ID: 1146986030

View in Genome Browser
Species Human (GRCh38)
Location 17:37219076-37219098
Sequence CTGTGTGATTAGAAGGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146986030 Original CRISPR CTGTGTGATTAGAAGGTTGA GGG Intronic
901685551 1:10941636-10941658 GTGTGTGATTGGCAGGTTTACGG - Intergenic
902901478 1:19519412-19519434 CTGTGTCTTTACATGGTTGAAGG + Intergenic
905593385 1:39184750-39184772 CTGTGTGATTATGAGGTTGGAGG + Intronic
906247824 1:44289586-44289608 CTGTGTGCTTATAGGGGTGAGGG - Intronic
907033066 1:51191489-51191511 CTGTGGGATTGGAAGATTGTTGG - Intergenic
907085264 1:51666585-51666607 CTCTGTGATGACAAGATTGACGG - Intronic
907298811 1:53472363-53472385 CTGTGTCATTGGATGCTTGAAGG + Intergenic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908896731 1:68909663-68909685 CTGTGTGTTTCCAGGGTTGAGGG - Intergenic
909614886 1:77596477-77596499 CTTTGTGCTTAAAAGGTTTATGG - Intronic
910271072 1:85395304-85395326 CTGTGTGGTCAGAAAGATGAGGG + Intronic
913279227 1:117170043-117170065 CTGAGTGATTAGGAGTTTAATGG + Intronic
913380678 1:118207245-118207267 CTTTGTGATGAGATGGTTGGTGG + Intergenic
913521126 1:119647224-119647246 GTGGGTGAGTAAAAGGTTGAGGG - Intronic
914803601 1:150976911-150976933 CTTTGGAATTAGAAGGCTGAAGG - Intergenic
915048600 1:153042245-153042267 TTGTGGGACTAGAAGGTTTATGG - Intergenic
915508197 1:156370657-156370679 CTCTGTGATTAGCAGGTAGATGG - Intronic
916831981 1:168502695-168502717 CCGTGTGATTACAAGGTTAAGGG - Intergenic
918484227 1:185012273-185012295 GTGTGTGATGAGGAAGTTGAAGG - Intergenic
918585868 1:186187788-186187810 ATGTGTGACTAGAATGTGGAGGG - Intronic
918922041 1:190725148-190725170 CTGTGTCCTCAGAAGGTGGAAGG + Intergenic
919969921 1:202569053-202569075 CTGTGTGATCAGCAGATTCACGG - Intronic
920050582 1:203162354-203162376 CTGGGTGGTCAGAAGGGTGAGGG + Intronic
920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG + Intronic
920884250 1:209911161-209911183 ATGGGTGAATAGAAGGCTGAGGG + Intergenic
1063102278 10:2961191-2961213 CTTTGAGATTTGAAGGATGATGG - Intergenic
1063345906 10:5312302-5312324 CTGTGTGATAACATGGTGGAGGG + Intergenic
1064669239 10:17692291-17692313 ATGTGTAATTAACAGGTTGAGGG + Intronic
1065037319 10:21653020-21653042 CTGTGGGCATAGCAGGTTGAGGG + Intronic
1070123539 10:73601453-73601475 GTGTGTGAGTATCAGGTTGAAGG - Intronic
1070391181 10:75971884-75971906 CTGTGTGGTTAAAGGGTTGCTGG + Intronic
1072495986 10:95960345-95960367 CTGTGTGATTTCAAGGTTCAGGG - Intronic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1078459915 11:11506672-11506694 CTGTGTTATTAGAAAAGTGAAGG + Intronic
1078723726 11:13908775-13908797 CTGTGAGATTAGAAGGCAGAAGG - Intergenic
1078911971 11:15740795-15740817 CTGTGTGATTTGAAGAATGGTGG + Intergenic
1084428027 11:69096176-69096198 CCGTGTGTTTTGAAGGTTCATGG + Intergenic
1087235850 11:95717909-95717931 CTGGGTGAATAGAAGGTAGATGG - Intergenic
1088799368 11:113291218-113291240 ATGTGTGATTTGAAGGCAGAAGG + Intergenic
