ID: 1146987137

View in Genome Browser
Species Human (GRCh38)
Location 17:37230702-37230724
Sequence AAGCCTGTCTCTAGGACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146987137_1146987142 -8 Left 1146987137 17:37230702-37230724 CCCTCTGTCCTAGAGACAGGCTT 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1146987142 17:37230717-37230739 ACAGGCTTCTTTTGGGCAACTGG 0: 1
1: 0
2: 1
3: 9
4: 181
1146987137_1146987143 20 Left 1146987137 17:37230702-37230724 CCCTCTGTCCTAGAGACAGGCTT 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1146987143 17:37230745-37230767 CAAACATCACCATCTAATCCTGG 0: 1
1: 0
2: 0
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146987137 Original CRISPR AAGCCTGTCTCTAGGACAGA GGG (reversed) Intronic
900238652 1:1604445-1604467 AAGCATGTTTCTAGGGCAGGTGG + Intergenic
901452575 1:9345000-9345022 AAGGCAGTCTCTTGGACATAGGG - Intronic
901789258 1:11645828-11645850 AGGGCTGTCTCTAGGACAGTGGG - Intergenic
902032249 1:13431326-13431348 AAACCTGTCTCTCTGACCGAGGG + Intergenic
902723344 1:18319109-18319131 TAGCCTGTCTAAAGGACAGAGGG + Intronic
906682516 1:47739077-47739099 GTGCCTGTCGCTGGGACAGATGG + Intergenic
908695684 1:66838703-66838725 AAGACTGTTTTTAAGACAGAGGG - Intronic
909183049 1:72449673-72449695 GAGCCTGTCCCTGGGACAAAGGG + Intergenic
911273296 1:95829787-95829809 CAGCATGTCTCTGGGACAGATGG - Intergenic
912315618 1:108665250-108665272 AAGCCTGTCTCTCAGGCATATGG - Intergenic
915105790 1:153534443-153534465 AAGGCTGCCTCTAGCACATAAGG - Intergenic
918538718 1:185604057-185604079 AACCCTGTCTCTAGGAGTGGTGG - Intergenic
919582144 1:199389581-199389603 CAGCCTGACCCAAGGACAGATGG - Intergenic
921092180 1:211854852-211854874 TAACTTGTCTCAAGGACAGAGGG + Intergenic
922533663 1:226363914-226363936 AAACCTGGCTCTGGGACTGATGG - Intronic
1063476760 10:6335600-6335622 AAGCCAGTCTCTGGCAAAGATGG + Intergenic
1063676311 10:8143270-8143292 AAGCCTGTCTCAGGTTCAGAGGG + Intergenic
1065625593 10:27625664-27625686 CAGCCTGGCTCCAGGGCAGAGGG - Intergenic
1067033978 10:42899451-42899473 AAGCCTGTCTCTAGCTAAGGGGG - Intergenic
1067549488 10:47223942-47223964 AAGCCTGTGTCTTGGGCAGCCGG + Intergenic
1068901836 10:62278163-62278185 TTGCCTGTCACTGGGACAGAGGG - Intergenic
1069311590 10:67044579-67044601 AATCCTGTCTCTGAGACAGAGGG - Intronic
1071158063 10:82713940-82713962 AGGTCTGTCTCTGGGACAGCAGG - Intronic
1071432637 10:85618324-85618346 GAGCATCTCTCTAGAACAGATGG - Intronic
1073288679 10:102402825-102402847 AAGCCAGGCCCCAGGACAGAGGG + Exonic
1074921751 10:118021415-118021437 CAGCAGGTCTCTAGGAGAGAGGG - Intronic
1074938560 10:118212005-118212027 AATCCTGTGTCAAGCACAGAGGG - Intergenic
1075861212 10:125678678-125678700 AGGCCAGTCTCTAGGACTGCAGG + Intronic
1076063981 10:127434104-127434126 AAGCCTGACTCTGTGACAGTTGG - Intronic
1076409188 10:130233783-130233805 TAGCCTTTCTGCAGGACAGAGGG + Intergenic
1077226906 11:1442615-1442637 CAGCCTCTCTCCAGGGCAGAGGG - Intronic
1080663085 11:34313284-34313306 AAGGCTGGCTCCCGGACAGACGG + Intronic
