ID: 1146988324

View in Genome Browser
Species Human (GRCh38)
Location 17:37243494-37243516
Sequence CAATTCTAGGAGAGGCAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 352}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146988317_1146988324 23 Left 1146988317 17:37243448-37243470 CCACATTGGGGGGAATGCGGCCA 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1146988324 17:37243494-37243516 CAATTCTAGGAGAGGCAGGGAGG 0: 1
1: 0
2: 0
3: 36
4: 352
1146988319_1146988324 3 Left 1146988319 17:37243468-37243490 CCAGACACACTGGTCATAATATC 0: 1
1: 0
2: 1
3: 9
4: 126
Right 1146988324 17:37243494-37243516 CAATTCTAGGAGAGGCAGGGAGG 0: 1
1: 0
2: 0
3: 36
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146988324 Original CRISPR CAATTCTAGGAGAGGCAGGG AGG Exonic
901761563 1:11475103-11475125 GAATTCTGGGGGAGGCAGGAGGG + Intergenic
901788644 1:11641586-11641608 GATTCCTAGGAGAGGAAGGGAGG + Intergenic
903153802 1:21430720-21430742 AAATGCAAGGAGAGCCAGGGTGG - Intergenic
903222984 1:21879117-21879139 CAATTCTAGAAGAAGGAGGAGGG + Exonic
903464860 1:23545092-23545114 CAATTCTAGGACTGGGAGGGTGG + Intergenic
903623731 1:24716309-24716331 CAATGCAAGGAGAAGCAGAGAGG + Intergenic
904753623 1:32755844-32755866 AGATTCTAGGAGAGACAGGTAGG - Intronic
905173883 1:36124809-36124831 CGCTTCTGGGAGAGGAAGGGAGG + Intronic
905901562 1:41584821-41584843 CTATTCAGGGAGAGTCAGGGCGG + Exonic
907581249 1:55574647-55574669 CAATGCTTGGAGAGGAGGGGAGG - Intergenic
908395360 1:63720325-63720347 CAACTCTAGGCTTGGCAGGGAGG + Intergenic
908513847 1:64872332-64872354 CAATTCTAAGAGAGGGGTGGGGG - Intronic
910445615 1:87296700-87296722 CAATGCTAGGAGGGGCTGAGGGG + Intergenic
910456776 1:87406144-87406166 CAATTTTAGGCCAGGCACGGTGG + Intergenic
912324402 1:108744338-108744360 CAAATCTAGGGGAGCCTGGGAGG + Intergenic
913058685 1:115185040-115185062 CCATACTGGGAGAAGCAGGGCGG - Intergenic
913090287 1:115472143-115472165 CAATGGGAGCAGAGGCAGGGAGG - Intergenic
913665547 1:121045041-121045063 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914160840 1:145132687-145132709 CATTTTTAGTAGAGGCAGGGTGG - Intergenic
914655554 1:149736853-149736875 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
915135306 1:153727721-153727743 AAATTCTAGGAGGAACAGGGCGG + Intergenic
915167554 1:153956925-153956947 TGATTCTAGCAGAGGCATGGTGG - Intronic
915199979 1:154220410-154220432 CAATTCTGCGCGAGGTAGGGAGG - Exonic
915478258 1:156167163-156167185 CAATCCCAGGTGAGGCATGGTGG - Intronic
915725400 1:158013773-158013795 GAATGGTAGGGGAGGCAGGGAGG - Intronic
916321146 1:163505549-163505571 AGATGCTAGGAGAGGAAGGGAGG - Intergenic
916813135 1:168323792-168323814 CATCTGTAGGAGAGGCTGGGAGG - Intergenic
916859451 1:168787117-168787139 GCATTCTAGGAAAAGCAGGGCGG + Intergenic
