ID: 1146984691

View in Genome Browser
Species Human (GRCh38)
Location 17:37204121-37204143
Sequence CTTTCTCTGCAAGAAGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146984690_1146984691 12 Left 1146984690 17:37204086-37204108 CCACTGAATTAAATTTTGAAAAC 0: 1
1: 3
2: 3
3: 54
4: 565
Right 1146984691 17:37204121-37204143 CTTTCTCTGCAAGAAGTCCATGG 0: 1
1: 0
2: 1
3: 17
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146984691 Original CRISPR CTTTCTCTGCAAGAAGTCCA TGG Intronic
902628019 1:17688171-17688193 CTTTCTCAGAAAAAACTCCAAGG - Intronic
903914731 1:26755465-26755487 CTTTTTCTCCAAGAAGCTCAGGG + Intronic
904249189 1:29210523-29210545 CTTTCTATGTATGAAATCCAGGG + Intronic
904299569 1:29545588-29545610 CTGTCTCTGCAAGTATTGCAGGG - Intergenic
905445756 1:38027574-38027596 CTGTCTCAGCAAAAAGTGCAGGG + Intergenic
905711453 1:40107939-40107961 GTTTCTCTGCAAGAATTCTAGGG + Intergenic
907286787 1:53385578-53385600 TTCTCTCTGCAAGAAGCCCAAGG - Intergenic
907715642 1:56923525-56923547 CTTGCCCTGCAAGAAGTCACTGG - Intergenic
907971336 1:59384497-59384519 CTTTCTCTACAATAACCCCATGG - Intronic
908781299 1:67692985-67693007 ATTTCTCTGCAAAAATTGCAGGG + Intergenic
909566082 1:77054847-77054869 CTTTCTTCCTAAGAAGTCCATGG - Intronic
910065986 1:83151366-83151388 CTTTCTTGGCAGGCAGTCCAGGG + Intergenic
910150047 1:84131921-84131943 CTCTCTCTGCAAGAACTACGAGG - Intronic
911816156 1:102354403-102354425 ATTTCTTTACAAGATGTCCATGG - Intergenic
916062599 1:161110564-161110586 CTTTCTCTCCAAAATGTCCTAGG + Intronic
916326421 1:163564973-163564995 GTTTCTCTGCATGAAGCCCCTGG - Intergenic
917332340 1:173894489-173894511 CTTTCTCTCCATGAAGTCTAAGG + Exonic
918103641 1:181397933-181397955 CTGTCTCTGCAAAAAGGCGATGG - Intergenic
918342421 1:183578756-183578778 CATTCTCTGCTACAAGTCCCAGG - Intronic
918462921 1:184794933-184794955 CTTTCTCTGAAAAAAGCCAAAGG - Exonic
920275932 1:204804250-204804272 CTTTCTATGCCACAAGACCATGG - Intergenic
922118762 1:222641550-222641572 CTTCCTCTTCAAGAAGTCCTTGG + Intronic
1063279920 10:4616667-4616689 TTTTTTCTGTAAGGAGTCCATGG - Intergenic
1063648330 10:7908268-7908290 CTTTTTCTGCCTGAAGGCCATGG + Intronic
1063955822 10:11265574-11265596 CTTTTTCTCTAAGAAGCCCAAGG + Intronic
1064093292 10:12403629-12403651 CATTCTCTGCAGGAATTCTATGG - Intronic
1067551995 10:47242782-47242804 CTTTTGCTGCCAGAAGTTCAGGG + Intergenic
1068270302 10:54715361-54715383 CTGTTTCTGCAACAAGTGCATGG - Intronic
1068444059 10:57097070-57097092 CTGTCTCTGTAAGGAGGCCATGG - Intergenic
1068630305 10:59291026-59291048 CTTTCAACACAAGAAGTCCAAGG + Intronic
1070274509 10:74992726-74992748 CTTACTCTGCAAGCAGCACATGG - Intronic
1070988838 10:80713736-80713758 CGTCCTCTGCAATAAGTTCAGGG + Intergenic