1081902414 11:46640190-46640212 GAGCCTGTCTGTAGAACAGTAGG + Intronic
1084400724 11:68941409-68941431 TAGCCTGTCTGCAGGAGAGAAGG + Intergenic
1084971233 11:72773253-72773275 AAGCCTGTCTCTGGGTCTCAAGG - Intronic
1085261027 11:75204834-75204856 AAGCCTGGCCCCAGGACAGCTGG - Exonic
1087939550 11:104078493-104078515 AAGCCTGAATCAAGGAAAGAGGG - Intronic
1089949215 11:122509854-122509876 TAGCTTGTCCCAAGGACAGAGGG + Intergenic
1090858648 11:130633613-130633635 ATGCCTTTCTCTAGGAAAGAAGG - Intergenic
1091187923 11:133663197-133663219 AGGCATGTCTCTAGGACCCAGGG - Intergenic
1095403296 12:41839746-41839768 AAGCTAGTCTCCAGGAGAGATGG - Intergenic
1097690290 12:62728595-62728617 AAGCCTCTCACTAGGCAAGAGGG + Intronic
1100588502 12:96001365-96001387 AGGCCAGTCTCTGGTACAGAAGG - Intronic
1101452119 12:104789248-104789270 TAGCCTGTCTCCAGCCCAGAAGG + Intergenic
1106820127 13:33455439-33455461 AAGCCAGGCTGAAGGACAGAAGG + Intergenic
1108430829 13:50352046-50352068 AAGCCTGTTCCTGGGACACAAGG - Intronic
1109793636 13:67281626-67281648 ACGTCTGCCTCTAGGACTGAGGG + Intergenic
1111585223 13:90274615-90274637 AAGCTTTTCTCTAAGATAGAAGG + Intergenic
1112209899 13:97365777-97365799 ACGTCTGTCTTTAGGACATATGG + Intronic
1112240645 13:97678315-97678337 AACCCTGGCTCCAGGACAAAGGG - Intergenic
1116468045 14:45255584-45255606 AATCCAGTCTCTAGGCAAGAAGG + Intergenic
1117305055 14:54465840-54465862 CAGCCAATCTCTAGGGCAGAGGG - Intergenic
1119679393 14:76580681-76580703 ATTCCTGTTTCAAGGACAGAGGG + Intergenic
1120046979 14:79818985-79819007 AAGCACTGCTCTAGGACAGAGGG - Intronic
1121365336 14:93303853-93303875 AGGCCTGACTCTAGGACAATGGG + Intronic
1125179996 15:36871525-36871547 AAGCCTGGCTGGAGGTCAGAGGG - Intergenic
1125227999 15:37417757-37417779 AATCCTGTGACTAGGAAAGAAGG + Intergenic
1128351270 15:66891492-66891514 CACCCTGTCATTAGGACAGATGG + Intergenic
1131108002 15:89747620-89747642 CAGCTTGTCTCAAGAACAGAGGG - Intergenic
1132050831 15:98606462-98606484 CAGTCTCTCTCTTGGACAGAAGG + Intergenic
1132267372 15:100486182-100486204 AAGCCTGCCTGTGGGCCAGATGG + Intronic
1133075515 16:3277611-3277633 AAGCCGATTTCCAGGACAGATGG + Intronic
1134255056 16:12603602-12603624 AAGGCTGGCACCAGGACAGATGG + Intergenic
1134362669 16:13546078-13546100 AAGTCTGGCTCTAGGCAAGAGGG - Intergenic
1135080070 16:19426585-19426607 ACGCCCGTCTCTGGGACAGATGG - Intronic
1136005293 16:27325055-27325077 AACTCTGTCTCTAGGGCAGTGGG - Intronic
1137491122 16:48933607-48933629 AAGCCTGTTACTAAGAAAGAAGG + Intergenic
1138849102 16:60605167-60605189 TACCCTGTCACAAGGACAGAGGG + Intergenic
1139642146 16:68299423-68299445 AAGTCTGTATCCAGCACAGAGGG - Exonic
1139954677 16:70687362-70687384 AACCCGATCTCCAGGACAGAGGG + Intergenic
1140778725 16:78274630-78274652 ACCCCTGTCTCTAAGACATAGGG - Intronic
1141680802 16:85542589-85542611 AAGGCTGTCTTTGGGACACATGG + Intergenic
1141862668 16:86728562-86728584 AAGGCTGTTTCTTGGACAGAAGG + Intergenic