916947544 1:169743848-169743870 CACTTGTAGGAGAGGCAGTGTGG - Intronic
917418226 1:174834137-174834159 AAATTCTAGGCCAGGCACGGTGG + Intronic
918883714 1:190162429-190162451 GAATTATAGGCGAGGCAGAGTGG - Intronic
919677404 1:200397411-200397433 CAATTCTTGGCCAGGCACGGTGG + Intergenic
920671310 1:208005625-208005647 AAATTCTAGGTCAGGCACGGTGG - Intergenic
921039405 1:211416083-211416105 CATGGCTATGAGAGGCAGGGAGG + Intergenic
921719887 1:218459858-218459880 CACTTTTAGGAGAGGAAGGCAGG - Intergenic
921853369 1:219954058-219954080 GAATTTTAGGAGAGGCAAAGGGG - Intronic
923072161 1:230575669-230575691 GAATTCTAAGAGAGGCAAGGCGG + Intergenic
923302138 1:232651151-232651173 GAATTCGAGGAGGAGCAGGGTGG - Intergenic
923999170 1:239531944-239531966 CCATTCTAGGCCAGGCACGGCGG - Intronic
924419624 1:243896089-243896111 CAGTTAGAGGTGAGGCAGGGAGG - Intergenic
1064973185 10:21087027-21087049 AAATTCTTGGTGAGGGAGGGTGG - Intronic
1067837623 10:49651297-49651319 TACTTCAAGGAGAGGCAGGCAGG + Intronic
1069449875 10:68508424-68508446 GAATTCTAGGCCAGGCGGGGTGG + Intronic
1070701044 10:78601975-78601997 CAGTGCCAGGAGAGGCAGGCAGG - Intergenic
1071508139 10:86245237-86245259 CAACTCTGGGAGAAGCAGGCGGG - Intronic
1072081188 10:92033711-92033733 GTAGTCTAGGAGAGGCAAGGTGG - Intergenic
1072231426 10:93417150-93417172 TAATTATTGGAGAGGCAGGATGG - Intronic
1072742381 10:97917307-97917329 CAATGCTTGGAGAGGCAGTGTGG + Intronic
1072833164 10:98681049-98681071 CAATTCAGGGACAGGCATGGTGG - Intronic
1074383528 10:112999318-112999340 GATTTGTGGGAGAGGCAGGGAGG + Intronic
1077190393 11:1253651-1253673 CAAAGCTGGGAGAGGCAGGAAGG - Intronic
1077539396 11:3139476-3139498 CCATTCTGGGAAAGGCAGGGAGG + Intronic
1078243894 11:9555244-9555266 CATTTCTAGGCCAGGCATGGTGG - Intergenic
1078256506 11:9663656-9663678 CAAGTCGGGGAGATGCAGGGCGG - Intergenic
1078466392 11:11553487-11553509 GAACTCTGGGAGAGGCAGGCAGG - Intronic
1080674703 11:34414578-34414600 CAATTGTAGGCCAGGCATGGTGG - Intergenic
1081348365 11:42018109-42018131 AAATTCTAGGTCAGGCACGGTGG - Intergenic
1081534131 11:43985074-43985096 CAAATCCACGAGAGGCAGGGTGG + Intergenic
1082270557 11:50165388-50165410 CAATTTTAGGCCAGGCATGGTGG - Intergenic
1083583533 11:63839900-63839922 CTATTCGAGGAGCGGGAGGGTGG - Intronic
1083966532 11:66047131-66047153 CAATCCTTGAAGAGACAGGGAGG - Intronic
1085059976 11:73436753-73436775 CATTTTGAGGAGAGGCAGGGAGG - Intronic
1086199172 11:84179803-84179825 CAATTTTAGGTGAGACAGGATGG - Intronic
1086316806 11:85603626-85603648 CAATTCTTGGCCAGGCACGGTGG + Intronic
1086460257 11:86998899-86998921 CTATTCTAGGCGGGGCATGGTGG - Intergenic
1087764334 11:102133582-102133604 CAATTCTAGGCCAGGCGTGGTGG - Intronic
1087820881 11:102710671-102710693 AAATTCTAGCTTAGGCAGGGTGG + Intergenic
1088125374 11:106417612-106417634 GAATTGTAGAAGAGGCAGAGGGG + Intergenic