1090618740 11:128542120-128542142 CTCTGTGAATAGAAGGTGTAGGG - Intronic
1090666050 11:128915747-128915769 ATGAGTGATTGGATGGTTGAAGG + Intronic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1094313638 12:29113984-29114006 ATTTTTCATTAGAAGGTTGATGG + Intergenic
1097562093 12:61220251-61220273 ATGTGTGATTCGAAGGTGTATGG - Intergenic
1097631211 12:62065078-62065100 CTGTGTGATTTTAATCTTGAGGG - Intronic
1099923088 12:88983517-88983539 CTCAGTGACTAGAAGTTTGATGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106372953 13:29154480-29154502 CTGTGTTGTGAGAAGGTTAATGG - Intronic
1107895582 13:44959434-44959456 TTGTGTGATTTGAAGCTAGAAGG - Exonic
1111825560 13:93263127-93263149 GTGTGTGATTAGTATGTTAATGG + Intronic
1111832374 13:93345108-93345130 GTATGTGATTAAAATGTTGAGGG + Intronic
1112189554 13:97163096-97163118 CTGTGTGCTTAAAGGTTTGAGGG + Intergenic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1114682935 14:24502139-24502161 GTGTGTGAGAAGCAGGTTGATGG - Intronic
1115813326 14:37134212-37134234 TTGTGAGACTTGAAGGTTGATGG + Intronic
1118889310 14:69894651-69894673 CTGTGTGGTGAGAAGGGTGATGG + Intronic
1118963631 14:70559209-70559231 CTGTGTGTTAAGCAGGTTTAGGG - Intergenic
1121562991 14:94887960-94887982 CTGGGTGATTAGAAGCCTGCCGG - Intergenic
1121810355 14:96882191-96882213 CAGTGTGTTTAGAAGGTATATGG + Intronic
1124870980 15:33542285-33542307 CTGTGTGAGTAGGATATTGATGG + Intronic
1125197631 15:37066704-37066726 CTGTGTGATTAGGATGTTAGGGG - Intronic
1125457982 15:39880063-39880085 CTGAGTCTTGAGAAGGTTGAAGG - Intronic
1128214710 15:65926298-65926320 CTGTGGCATGAGAAGGTTGGTGG + Intronic
1129682353 15:77664914-77664936 CTGTGTGTTTACAAGTCTGAAGG - Intronic
1138784354 16:59828830-59828852 CTGTGTGCTTAGGATGATGAAGG + Intergenic
1139239567 16:65377258-65377280 TTGAGTGAATAGAAGGGTGATGG + Intergenic
1140853252 16:78954301-78954323 CTGAGTGGATAGAAGGTGGATGG + Intronic
1144466565 17:15502175-15502197 CTGAGTGATTATACCGTTGAAGG - Intronic
1144678552 17:17177321-17177343 CTGTGACATCAGCAGGTTGAAGG + Exonic
1146986030 17:37219076-37219098 CTGTGTGATTAGAAGGTTGAGGG + Intronic
1150075115 17:62185537-62185559 ATGGGTGATTAGGAGTTTGAGGG - Intergenic
1150866069 17:68851502-68851524 CTGTATGTTGACAAGGTTGATGG - Intergenic
1151097655 17:71517700-71517722 CTGTTTGATTGGAAGGTCAATGG - Intergenic
1152388277 17:79988106-79988128 GTGTGTGTTTAGAAGGGAGAGGG + Intronic
1152446206 17:80345839-80345861 CTGTGTGATCATATGGTGGATGG + Exonic
1155335926 18:24765345-24765367 CTGTCAGTTTAGAAGGTTTATGG + Intergenic
1155532606 18:26782350-26782372 CGTTGTGATTCCAAGGTTGAGGG + Intergenic
1156192912 18:34740410-34740432 CTGTGTTCTTACCAGGTTGAGGG + Intronic
1156969268 18:43135089-43135111 GGGTGTGATTAGAAGGAGGAGGG + Intergenic
1158702169 18:59758012-59758034 CTGGGTGAGGAGAAGGTTGGAGG - Intergenic
1158959177 18:62574467-62574489 CTGTGTGGAAGGAAGGTTGATGG - Exonic
1162141031 19:8585738-8585760 CTGGGTGATTGGAAGGGTGGGGG - Intronic