1072069342 10:91901217-91901239 CTCTCTCTGCATGAAGACTAGGG + Intergenic
1072421547 10:95293842-95293864 CTTTCTGGGCAACAATTCCAAGG + Intergenic
1075618216 10:123906775-123906797 CTTTCTCTCCTAAAAGTGCATGG - Intronic
1077123471 11:921821-921843 CTTTTTCTGCATTATGTCCAGGG + Intergenic
1078636143 11:13052269-13052291 CCCTCTCTGCCAGATGTCCATGG + Intergenic
1078777173 11:14404188-14404210 GTTTCCCTGCAAGAATTCAAAGG - Intergenic
1079364705 11:19799225-19799247 CTTCATCTTCAAGAACTCCAGGG + Intronic
1080655702 11:34256402-34256424 GTTTCTCTGCTAGAAACCCAAGG - Intronic
1081747785 11:45485077-45485099 CTTTCTCTGCATTAAGGCCTTGG + Intergenic
1084455666 11:69266816-69266838 CTTTCTCTGCACCAGGTGCAGGG - Intergenic
1085137547 11:74106480-74106502 CTTTCTCAGCCAGAAGTCATTGG - Exonic
1086363853 11:86088300-86088322 CTTCCCCTGCAAGAAGCCTAAGG + Intergenic
1089840131 11:121409712-121409734 CTTTCTCTGAAAGAAATTCAGGG - Intergenic
1090265181 11:125349065-125349087 CCTTCTCTGCCAGAGTTCCAGGG + Intronic
1090481630 11:127074076-127074098 TTTTCTCCTCAAGAAATCCAGGG + Intergenic
1090828958 11:130407687-130407709 CTTACTCTGCAGGAAGTACATGG + Intronic
1093697704 12:22180954-22180976 CTTTCCTTGCCAGAAGTACATGG - Intronic
1093788080 12:23215677-23215699 CTTTCTCTGCCACATGACCAGGG - Intergenic
1094807305 12:34106377-34106399 CTGCCTCTGCCTGAAGTCCAGGG - Intergenic
1095079799 12:37985799-37985821 CTTTCTCTCCAAGAGCTCAATGG - Intergenic
1095707834 12:45257059-45257081 CATTCTTTCCAAGAAGTCTAGGG + Intronic
1096687457 12:53298058-53298080 CTTCCTCTTGAAGAAGTCCTTGG - Exonic
1097045346 12:56183786-56183808 CTTGCTCTGCTAGATGTCCTAGG + Intronic
1097915229 12:65014081-65014103 ATTTCTCTGCTAGAACTCCCTGG + Intergenic
1101695045 12:107117243-107117265 CTTTCTCTGCAGGAAGTCTCTGG + Intergenic
1103241704 12:119418907-119418929 CTTTCTTGGAGAGAAGTCCAAGG - Intronic
1106469115 13:30039020-30039042 CTTCCTTAGCAAGCAGTCCAAGG - Intergenic
1109237229 13:59839178-59839200 ATTTCCCTGCAAGAAGGCAAAGG + Intronic
1109906478 13:68847935-68847957 TTTTCACCGCAAGAAGACCAAGG + Intergenic
1111619970 13:90712634-90712656 CTTTCTCTCAAAGAAAGCCAGGG - Intergenic
1112630544 13:101157248-101157270 CTCTCTCAGCAAGAAGAGCAGGG - Intronic
1113031329 13:105997007-105997029 CTCTCTCTGCCAGAACTCAAAGG + Intergenic
1113058616 13:106297153-106297175 CATTCCCTGAAAGATGTCCAGGG - Intergenic
1114389681 14:22293695-22293717 CTTTCTCTCCAACAAATCCATGG + Intergenic
1116200145 14:41783143-41783165 CTTTCCCTGCCAGAAGCCTATGG + Intronic
1116242586 14:42364512-42364534 CTTTCTCTGGCAGAACTCCAAGG - Intergenic
1117078064 14:52123878-52123900 AGTTCTCTGCAATAATTCCATGG - Intergenic
1121022610 14:90590328-90590350 ATTTCTCTGCTGGAAATCCAAGG + Intronic