1089282262 11:117382625-117382647 TAATTCAGGGAGAGGAAGGGCGG + Intronic
1089327695 11:117668637-117668659 CATTGGTAGGAGAGTCAGGGAGG - Intronic
1091455094 12:600832-600854 CAATTCTGGGCCAGGCATGGTGG - Intronic
1092812304 12:12283339-12283361 AAATGCGAGGACAGGCAGGGTGG - Intergenic
1093334541 12:17886539-17886561 GAATTGGAGGAGAGGCATGGTGG - Intergenic
1096237754 12:49941393-49941415 CAATTCTAGGAGTGGAATTGTGG + Intergenic
1096399980 12:51297956-51297978 CATTTCTAGGCCAGGCACGGTGG + Intronic
1096681021 12:53255396-53255418 CAATCAGAGGTGAGGCAGGGAGG - Intergenic
1097041854 12:56160679-56160701 CAACTAGAGGAGAGGCTGGGAGG - Intronic
1100828774 12:98498970-98498992 AAATTCTAGGTCAGGCACGGTGG + Intronic
1101135063 12:101734833-101734855 CTATTCTAGGATCGGCACGGTGG - Intronic
1101454833 12:104820176-104820198 CAAATCTAGGCCAGGCATGGTGG + Intronic
1102039990 12:109794483-109794505 CGGTTCTAAGAGAGGCAGGGTGG + Exonic
1102327090 12:111995454-111995476 CAGTTCTAGGACGGGCATGGTGG + Intronic
1103287870 12:119817785-119817807 CAATTCTAGGCTGGGCATGGTGG + Intronic
1103719432 12:122965571-122965593 CAGCTCTAGGAGAGGCAGAGAGG + Intronic
1104517755 12:129443523-129443545 CAAGTCCAGGAGTGGGAGGGAGG - Intronic
1104561453 12:129848971-129848993 CAATTATACGAGAGGCAGGAAGG - Intronic
1110828946 13:80007830-80007852 CAATTCAGGGACAGGCAGGGTGG + Intergenic
1112027450 13:95424235-95424257 AAATTCTAGGCCAGGCATGGTGG - Intergenic
1112495937 13:99904957-99904979 CTGTTCTGGGGGAGGCAGGGTGG - Intergenic
1113734615 13:112669485-112669507 AAATTCTAGGCCAGGCATGGTGG + Intronic
1114813896 14:25932958-25932980 CAATTCTAGAACATGCAGTGTGG + Intergenic
1115015632 14:28609434-28609456 CAATGCTAGGAGAGTCATAGAGG - Intergenic
1116936093 14:50742124-50742146 CTATTCTAGGCTAGGCATGGTGG + Intronic
1116947769 14:50852137-50852159 TAATTCTAGGCCAGGCATGGTGG - Intergenic
1116993326 14:51297992-51298014 CAATCTTAGGGGAGGCAGAGTGG + Intergenic
1117176127 14:53148598-53148620 CAATTCTAGGCCAGGCGTGGTGG - Intronic
1118004233 14:61551376-61551398 CCCTCCTAGGAGAGGCAGGCAGG - Intronic
1119480014 14:74953263-74953285 CACGTCTTGGAGAGGCAGGGAGG + Intronic
1119572456 14:75687559-75687581 CAAATTTAGGTGAGGCATGGTGG - Intronic
1119651743 14:76388775-76388797 AGACTCTAGGAGAGGCATGGAGG - Intronic
1121700748 14:95952269-95952291 CCATTCTTGGAGAAGGAGGGAGG - Intergenic
1121923521 14:97905849-97905871 CAAATGGAGGAGAGACAGGGAGG - Intergenic
1122226498 14:100283766-100283788 CAATTCCAGGCCAGGCACGGTGG - Intergenic
1122647049 14:103201848-103201870 CAATTCTTGGAGAGGAAGGTGGG + Intergenic
1124588567 15:31033717-31033739 CAGTTATAGGAGAGAGAGGGTGG - Intronic
1124627569 15:31317488-31317510 CAATTCAGGGAGAGCCAGGCTGG - Intergenic
1124804413 15:32867160-32867182 CAAATCAGAGAGAGGCAGGGTGG - Intronic