1142157459 16:88539170-88539192 AAGCCAGTCTTGAGGAGAGAAGG - Intergenic
1144577654 17:16439153-16439175 AAGCCTGTCTAGAGGGCGGAGGG + Intergenic
1146987137 17:37230702-37230724 AAGCCTGTCTCTAGGACAGAGGG - Intronic
1147276329 17:39320012-39320034 GTGACTGTCTCAAGGACAGAAGG - Intronic
1147389521 17:40100614-40100636 GAGCCTTTCCCTGGGACAGAGGG + Exonic
1149725246 17:58886533-58886555 AAGTCTGTTTCTAGCAGAGATGG - Intronic
1152325669 17:79634395-79634417 TAGCCTGTCTTGAGGACAGCAGG - Intergenic
1153150255 18:2084493-2084515 AATCCTATCTCTAGGTCAAAGGG - Intergenic
1154995438 18:21636110-21636132 CAGCCTGTCTTTAGGAGAGGAGG + Intergenic
1155244983 18:23899296-23899318 AAGCAGATCTCTGGGACAGATGG + Exonic
1157175856 18:45451265-45451287 AAGCCTGTCCCTAAGAGAGGGGG + Intronic
1157517652 18:48322091-48322113 AAGCCTCTCTCTAGGGAAAATGG - Intronic
1158871592 18:61693501-61693523 ATGCCTGTCACTAGGATACATGG - Intergenic
1159530222 18:69646721-69646743 CACCCTGTCTCTAGAGCAGAGGG - Intronic
1160503525 18:79414360-79414382 AATCCTGTCCCTATGCCAGAAGG + Intronic
1162622887 19:11858503-11858525 AGGCCAGTCTCTAGGAATGACGG + Intronic
1165397771 19:35576513-35576535 AATCCTGTCTCCTGGACAGGAGG + Intergenic
1165866475 19:38942598-38942620 AGTCCAGTCGCTAGGACAGACGG + Exonic
925423703 2:3731749-3731771 TAGCCTGTCTGTGGGACACAGGG - Intronic
929115234 2:38438354-38438376 AAGCCTTTTTCTAAGACACAGGG - Intergenic
930454038 2:51582033-51582055 TATCTTGTCTCAAGGACAGAAGG - Intergenic
931044926 2:58340903-58340925 GAGGCTGTCTCTGGGACAAAGGG + Intergenic
932066297 2:68565448-68565470 AGACCTGTCTCTAAGACAGATGG + Intronic
932777205 2:74535526-74535548 AAGCCTGTGTTTTGGGCAGAGGG - Intronic
933803550 2:85981892-85981914 CACCCTCTCTCTAGGACTGAAGG + Intergenic
937639569 2:124196210-124196232 AAGTCTGTCCCTAGGTGAGAAGG + Intronic
938071110 2:128308894-128308916 TTCCCTGTCTCCAGGACAGATGG + Intronic
941211496 2:162645664-162645686 AAGTCAGTCTCTAGGAAAGTAGG - Intronic
941927843 2:170914137-170914159 AATCCTGTCTCTAGGACCAATGG - Intergenic
942226087 2:173817348-173817370 TTTCCTGTCTCTAGGACAGAAGG - Intergenic
945712886 2:213322574-213322596 AAGCCTGTCACTAAGGTAGAAGG - Intronic
946090510 2:217218516-217218538 AAGGCTGTCACATGGACAGAGGG - Intergenic
946521899 2:220474882-220474904 AAGCCTGTTTCCAGCAGAGATGG - Intergenic
948453554 2:238093409-238093431 CATTCTGTCTCTAGAACAGAGGG - Intronic
948932958 2:241143862-241143884 AGGCCTGTCTCTAGGAGACATGG - Intronic
1169212416 20:3774517-3774539 AACCCTGTCTCTAAAAAAGAAGG + Intergenic
1169263575 20:4154535-4154557 AACCCTGTCTCTACTAAAGATGG - Intronic
1169273579 20:4218445-4218467 CAGCCTGTCTCTGGGACACAGGG - Intergenic
1170368255 20:15620090-15620112 AAGCAGTTCTCCAGGACAGAAGG + Intronic
1171176533 20:23054273-23054295 ATGGATGTCTCTAGGGCAGATGG - Intergenic
1172149222 20:32778925-32778947 GACCCTGTCTCTAAGATAGATGG + Intronic
1179139191 21:38709275-38709297 AAACCTGTCTATGGGACAGTTGG - Intergenic
1181683264 22:24510761-24510783 AAGCTTCTCTCTCGTACAGAAGG - Exonic