1121529005 14:94639650-94639672 CTTTCTCTGCCACAAGTGCTTGG - Intergenic
1122200599 14:100120385-100120407 CTCTGCCTGCAAGAAGCCCAGGG + Intronic
1122658698 14:103279738-103279760 CTTTTTCTGGATGGAGTCCAGGG - Intergenic
1122829657 14:104389605-104389627 CCTTCTCTCCAGGAAGGCCAGGG - Intergenic
1126454944 15:48850878-48850900 CTTTCTCTGCTCGAAACCCAAGG - Intronic
1127592536 15:60440093-60440115 CTTTCTGTGCATGAACTCAATGG + Intronic
1130186342 15:81687314-81687336 CTCACTCTGCAAGAGGACCAAGG + Intergenic
1131775331 15:95789980-95790002 ATTTCTCAGCATGAACTCCATGG - Intergenic
1131836164 15:96393334-96393356 GTTTCTCTTCCAGAAGTTCATGG + Intergenic
1132202640 15:99965410-99965432 CTTTCTCTCCAACAAGTCAATGG - Intergenic
1134039858 16:11060190-11060212 CTTTCCCTGCCAGCAGACCAGGG - Intronic
1135735013 16:24923993-24924015 CTCACCCTTCAAGAAGTCCAAGG + Intronic
1135802369 16:25509826-25509848 TTTTCTCTCCAAGATTTCCATGG + Intergenic
1138947984 16:61875283-61875305 ATTTCTCTACATGGAGTCCACGG - Intronic
1139441318 16:66969078-66969100 CATTCTCAGCAACAAGTCCTGGG - Intronic
1140746085 16:77981656-77981678 CTTTCTCAGCAGGAAGCCAACGG + Intergenic
1141199589 16:81886984-81887006 CTTTCTTTGCAGCCAGTCCAGGG + Intronic
1142217234 16:88835823-88835845 CTGTCTCTTAATGAAGTCCAGGG + Exonic
1146984691 17:37204121-37204143 CTTTCTCTGCAAGAAGTCCATGG + Intronic
1147120971 17:38334898-38334920 CTTTCTCTGAAAGATGTGCTGGG + Intronic
1147559209 17:41498708-41498730 CTCTGTCTTCAAGGAGTCCACGG - Intergenic
1147934887 17:44005689-44005711 CATGCGCTGCAAGAAGGCCAGGG - Exonic
1150467285 17:65403993-65404015 CTTTCTGTGCAAGCTGGCCAGGG + Intergenic
1150973332 17:70055607-70055629 CTGTTTGTGCAAGAATTCCAAGG - Intronic
1151734047 17:75927693-75927715 GTTTCCCTGCCAGAAGCCCATGG - Intronic
1153455803 18:5280839-5280861 CTTGCTCTGCAAGCAGACCTAGG + Intergenic
1155918433 18:31578649-31578671 CTTTAACAACAAGAAGTCCAAGG - Intergenic
1159689514 18:71468695-71468717 CTTGCTTTGCTAGAAGCCCAGGG + Intergenic
1162491644 19:10995898-10995920 CCTTCTCTCCACCAAGTCCAAGG - Intronic
1162501787 19:11058341-11058363 CTTTATCTTCTTGAAGTCCACGG - Exonic
1164740487 19:30572162-30572184 CTTTTTCTGCAAGTAGTACCTGG - Intronic
1167344379 19:48936105-48936127 CGTTCTGTGCGAGAAGCCCACGG + Exonic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
928123668 2:28601942-28601964 CTCTCTATGCAGGACGTCCAAGG - Exonic
929969725 2:46563655-46563677 ATTACCCTGCAAGAAGTCCCTGG - Intronic
930448783 2:51508706-51508728 CTTTCTCCTCAAGGAGTTCATGG + Intergenic
930767334 2:55097403-55097425 CTTTCTTTACAAGAAGTACCTGG - Intronic
931265507 2:60656623-60656645 CTTTCTCTGCATGCAGGCCTGGG - Intergenic
932966143 2:76477090-76477112 TTTTCTCTGCTTGGAGTCCATGG + Intergenic
934020503 2:87946779-87946801 TCTTCTCTGCCAGAAATCCACGG - Intergenic