1125879420 15:43180408-43180430 AAATACTAGGCCAGGCAGGGTGG - Intronic
1126607108 15:50489001-50489023 ACATTCTAGGCCAGGCAGGGTGG - Intronic
1126935464 15:53702583-53702605 TAATTCTAGGCCAGGCATGGTGG + Intronic
1127067512 15:55256091-55256113 CAAGTCAAGTAGAGGCTGGGAGG + Intronic
1127392824 15:58520912-58520934 GAATTCTAGAAAAGGAAGGGAGG + Intronic
1127938248 15:63665244-63665266 CAATTCTAGGCCAGGAACGGTGG + Intronic
1129282032 15:74493144-74493166 AACTTCTAGGCTAGGCAGGGTGG + Intergenic
1129818118 15:78574098-78574120 CAATTCTAGGCCGGGCACGGTGG - Intronic
1130236040 15:82134384-82134406 GAATTCTGGGTGAGGCAGTGAGG - Intronic
1132668935 16:1094890-1094912 CAGTGCTAGGAGCAGCAGGGCGG + Exonic
1133179672 16:4044057-4044079 AAATTCTAGGCCAGGCACGGTGG + Intronic
1133243640 16:4431866-4431888 CAACTCTAGGCCAGGCAAGGTGG - Intronic
1133967505 16:10542120-10542142 AAATTTTAGGAGAGGCATGGTGG + Intronic
1133995936 16:10748236-10748258 CAATTTTAGGCCAGGCACGGTGG - Intronic
1134796027 16:17037955-17037977 CAATTCAAAGAGGGGCATGGAGG - Intergenic
1135329272 16:21547554-21547576 CAATCCTAGGCCAGGCACGGTGG + Intergenic
1135579175 16:23610748-23610770 AAATTCTAGGCCAGGCATGGTGG + Intronic
1135620297 16:23950000-23950022 CAATGCAAGGAGAGGGAAGGAGG - Intronic
1136136995 16:28262237-28262259 CAAGGCTGGGAGAGGCGGGGCGG - Intergenic
1136339612 16:29633496-29633518 CAATCCTAGGCCAGGCACGGTGG + Intergenic
1136541745 16:30931158-30931180 CATTTCTAATAGAGGCTGGGGGG - Intronic
1136657187 16:31716549-31716571 CAATTTTTGTAGAGACAGGGAGG + Intronic
1136929438 16:34406159-34406181 GAATTCTAGGAGATTGAGGGGGG - Intergenic
1136975136 16:35005645-35005667 GAATTCTAGGAGATTGAGGGGGG + Intergenic
1137292389 16:47060811-47060833 CAATTCTTCCAGGGGCAGGGTGG + Intergenic
1141206503 16:81937046-81937068 GAATTCTCAGAAAGGCAGGGTGG + Intronic
1141551591 16:84810010-84810032 CAAAGCTGGCAGAGGCAGGGAGG + Intergenic
1142870547 17:2817279-2817301 AAATTCTAGGCCAGGCATGGTGG - Intronic
1144554515 17:16269997-16270019 AAATTCTAGGCCAGGCATGGTGG + Intronic
1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG + Intergenic
1145882748 17:28364201-28364223 CAATCCCAGGAGGGGCAGGGTGG + Intergenic
1146352261 17:32104555-32104577 CAGTTCAGGGGGAGGCAGGGTGG + Intergenic
1146792797 17:35762275-35762297 CATTTCTAGGCGGGGCACGGTGG - Intronic
1146926958 17:36751827-36751849 CCATTCTGGGAGAGGCGGGGTGG + Intergenic
1146988324 17:37243494-37243516 CAATTCTAGGAGAGGCAGGGAGG + Exonic
1147530644 17:41273842-41273864 AAATTCTAGGAAAAGGAGGGAGG + Intergenic
1148035486 17:44656585-44656607 CTAGTCCAGGAGAGGCTGGGGGG + Exonic
1148290259 17:46440740-46440762 AAATTCTGGGCCAGGCAGGGTGG - Intergenic
1148312427 17:46658313-46658335 AAATTCTGGGCCAGGCAGGGTGG - Intronic