1164749572 19:30642529-30642551 TTGGCTGATTAGAAGGTAGAAGG + Intronic
1164817948 19:31220808-31220830 CTGTGTGCTCAGAAAGATGAAGG + Intergenic
1165783247 19:38446066-38446088 CTCTGGGTTTAGAAGGGTGATGG - Intronic
1167294149 19:48639668-48639690 CTGGGGGAGGAGAAGGTTGAGGG - Intronic
1167891282 19:52541738-52541760 CTGTGAGATGATAAGGTTCAAGG - Intronic
1167920724 19:52781092-52781114 CTGTGAGATGATAAGGTTCAAGG + Intronic
1168580634 19:57553056-57553078 CTGTGTTCTTACAAGGTGGAGGG - Intronic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
927394111 2:22629822-22629844 CTGGGTGCTGAGAAGGTTTATGG - Intergenic
928902548 2:36335954-36335976 CTGTAAGAATAGAAGGATGAGGG + Intergenic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
932576809 2:72966889-72966911 CTGTGTGTTTATAAGGGTGGTGG - Intronic
932641226 2:73449237-73449259 CTGTGTGAGTAGAAACTAGATGG - Exonic
932641285 2:73449804-73449826 CTTTGTGAGTAGAAAGTAGACGG - Exonic
932641358 2:73450515-73450537 GTGTGTGAGTAGAAAGTAGAGGG - Exonic
932641388 2:73450800-73450822 GTGTGTGAGTAGAAAGTAGAGGG - Exonic
933257844 2:80100808-80100830 ATGTATGCTCAGAAGGTTGAAGG - Intronic
934564145 2:95329242-95329264 CTATGGGATAAGAAGGTTGTAGG - Intronic
935161315 2:100531844-100531866 CTGCGTGCTGAGAAGGATGAAGG + Intergenic
936039322 2:109137821-109137843 CTGTTTGATTTGAAGGGTCAAGG + Intronic
937875420 2:126821764-126821786 CTGTCTGAATGGAAGTTTGAGGG + Intergenic
941020607 2:160404848-160404870 TTCTGAGATTAGAAGGGTGATGG + Intronic
945385638 2:209196692-209196714 CTGTGTCATAACATGGTTGAAGG - Intergenic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
947576819 2:231281768-231281790 CTGAGTGATTAGGAAGTTAAAGG + Intronic
948433204 2:237933865-237933887 CTGTGTGATTTGGAGGATGGCGG - Intergenic
1169219732 20:3815076-3815098 CTATGTGAATAGAAAGTGGAAGG + Intergenic
1169417921 20:5433311-5433333 CGGAGTGGTTAGAAGGGTGAAGG - Intergenic
1169685834 20:8270288-8270310 CTGTGTACTTAGCAAGTTGAAGG - Intronic
1170934132 20:20795277-20795299 GTGTGTGAGAAGCAGGTTGAGGG + Intergenic
1172231689 20:33340963-33340985 CAGGGTGATTGGAAGGTGGAGGG - Intergenic
1172820037 20:37724500-37724522 CTGAGTGATTCAAAGGTGGAGGG + Intronic
1173094629 20:40013324-40013346 CTGGGTGATTTAGAGGTTGAAGG - Intergenic
1173148565 20:40546422-40546444 CTCTGTGAGTACAAGGATGAGGG + Intergenic
1173350086 20:42236888-42236910 CTGTGTGAATAGAATGTGGTAGG + Intronic
1174098699 20:48109996-48110018 GTGAGTGAGTAGAAGGGTGAAGG - Intergenic
1174100495 20:48123065-48123087 CTGTGTTAGTTGAAGTTTGAGGG - Intergenic
1174153446 20:48501938-48501960 CTGTGTCAGTTGAAGTTTGAGGG - Intergenic
1179374447 21:40837219-40837241 CTGTGGGATTAGATGCTTGGAGG - Intronic
1180086192 21:45509002-45509024 CTGGGAGATTAGAAGGTCGAAGG + Intronic
1181607311 22:23988502-23988524 GTGTGTGAGTAGGATGTTGAGGG - Intergenic
1181814105 22:25423905-25423927 CTGTTTGATTTGGAGGTTGGGGG + Intergenic
1182092636 22:27606432-27606454 CCATGTTATAAGAAGGTTGATGG + Intergenic