935349546 2:102141897-102141919 CTCTCCCTGCAAGGAGCCCAAGG + Intronic
935387383 2:102514280-102514302 CTTTCACTGTCAGAATTCCAAGG + Intronic
937052570 2:118904489-118904511 CTGTCTCTGCTGGAAGTCCCAGG - Intergenic
940060022 2:149554820-149554842 CTTTCTTAACAAGAGGTCCATGG + Intergenic
945471782 2:210235407-210235429 CTTTCTTGGCATCAAGTCCAGGG - Intergenic
945771969 2:214054658-214054680 GATTCTCTGTAAGAAGTCAAAGG - Intronic
945825064 2:214711730-214711752 CTTTCTCTGCCTGAAAACCACGG + Intergenic
947391132 2:229640815-229640837 TTTTCTCTGGCAGAACTCCAGGG + Intronic
947696727 2:232196594-232196616 CTTGCTCTTCAAGAATTCTAGGG - Intronic
1168876976 20:1178491-1178513 CTTTCTTTGCAGGCATTCCAGGG - Intronic
1169326992 20:4684544-4684566 CTTTCCCTCCAAGAAATCCCAGG + Intergenic
1169543599 20:6628349-6628371 CTTCATCTGCAAGAAGACTAGGG - Intergenic
1170528585 20:17266632-17266654 CTTGCTCTCCAAGAAGTCTCTGG - Intronic
1170885122 20:20334019-20334041 CTTTCTCTGCTCCAAGTGCATGG - Intronic
1171168429 20:22993889-22993911 CTGTCTCTACAAGAACTCCCAGG - Intergenic
1176423854 21:6535754-6535776 GGTTCTCTGCATGAACTCCAAGG + Intergenic
1179699347 21:43144069-43144091 GGTTCTCTGCATGAACTCCAAGG + Intergenic
1179811032 21:43869817-43869839 CTTTCTCTGGCAGAGCTCCATGG + Intronic
1180594378 22:16963725-16963747 CTTGCTCGGCTGGAAGTCCAGGG + Exonic
1181041919 22:20196316-20196338 CCTTCTCTGCAAGATGTCCCGGG - Intergenic
1181042575 22:20199193-20199215 CCTTGTCTGCAAGATGTCCCAGG + Intergenic
1181576145 22:23796466-23796488 ATTTCTCTGCACAAAGCCCAAGG + Intronic
1182073835 22:27481270-27481292 CTTTCACTGCACGAAGCCCTCGG + Intergenic
1184254186 22:43277860-43277882 CCTTCTCTGCCACAAGTCCTGGG - Intronic
950720756 3:14881033-14881055 CTTTCTCAGCAAGAGGGCTAAGG - Intronic
951483417 3:23185955-23185977 ATTTCTCTGGATGTAGTCCATGG + Intergenic
952197202 3:31088480-31088502 CCTTCTCTGTGAGAAGTCCCAGG + Intergenic
952257166 3:31705447-31705469 CTCTGTCTGAAAGAGGTCCATGG + Intronic
953181295 3:40597491-40597513 CTTTCTCTGCAGGATCACCATGG - Intergenic
953521894 3:43650840-43650862 CTAACTCTGAAAGAAGTCAAAGG + Intronic
953778687 3:45845695-45845717 CTTACATTGCCAGAAGTCCATGG - Intronic
954358271 3:50101296-50101318 CATTTTTTGCAAGAACTCCAAGG + Intronic
955379320 3:58424051-58424073 ATTTCTCTGTAAGAATACCATGG + Intronic
955776010 3:62433749-62433771 CTGTGTCTTCAAGAAGTACAAGG + Intronic
957428563 3:80071669-80071691 CTGTATCTTGAAGAAGTCCATGG - Intergenic
959915522 3:111812729-111812751 CTTTCTCTGCAGAAAGTCAAAGG - Intronic
960258489 3:115536779-115536801 CTTTCTTTGCAAGAATTCTATGG + Intergenic
960330443 3:116353470-116353492 CTCTGTCTTCAAGAAGTGCATGG - Intronic
960564222 3:119117098-119117120 CTTTCTCTGCTACAATTTCATGG + Intronic