1148958753 17:51375423-51375445 CAATTTTAGGTCAGGCATGGTGG + Intergenic
1149925877 17:60701670-60701692 CAAATCTAGGCCAGGCACGGTGG + Intronic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1152843984 17:82588109-82588131 AAATTTGGGGAGAGGCAGGGTGG - Intronic
1154494193 18:14944012-14944034 CAAGACAAGGAGAGGGAGGGAGG + Intergenic
1154989113 18:21583354-21583376 AAATTCTAGGCCAGGCAGGGTGG + Intronic
1155247529 18:23924437-23924459 AAATTCTAGGCCAGGCATGGTGG - Intronic
1156020003 18:32588922-32588944 CAAGGCTAGGAAAGGCGGGGTGG + Intergenic
1157209630 18:45730795-45730817 AGATTCTAGGAGGGGCAGTGTGG + Intronic
1157212962 18:45759668-45759690 CAAGTCTAGGTGAGCCAGGGAGG - Intergenic
1157902670 18:51534865-51534887 CAATTCCAGGCCAGGCACGGTGG - Intergenic
1158322483 18:56278885-56278907 CATCTCCAGGAGAGGTAGGGAGG - Intergenic
1158354765 18:56606086-56606108 CAATTCTAGGCCAGGCATGGTGG + Intronic
1158416955 18:57257032-57257054 CCAGTCCAGGAGAGGCAGAGAGG + Intergenic
1160403067 18:78625091-78625113 CAATACTCAGAGAAGCAGGGAGG + Intergenic
1160981083 19:1816934-1816956 GACTTCTAGGAGAGGCCGAGTGG + Intronic
1162314020 19:9926263-9926285 AAATTCTAGGCCAGGCATGGTGG + Intronic
1163817475 19:19475575-19475597 AACTTCCAGGAGAGGCTGGGTGG + Intronic
1164089838 19:21940013-21940035 AACTTCTAGGAGAGGCTCGGTGG + Intronic
1164103219 19:22077950-22077972 CCATTCTAGGCCAGGCACGGTGG + Intronic
1164134560 19:22401887-22401909 CAATTCTCGGTCAGGCACGGTGG + Intronic
1164194159 19:22939924-22939946 AACTTCTAGGAGAGGCCCGGCGG + Intergenic
1164837209 19:31364337-31364359 CTATTCTAGGCCAGGCACGGTGG - Intergenic
1165674220 19:37707480-37707502 CAATTCTGGGCCAGGCACGGTGG + Intronic
1165827938 19:38716190-38716212 CAATTCTAGGCCAGGCACGCTGG - Intronic
1167806574 19:51790496-51790518 CAATTATAGGCCAGGCACGGTGG - Intronic
1168237976 19:55075729-55075751 CAGATCTAGGAGGGGCTGGGGGG - Intronic
1168244565 19:55105278-55105300 CAATTCAGGGAGGGGAAGGGAGG + Intronic
925212961 2:2066577-2066599 CAATTCCAGGAGAGGCTATGGGG + Intronic
925658111 2:6171677-6171699 CAATTCTAGGAAATGGGGGGTGG + Intergenic
925974545 2:9132559-9132581 CAATTGTAGGCCAGGCATGGTGG - Intergenic
926120091 2:10237121-10237143 CTTTTCTAAGAGTGGCAGGGAGG + Intergenic
926150123 2:10421043-10421065 CAATTCTTGGCCAGGCACGGTGG - Intronic
927000220 2:18787066-18787088 CACTTCTAGGCCAGGCATGGTGG - Intergenic
927271734 2:21217638-21217660 GAAATCTAGGAGAGACAGGGAGG - Intergenic
927803457 2:26122884-26122906 CTATTCTCGGGGTGGCAGGGAGG + Intronic
928397446 2:30953921-30953943 CTACTCTATGACAGGCAGGGTGG + Intronic
928605222 2:32939506-32939528 CAATTCTAGGCCAGGCGCGGTGG + Intergenic
928624423 2:33125168-33125190 CAAGTGTAGGAGAGGCATTGGGG + Intronic
929187590 2:39111578-39111600 GTATTCTAGGAGTGGCAGGAAGG - Intronic
929278451 2:40050930-40050952 CCACTCTAGTAGAGGGAGGGAGG + Intergenic