1183038961 22:35161866-35161888 CTGTGGGAGTAGAAGGTGTAGGG - Intergenic
950689055 3:14641287-14641309 TTGTGTGATTAGAAAGTTTGAGG + Intergenic
954092698 3:48297731-48297753 CTGTGGGATTAGAATTGTGAAGG + Intronic
954831143 3:53422270-53422292 CTTCATGATTAGAAGGTTCAGGG + Intergenic
955113875 3:55976980-55977002 CTGTGTGAGAACAAGGTGGAAGG - Intronic
957148445 3:76454467-76454489 CTGTGAGATTAAAAGGTGGTTGG + Intronic
958167061 3:89889679-89889701 GTGGGTGATGTGAAGGTTGAGGG - Intergenic
958642048 3:96816089-96816111 TTGTGTGAGGAGAAGGTTAAGGG + Intronic
959132718 3:102377651-102377673 CTCTGTGTTTAGAATGTTCAAGG - Intronic
960379087 3:116938270-116938292 TTTTGTGATTAGAGGGTGGAGGG - Intronic
967683484 3:192392911-192392933 CTCTGTGATTACAATGTTAATGG + Intronic
970686314 4:18571699-18571721 CTGTGTAATTAAATGGTTGCAGG + Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
975241582 4:72066190-72066212 CTGTGTCCTTACAAGGTGGAAGG + Intronic
975890954 4:79026900-79026922 TTGTGTGACTAGCAGGTTGTTGG + Intergenic
976817185 4:89162593-89162615 CTGGATGATTTGAAGGCTGAAGG + Intergenic
977112938 4:92983289-92983311 CTGTGTCATTACATGGCTGAAGG + Intronic
977182722 4:93897519-93897541 CAGTGTGACTAAAAAGTTGAAGG + Intergenic
978173210 4:105698915-105698937 CTGAGTGATTTGGAGTTTGAGGG + Intronic
979483802 4:121247970-121247992 CTATGTGAGGAGGAGGTTGAAGG + Intergenic
982054024 4:151529566-151529588 CCCTGTGACTAGCAGGTTGATGG + Intronic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
984201826 4:176731606-176731628 GTGTGTGATTGGAAGGTTCCTGG + Intronic
987660523 5:20867502-20867524 CTGTTTCATCACAAGGTTGAAGG + Intergenic
988763124 5:34338181-34338203 CTGTTTCATCACAAGGTTGAAGG - Intergenic
988785564 5:34563263-34563285 CTGTGAAATTAGAGGGCTGAGGG + Intergenic
990468960 5:56095734-56095756 CTGTGAGATTGGAAGGTGGGAGG - Intergenic
991599902 5:68341872-68341894 CTGTGTCCTTTGAAGGATGAGGG + Intergenic
992265600 5:75015336-75015358 CTGTGTGTTTACACTGTTGATGG - Intergenic
992904194 5:81329470-81329492 TTGTGTGAATAGATGGGTGAGGG + Intergenic
994090842 5:95808393-95808415 CTGTGTGATTAAAAAGTTCAGGG - Intronic
994163893 5:96587507-96587529 CTTTGTGATGAGAGGGTTGTTGG + Intronic
996936519 5:128955739-128955761 CTGTGTGATGAGCATATTGAGGG + Intronic
1000926663 5:167202646-167202668 CTGTGTGACTGGGAGGATGATGG - Intergenic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001515277 5:172350980-172351002 ATATGGGATTAGCAGGTTGAGGG + Intronic
1001517056 5:172363288-172363310 ATGGGTGATGAGATGGTTGATGG - Intronic
1001799630 5:174531827-174531849 GGGTGTGTTTAGAAGCTTGAAGG - Intergenic
1002283459 5:178146871-178146893 CTGTGTATTTAGACTGTTGATGG + Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004232691 6:13847303-13847325 CTGTGAGATTAGAAGCAAGATGG - Intergenic
1008136359 6:47781760-47781782 TGGGGTGATTAAAAGGTTGAAGG - Intergenic
1010712582 6:79192516-79192538 ATGTCTGAGCAGAAGGTTGATGG - Intergenic
1012464461 6:99502026-99502048 CCATGTGATTAGAATGTTGGGGG + Intronic
