ID: 1146985853

View in Genome Browser
Species Human (GRCh38)
Location 17:37217088-37217110
Sequence TTTGATTTTTTAGTAAAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456673
Summary {0: 1, 1: 63, 2: 6787, 3: 201883, 4: 247939}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146985853_1146985859 -5 Left 1146985853 17:37217088-37217110 CCCGTCTTTACTAAAAAATCAAA 0: 1
1: 63
2: 6787
3: 201883
4: 247939
Right 1146985859 17:37217106-37217128 TCAAAATTAGTGGGGTGTGGTGG 0: 2
1: 28
2: 669
3: 11185
4: 73825
1146985853_1146985863 26 Left 1146985853 17:37217088-37217110 CCCGTCTTTACTAAAAAATCAAA 0: 1
1: 63
2: 6787
3: 201883
4: 247939
Right 1146985863 17:37217137-37217159 TGTAATCCCAGCTAATCGGGAGG 0: 221
1: 47799
2: 215541
3: 268967
4: 501988
1146985853_1146985858 -8 Left 1146985853 17:37217088-37217110 CCCGTCTTTACTAAAAAATCAAA 0: 1
1: 63
2: 6787
3: 201883
4: 247939
Right 1146985858 17:37217103-37217125 AAATCAAAATTAGTGGGGTGTGG 0: 1
1: 5
2: 64
3: 1365
4: 15374
1146985853_1146985861 23 Left 1146985853 17:37217088-37217110 CCCGTCTTTACTAAAAAATCAAA 0: 1
1: 63
2: 6787
3: 201883
4: 247939
Right 1146985861 17:37217134-37217156 GCCTGTAATCCCAGCTAATCGGG 0: 375
1: 77361
2: 212608
3: 241389
4: 413077
1146985853_1146985860 22 Left 1146985853 17:37217088-37217110 CCCGTCTTTACTAAAAAATCAAA 0: 1
1: 63
2: 6787
3: 201883
4: 247939
Right 1146985860 17:37217133-37217155 CGCCTGTAATCCCAGCTAATCGG 0: 107
1: 21606
2: 152886
3: 311819
4: 402386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146985853 Original CRISPR TTTGATTTTTTAGTAAAGAC GGG (reversed) Intronic
Too many off-targets to display for this crispr