGGGAGCGGGG - Intergenic
1014658063 6:124132232-124132254 TTGTAGCCACTGTGGGGGACAGG - Intronic
1016126291 6:140408337-140408359 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1016785868 6:148010506-148010528 TTTTAGCCACAGCTGGAGCTGGG - Intergenic
1017638669 6:156468560-156468582 TTGTGTCCACAGATGGGGCCTGG - Intergenic
1019058088 6:169237092-169237114 GAGCAGCCACAGCTGGAGCCGGG - Intronic
1019758361 7:2789816-2789838 TTGCAGCCACAGAGGAAGCCAGG + Intronic
1021719442 7:23491337-23491359 TTGTAGTCACAGCTGGAGCCTGG - Intergenic
1027395317 7:77747481-77747503 TTTGAGCCACAGCTGGAGCTGGG - Intronic
1028903662 7:96129130-96129152 TTGCAGTCACAGTAGCAGCCAGG - Intronic
1030669870 7:112324596-112324618 TTGTAGCCACAGTTGCTGGTTGG - Intronic
1031040773 7:116836462-116836484 TTGGAGTCAGAGCTGGAGCCAGG - Intronic
1031313208 7:120225667-120225689 TTGTAGACATAGTTGGACCTAGG - Intergenic
1031665876 7:124481368-124481390 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1032491976 7:132330598-132330620 ATGCAGACACAGTTGGGGCCTGG - Intronic
1034692409 7:153024313-153024335 TTATAGCCAAAGTTGAGGCCTGG + Intergenic
1035451407 7:158979489-158979511 TTGTAGCCACCGTCAGAGCCAGG + Intergenic
1036137611 8:6176160-6176182 TTGCAGCCTCTGCTGGAGCCGGG - Intergenic
1036598209 8:10233186-10233208 TTGTAGCCACTGCTGCAGCAGGG + Intronic
1036920214 8:12845482-12845504 TGGTAGCCACAGCTGGAGCCTGG + Intergenic
1038856993 8:31344798-31344820 TTGCAGCCACCCTTGAAGCCAGG + Intergenic
1041532372 8:58884060-58884082 TTGAAGCCTCAGCTGGACCCTGG - Intronic
1044971409 8:97624208-97624230 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1051057215 9:13001774-13001796 TTGAAGACACAGAGGGAGCCAGG - Intergenic
1055993433 9:82131605-82131627 TTGTAGCCATAGCTGGAGCCTGG - Intergenic
1057924195 9:99128625-99128647 ATGTAGCAACATTTGGACCCAGG - Intronic
1058147525 9:101428513-101428535 TTGTATCCACAGTTAGACCAAGG - Exonic
1059058963 9:111014923-111014945 ATGTGACCACATTTGGAGCCAGG + Intronic
1061009036 9:127944495-127944517 TTGTCGCCACAGTGTGACCCTGG - Intronic
1193239324 X:79148170-79148192 TTGTGCCCACCGTGGGAGCCAGG + Intergenic
1197595116 X:128455025-128455047 TTCTAGCCACACTTGCAGCTGGG + Intergenic