929503991 2:42513924-42513946 CAAGTCTAGGCCAGGCACGGTGG + Intronic
929554749 2:42919072-42919094 TAGTTCTTGGGGAGGCAGGGAGG + Intergenic
929580943 2:43081470-43081492 ACATTCTAGGTGAGGCAGGGGGG - Intergenic
929691748 2:44080640-44080662 CAATACTAGGCCAGGCAAGGTGG + Intergenic
929900943 2:46003043-46003065 AAATTCAAGAAGGGGCAGGGTGG + Intronic
930066617 2:47332618-47332640 CATTTTGGGGAGAGGCAGGGTGG - Intergenic
932132021 2:69196504-69196526 GAATTCCAGGCGAGGCAGGGGGG + Intronic
932143540 2:69299735-69299757 CAATTCTTGGCCAGGCAAGGTGG - Intergenic
932783897 2:74582731-74582753 AAATTCTAGGTGGGGCATGGTGG + Intronic
933608223 2:84406744-84406766 CAATTATGGCAGAGGCAGTGTGG - Intergenic
934885077 2:98017243-98017265 CAATTCTATGAGAGGGAGGTGGG + Intergenic
934922939 2:98360185-98360207 CATTTGTAAGAGAGGGAGGGGGG + Intronic
934930351 2:98417225-98417247 CACCTCTAGGTGAGGCAGTGAGG + Intergenic
935057392 2:99579430-99579452 AAATTCTAGGCCAGGCATGGTGG + Intronic
937076993 2:119114261-119114283 CAAGTCCAGGAGAGGGATGGTGG + Intergenic
937173667 2:119903667-119903689 CAATAGTGGTAGAGGCAGGGTGG - Intronic
937625504 2:124038927-124038949 CAATACAAGCAGAGGCAGGTGGG - Intronic
938063019 2:128266955-128266977 AAATGCAAGGAGAGCCAGGGTGG + Exonic
938108314 2:128548077-128548099 CAATTCTAGAAAAGGGAGAGTGG - Intergenic
940328683 2:152452331-152452353 AAATGCTAGCAGAGGCAGGAAGG - Intronic
942377233 2:175350107-175350129 CAATTCAAGGAGAGGCACAAAGG - Intergenic
943988117 2:194649288-194649310 CAGTACTAGGAGAGACAGGCAGG - Intergenic
944648667 2:201806600-201806622 CAAGGATAGGAGAGGCAGTGGGG + Exonic
944889469 2:204102377-204102399 CTATTTTAGGGGAGGAAGGGTGG + Intergenic
945896211 2:215484864-215484886 GAATTCTATCAAAGGCAGGGGGG - Intergenic
947298166 2:228656277-228656299 CAATTCAAGGAGAGAAAGGAAGG + Intergenic
947648025 2:231759028-231759050 CATTTCTAGGCCAGGCATGGTGG + Intronic
948575690 2:238948006-238948028 CAAAGCTGGGAGAGGCAGGAAGG + Intergenic
948979930 2:241488685-241488707 AAATTCTAGGCCAGGCACGGTGG - Intronic
1169435752 20:5588215-5588237 CAAATATAGGACAGGCATGGTGG + Intronic
1170935247 20:20804307-20804329 AATTTCTAGGACAGGCATGGTGG - Intergenic
1171196634 20:23205072-23205094 GATTCCTAGGAGGGGCAGGGAGG - Intergenic
1172340255 20:34152032-34152054 AAATTCTAGGCCAGGCATGGTGG - Intergenic
1173223187 20:41145994-41146016 CCATCCTGGGGGAGGCAGGGAGG + Intronic
1173608266 20:44347508-44347530 GAATTCTAGGGCAGGCACGGTGG - Intronic
1173779253 20:45740771-45740793 AAATTCTAGGTCAGGCACGGTGG + Intergenic
1176030759 20:63010049-63010071 CGTCTCTGGGAGAGGCAGGGTGG - Intergenic
1176152448 20:63598943-63598965 CAGGCCTAGGAGGGGCAGGGAGG - Intronic
1178487589 21:33028490-33028512 CAAATCAACGAGAGACAGGGAGG - Exonic
1178576879 21:33801157-33801179 AAATTCTAGGCCAGGCATGGTGG - Intronic