950570302 3:13795866-13795888 AGGCCTGTCCCTTTGACAGAAGG + Intergenic
951575828 3:24112817-24112839 AATCCTGGCTCTAGGAAAAATGG + Intergenic
951787142 3:26434685-26434707 TAGACTGTCTTTAGGGCAGAGGG - Intergenic
954781610 3:53066140-53066162 AGGCCTGTCTCTAAGAGAGGAGG + Intronic
955223816 3:57044828-57044850 ATGCCTGTCTTTAGGCCAAAAGG + Intronic
957735611 3:84197709-84197731 AAGCCTGTCTTTGGGCCACAGGG - Intergenic
958678801 3:97298431-97298453 ATGCCTGTTTCTAGGACATGGGG + Intronic
960674965 3:120184820-120184842 AAGACTGGCTCTGAGACAGATGG - Intronic
961703620 3:128766409-128766431 AGGTCTTTCACTAGGACAGAAGG + Intronic
963751201 3:149181654-149181676 ATGCCTGTCTCTAGCACATGTGG - Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
966592417 3:181697065-181697087 AAGCCTTTCCCTATGTCAGATGG + Intergenic
967322615 3:188209600-188209622 AAAACTGTCTCCAGGACACAAGG - Intronic
969030144 4:4205247-4205269 TAGCCTGCCTCAAGGACTGAAGG - Intronic
971486414 4:27165088-27165110 AAGTATATCTCTAGGATAGATGG + Intergenic
971504161 4:27348035-27348057 AAGTCTGTCTCACTGACAGAGGG - Intergenic
972203912 4:36747976-36747998 ACTCCAGTCTCTAGGACTGATGG - Intergenic
973663059 4:53127729-53127751 AGGCCTGTGTCTGGGACAGAGGG + Intronic
980106249 4:128591421-128591443 AAGCCTGTGTCTGAGACAGCTGG + Intergenic
980503044 4:133681983-133682005 AAGCCAGTCTCCAGGCCAGCAGG + Intergenic
980565217 4:134530875-134530897 AAGCCTCCCTTTAGGCCAGATGG - Intergenic
982345487 4:154353177-154353199 AAGTATGTCTCTAGGACACTCGG + Intronic
983772244 4:171565444-171565466 AAACCTGTCTGTGGGAAAGAAGG + Intergenic
985173517 4:187176856-187176878 AAGCCAGTATTTAAGACAGAGGG + Intergenic
986180644 5:5390270-5390292 AAGCCTGTGTCTTGGAGACAGGG + Intergenic
987175080 5:15299662-15299684 AAGCCTAACTATAGGACAAATGG - Intergenic
987642790 5:20633660-20633682 AAGACTGTCCCTGGGACAAAGGG + Intergenic
987707491 5:21474267-21474289 AAGCCTGTGTCTTGGAGACAGGG - Intergenic
992556486 5:77908502-77908524 AAGTCTGTCTCAAAGACAAAAGG + Intergenic
996616896 5:125452704-125452726 AATCATTTCTCTAGGATAGAAGG - Intergenic
1003141686 6:3477063-3477085 AAGCCAGTATCAAGGACAAAAGG - Intergenic
1006572210 6:35015078-35015100 AATCCTTTCTCTAGGGAAGAAGG - Intronic
1006915014 6:37588366-37588388 ACCTCTCTCTCTAGGACAGAAGG - Intergenic
1008660592 6:53663671-53663693 AAGGCTGTATATAGGACACAAGG + Intronic
1009020732 6:57946245-57946267 AAGCCTGTGTCTTGGAGACAGGG + Intergenic
1009034967 6:58106182-58106204 AAGACAGTCTCAATGACAGAGGG + Intergenic
1009210482 6:60856899-60856921 AAGACAGTCTCAATGACAGAGGG + Intergenic
1011333325 6:86234140-86234162 AAACCTGTGTCTAGGCCACAAGG - Intergenic
1013946490 6:115728578-115728600 TAGCTTGTCGCAAGGACAGAGGG - Intergenic
1014236277 6:118958981-118959003 AAGCCAGATTCTAGGAAAGAAGG - Intergenic
1016369994 6:143363824-143363846 AGGCCTGTCTCTATTTCAGAAGG - Intergenic
1020368930 7:7411987-7412009 TAGCCTGTTTCTAGGAAGGATGG - Intronic
1022719656 7:32931368-32931390 AAGTCTGTATCTGGGACAGGCGG + Intergenic