1013915457 6:115332228-115332250 CTATGTGTTTAGAAGCTTCAGGG - Intergenic
1015704132 6:136068729-136068751 CTGTGTAATAAGAATCTTGAAGG - Intronic
1015706292 6:136091397-136091419 TCCTGTGATTAGAAGGTTAAAGG + Intronic
1017555697 6:155564332-155564354 CTGTGTCATTACATGGTGGAGGG - Intergenic
1018165362 6:161089195-161089217 CTTTCTGATTAGATGGTTGTTGG + Intronic
1018406582 6:163490443-163490465 ATGTGTTCTTTGAAGGTTGAAGG + Intronic
1019921723 7:4167534-4167556 CTGTGTGGAGAGAAGCTTGAAGG - Intronic
1021334185 7:19378096-19378118 CTGTCTGACTAGCAGGTTAAAGG + Intergenic
1023575561 7:41622660-41622682 CTGTGTGAATGGAAGCTTGTTGG + Intergenic
1023605998 7:41931498-41931520 CTCTGTGCTGAGAAGGTTGCTGG + Intergenic
1029620450 7:101687098-101687120 CTGTGTGACTAGGGGGTTGGAGG - Intergenic
1029641394 7:101822385-101822407 CTGTCTTCTGAGAAGGTTGATGG + Intronic
1031262724 7:119542728-119542750 CTGTGTGGTTAAAAGAATGAAGG + Intergenic
1031941801 7:127797349-127797371 ATGTTTGATTTCAAGGTTGAGGG + Intronic
1032182842 7:129695757-129695779 CTGTGTGTTTAGAACTTGGAGGG + Intronic
1032634669 7:133693552-133693574 CTGTGTAATTAGGAGTGTGATGG - Intronic
1032825160 7:135561582-135561604 CTCTGTGACTAGAAGTCTGAGGG - Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033981925 7:147175728-147175750 GTGTGGGAGTAGAAGGTTGATGG + Intronic
1039223148 8:35357623-35357645 CTGTTAGATTACAAGTTTGAGGG + Intronic
1040695600 8:49993997-49994019 CTGAGGGACTAGAAGGTTAAAGG - Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1047715862 8:127594586-127594608 CTGTGTTCAGAGAAGGTTGAAGG + Intergenic
1048407415 8:134137694-134137716 CTGTCTGATAAGAAGGTTCTGGG + Intergenic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1050206774 9:3204695-3204717 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1052604239 9:30678737-30678759 CTGTGTGATGACAATGTTAATGG - Intergenic
1052688186 9:31780477-31780499 CTTTGTGATTAGCTCGTTGAGGG - Intergenic
1053368122 9:37538152-37538174 CTTTGAGATTAGAAGGATGGAGG - Intronic
1055779902 9:79809227-79809249 CTGTGTGCTTAGAAGTGTGTTGG + Intergenic
1057374924 9:94512374-94512396 TTCTGTGATTAAAAAGTTGAAGG + Intergenic
1058205664 9:102102552-102102574 CTGTGTGATTATAATGTAAAAGG - Intergenic
1061951615 9:133939478-133939500 CTATGTGATGAGAAGGCTGGGGG - Intronic
1186169054 X:6858033-6858055 CTATGTGATTGGAGGGTTGGGGG + Intergenic
1188396775 X:29694661-29694683 CTGTGTTCTTATAAGGTAGAAGG + Intronic
1189547471 X:42056676-42056698 CTGTGTGATTCTAATGGTGATGG - Intergenic
1189564730 X:42229916-42229938 ATGATTGATAAGAAGGTTGAAGG - Intergenic
1191024096 X:55894835-55894857 CTATGTGGTAAGAAGGTTGTAGG - Intergenic
1193902619 X:87201221-87201243 CTGTGGGTTTAAAAGGCTGAAGG - Intergenic
1195292588 X:103443470-103443492 CTGTGTCATCACAAGGTGGAAGG - Intergenic
1195860705 X:109380175-109380197 CGGTGTGATTTCAAAGTTGATGG - Intronic
1199365881 X:146982174-146982196 CTGTATTATTTGAAGGTAGATGG - Intergenic