960789041 3:121406402-121406424 CTTTCTCTGCATGATGTAAAAGG + Intronic
962951208 3:140220725-140220747 CTTTCTCTTCACTAAGTTCATGG - Intronic
966365840 3:179186431-179186453 CTTTTTCTTCAAAAAGCCCAGGG - Intronic
969655062 4:8492019-8492041 CTTTCTCTACAAAAATGCCATGG + Intronic
970274336 4:14381499-14381521 CTTTCTCTGAAAGAAAACCATGG - Intergenic
971843283 4:31882805-31882827 CTTTCTCTTCATGAATTGCAAGG - Intergenic
972098958 4:35387891-35387913 CATTCTCTGTAAGAATTCAAAGG + Intergenic
974711595 4:65604227-65604249 CTTTGTCTGTACAAAGTCCAGGG + Intronic
976993341 4:91397961-91397983 ATTTCTCTGCAAAATGTACAAGG - Intronic
981633069 4:146843807-146843829 CTTTCTCTGTAAGAAGCAAAGGG + Intronic
982949486 4:161672140-161672162 CTTTCTCTCCAAGAAATCAGAGG + Intronic
984024232 4:174523297-174523319 CTTGCTCTCCAGGAACTCCAGGG + Intergenic
985937623 5:3108829-3108851 GTTTCTCTGTAAGGAGGCCATGG - Intergenic
987359799 5:17096476-17096498 TTTTATATGCAAGAAGTACATGG + Intronic
990867346 5:60394931-60394953 ATTTCTCTGCAAGAATTCCTTGG - Intronic
992570379 5:78049239-78049261 CTTTCTCCCCAAGATGCCCAAGG - Intronic
994164247 5:96592226-96592248 CTGTCTCTGCTAGAAATACAGGG + Intronic
994398611 5:99250295-99250317 CTTTCTCTGCTAGATTTCCCAGG + Intergenic
997280839 5:132644251-132644273 CTTTCATTCCAAGAAGCCCATGG + Exonic
998682563 5:144486601-144486623 CTTTCTGTACAAGAAATACAAGG - Intergenic
998732879 5:145101072-145101094 CTTCCTTAGCAAGCAGTCCACGG - Intergenic
1002714473 5:181217846-181217868 GTTCCTCTGCAGGAAGCCCAGGG + Intergenic
1003380173 6:5617803-5617825 CTCTCTCAGCTACAAGTCCAGGG - Intronic
1004135921 6:12966391-12966413 CTTTATCAGCAGGATGTCCAGGG - Intronic
1005700355 6:28394622-28394644 CTTTCTCTGAAAGCACTGCAGGG - Intronic
1006696409 6:35933994-35934016 CCTTCTCTGGAAGAAGTCACAGG - Intergenic
1007520835 6:42451182-42451204 CTGTTTCTGCAACAAGTGCATGG + Exonic
1009936616 6:70241972-70241994 CTTTCATTCCAGGAAGTCCAGGG + Exonic
1010333749 6:74656229-74656251 CTCTATCTGCAACATGTCCAGGG - Intergenic
1012120972 6:95366347-95366369 CTTTCTCTGCTATATGGCCAGGG + Intergenic
1016244810 6:141969055-141969077 CTTTTTCTTCAAGATTTCCATGG - Intergenic
1016694775 6:146980150-146980172 CTTTCACTGCATGAAGACCTGGG - Intergenic
1017456068 6:154602658-154602680 CTTCCTATTCAGGAAGTCCAGGG - Intergenic
1017553178 6:155532887-155532909 TTTTCTCTGCGAGGAGTCCCAGG - Intergenic
1018066606 6:160129003-160129025 CTTTGTCTGCATCAAGTCCATGG - Intronic
1021973412 7:25986858-25986880 CTTTCTCTGGAGGAAGTGCCAGG - Intergenic
1022941471 7:35244723-35244745 ATTTCTATGCAAGAAGGTCAGGG - Intronic
1024053498 7:45645190-45645212 CTATCTCTGCATGAGGACCAAGG - Intronic
1024979663 7:55146694-55146716 CTTTCTCAGCAACATGTCGATGG + Exonic