1022790707 7:33686272-33686294 AAGCTTGTCTTTCTGACAGACGG - Intergenic
1023277817 7:38539396-38539418 GACCCTGTTTCTAGGCCAGAGGG + Intronic
1023688923 7:42765600-42765622 AATGCTGTCTCTGGGGCAGACGG - Intergenic
1024265139 7:47600610-47600632 TACCTTGTCTCAAGGACAGAGGG - Intergenic
1025608591 7:63057307-63057329 AAGCCTGTCTGTTGCACAGTGGG + Intergenic
1027329681 7:77078538-77078560 TAGCTTGTCTAAAGGACAGAGGG - Intergenic
1029038672 7:97549884-97549906 TATCTTGTCTCAAGGACAGAGGG - Intergenic
1029232177 7:99079281-99079303 AAGCCTGGCTCTGGGACACAGGG + Intronic
1029786081 7:102792800-102792822 TAGCTTGTCTAAAGGACAGAGGG + Intronic
1031939459 7:127772385-127772407 AAGCATCTCTCTAGGACTGAAGG - Intronic
1032938909 7:136766155-136766177 AAGCAAGTCTATAGGACTGAAGG + Intergenic
1033497766 7:141916791-141916813 AAGCCTGTCTCCAGAGCAGAGGG + Intronic
1034136483 7:148775568-148775590 AAGAGTGTCTTTAGGACAAAAGG + Intronic
1034442803 7:151095512-151095534 AAGCCTGTCACAGGGGCAGAGGG + Intronic
1034457604 7:151179711-151179733 CAGCCTGTCTCTGGGACCAAAGG - Intronic
1036112290 8:5916731-5916753 AAGCCTTTAACTAGAACAGAAGG + Intergenic
1036212092 8:6850575-6850597 AAGCCAGATTCTAGGACAGCTGG + Intergenic
1037202136 8:16268148-16268170 AAGCCTGTCTCCAGGTGAGTTGG - Intronic
1037513917 8:19610817-19610839 CACCTTGTCTCAAGGACAGAGGG - Intronic
1038225643 8:25654704-25654726 AAAGCTGTCTCTATGTCAGATGG - Intergenic
1040552600 8:48450222-48450244 GAGAATGTCTCTAGGACACAGGG - Intergenic
1042380639 8:68109474-68109496 AGGTCTGTCTCTGGGACAGCAGG + Exonic
1044296403 8:90532319-90532341 AAGGCTGGCTCTTAGACAGATGG + Intergenic
1046277427 8:111982107-111982129 TACCTTGTCGCTAGGACAGAAGG + Intergenic
1047432075 8:124801332-124801354 AAACCTATCTCTAAGATAGATGG + Intergenic
1051311784 9:15782425-15782447 GAGCCAGTCTCTGGGACGGATGG + Intronic
1051886928 9:21903476-21903498 CAGAGTGTCTCTAGGACAGATGG - Intronic
1053469578 9:38336554-38336576 TGGCCTGTCTCTGTGACAGAAGG - Intergenic
1057963278 9:99477905-99477927 AATCCTTTCTCTATGACAGATGG - Intergenic
1058151262 9:101465946-101465968 AAGCTTGTATCTAAGCCAGAAGG + Intergenic
1058346111 9:103964968-103964990 AAGCCTTTCTCTAAGCCAGAGGG + Intergenic
1059163263 9:112055249-112055271 AATCCTGTCTCTATGAAAAATGG + Intronic
1059831209 9:118098261-118098283 AAGCCAGACACTAGGACAGCTGG + Intergenic
1060092707 9:120758253-120758275 AAGCCTGGCCCTAGGACTGGTGG + Exonic
1060256343 9:122034502-122034524 ATGCCTGTCTCCAGGAGGGACGG + Intronic
1061328812 9:129879735-129879757 CAGCCTGACTCTAAGACAGGTGG - Intronic
1062089507 9:134667773-134667795 GTGCCTGACTCTAGGACAGGGGG + Intronic
1187063826 X:15813534-15813556 AGGACTGTCTTTAGGCCAGATGG + Intronic
1188743287 X:33811360-33811382 AAGGCTGCCTCCAGGACAAAGGG - Intergenic
1189418056 X:40832105-40832127 AATCCTGTCTCCAGGACACCTGG + Intergenic
1193183610 X:78486766-78486788 TAGCTTGTCACAAGGACAGAGGG + Intergenic
1196072322 X:111539472-111539494 TACCTTGTCTCAAGGACAGAGGG - Intergenic