1026476653 7:70741985-70742007 TTTTGTCTGCAAAAAGTACAAGG - Intronic
1026824678 7:73574006-73574028 CTCTCGCTGCAGGAAGTCCTTGG + Exonic
1027278123 7:76583409-76583431 CTTTCTTGGCAGGCAGTCCAGGG - Intergenic
1033725252 7:144109564-144109586 CTTTCTCTGCCACAAGAGCATGG + Exonic
1034397311 7:150836901-150836923 CTTTGTCTGCACCAAGTCCTGGG - Intronic
1037062295 8:14529464-14529486 CTTTCTTTGCAACAAGCACAGGG + Intronic
1038612126 8:29067580-29067602 CTTTCTCTCCACAAAGTCCGTGG - Exonic
1041128183 8:54666754-54666776 CTTACTCTGCACTAAGTCTAGGG + Intergenic
1044611623 8:94097704-94097726 CTCTCTCAGGTAGAAGTCCAGGG - Intergenic
1045402404 8:101832266-101832288 CTCTCTCTGCCATAAATCCATGG + Intronic
1045638783 8:104223756-104223778 CTTTCCCTGCATGAACTCCCTGG + Intronic
1045646340 8:104303265-104303287 CTTCCTCTGCAAGAATTCCATGG - Intergenic
1045656226 8:104390015-104390037 TTTTCTCTACAAGAAGACTAAGG + Intronic
1046775000 8:118154603-118154625 CTTTCTCTTCCTGAGGTCCAGGG + Intergenic
1048069413 8:131005819-131005841 CTTCCTCTGCAGCTAGTCCATGG + Intronic
1049501413 8:142969356-142969378 CTTTCTCGGCCAGAGGTCCCTGG + Intergenic
1051305890 9:15708736-15708758 CTATATGTGCCAGAAGTCCAGGG + Intronic
1051402792 9:16701100-16701122 CTTTCTCATCAAGTATTCCAGGG + Intronic
1054869998 9:70040408-70040430 CTTTCTCTGCAAAACGTCTGTGG + Intergenic
1054920251 9:70536351-70536373 CTTTGTCTCCAAGACCTCCAGGG + Exonic
1060000541 9:119954291-119954313 CTTTGTCTGCTGGAAGTTCAGGG - Intergenic
1062444083 9:136586084-136586106 CTTGCTCTCCAAGCAGACCAGGG - Intergenic
1186527080 X:10258521-10258543 CTTTCTCTGCAGTAACTCTAAGG - Intergenic
1188328851 X:28843471-28843493 CTATATGTGCAAGATGTCCAGGG + Intronic
1189215857 X:39322712-39322734 CTTTCTCTCCAAGTAGTCTTGGG - Intergenic
1189750125 X:44212370-44212392 CTCTCTCTGCCAGAAGTCTGAGG - Intronic
1189995186 X:46631089-46631111 CCTTTTCTCCATGAAGTCCACGG - Intronic
1195754414 X:108187141-108187163 CTTTATCTCCAGGAAGCCCACGG + Exonic
1197198947 X:123732489-123732511 CCTCCTCTGCCTGAAGTCCAAGG - Intronic
1198740837 X:139840794-139840816 ATTTCTCTGCAAGCAGAGCAGGG + Intronic
1199124018 X:144092350-144092372 TCTTCTCTGCCAGAAATCCACGG + Intergenic
1199500143 X:148499669-148499691 CTTTCTCTGCACGGAGGCCAGGG + Intergenic
1200885036 Y:8259135-8259157 TTTTCTCTGCAAAACTTCCAAGG - Intergenic
1200953465 Y:8922908-8922930 TTTTCTCTGCAAAACTTCCAAGG + Intergenic
1201058281 Y:10017543-10017565 TTTTCTCTGCAAAACTTCCAAGG - Intergenic
1202198967 Y:22326981-22327003 TTTTCTCTGCAAAACTTCCAAGG + Intronic
1202231559 Y:22664262-22664284 TTTTCTCTGCAAAACTTCCAAGG + Intergenic
1202311599 Y:23531903-23531925 TTTTCTCTGCAAAACTTCCAAGG - Intergenic
1202559203 Y:26138691-26138713 TTTTCTCTGCAAAACTTCCAAGG + Intergenic