1178628801 21:34241438-34241460 CAATTGTAGGCCAGGCATGGTGG + Intergenic
1179115074 21:38483559-38483581 CAATTCTCGGCCAGGCATGGTGG + Intronic
1179546551 21:42116045-42116067 GAATTCTAGGTTAGGCACGGTGG + Intronic
1181318567 22:21987208-21987230 ACATTTTAGGCGAGGCAGGGAGG - Intergenic
1181894044 22:26091125-26091147 CAACTCTGGGAGAAGCTGGGAGG - Intergenic
1182045826 22:27273438-27273460 AACATCAAGGAGAGGCAGGGTGG - Intergenic
1183789824 22:40057571-40057593 AAATTCTGGGCCAGGCAGGGTGG - Intronic
1184520061 22:44988171-44988193 CACTTCAAGGCGAGGCATGGTGG + Intronic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
949862625 3:8520476-8520498 CTAATTTAGGAAAGGCAGGGTGG + Intronic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
951145012 3:19216271-19216293 CAGTGCTAGCAGAGGCAGGCTGG + Intronic
951553758 3:23900345-23900367 AAATTCTAGGCCAGGCAGAGCGG + Intronic
952218063 3:31297274-31297296 CATTTCTTGGAGAGGCCTGGTGG - Intergenic
952429888 3:33213118-33213140 AAATTCAAGGCTAGGCAGGGTGG + Intronic
952871512 3:37905017-37905039 CAAGACTCGGAGAGGCAGCGGGG - Intronic
952949676 3:38511666-38511688 CAATAGTAGGAAAGGCAGGGTGG + Intronic
953821572 3:46211517-46211539 CAAATCTAGGTCAGGCATGGTGG - Intronic
954312466 3:49780820-49780842 CACTTCAAGGCAAGGCAGGGTGG + Intronic
954945974 3:54424716-54424738 CAAGGATAGGAGAGGCAGTGCGG - Intronic
956164175 3:66383986-66384008 CAAACCTAGGACAGTCAGGGTGG + Exonic
958488251 3:94739879-94739901 CAATTCTTGGCCAGGCATGGTGG + Intergenic
961176092 3:124836067-124836089 CACATCTGGGAGATGCAGGGAGG - Intronic
961365757 3:126398259-126398281 CAGTTCCAGGAGAGGCACTGGGG + Intronic
961395164 3:126581648-126581670 GAATTCTAGGAGAGACAGTATGG + Intronic
962363129 3:134758059-134758081 CAGTTCTATCAGAAGCAGGGTGG - Intronic
963629609 3:147716613-147716635 CAAATCTAGGGTGGGCAGGGAGG + Intergenic
969145957 4:5124346-5124368 CACCTCTAAGAGAGTCAGGGAGG - Intronic
969208883 4:5671261-5671283 CCAGCCTAGGAGAGGCAGCGGGG - Intronic
969567927 4:7991113-7991135 TAGTTCTAGGAGAGGGAGTGAGG + Intronic
971385345 4:26136563-26136585 CAATCCAAGGAGAGGCATGGGGG - Intergenic
971775751 4:30962497-30962519 TAATTCTAGGATGGGCATGGTGG + Intronic
972366417 4:38379487-38379509 CATTTCTAGGCCAGGCACGGTGG - Intergenic
978392370 4:108240710-108240732 CTCTTCTAGGATAGGAAGGGAGG + Intergenic
978726291 4:111973410-111973432 CAATTCTAGGCCAGGCGCGGTGG - Intergenic
979136692 4:117118842-117118864 CAATGCTAGCAGAGGACGGGAGG + Intergenic
980735733 4:136884570-136884592 GAATGCTAAGAGAGGAAGGGAGG + Intergenic
981146387 4:141330057-141330079 CAATTTTAGGAAAGCCATGGAGG - Intergenic
982462860 4:155692769-155692791 GAATTCTAGGATGGGCATGGTGG + Intronic
982837946 4:160146467-160146489 AAAATCTAGCAGAGGCCGGGCGG + Intergenic
982844418 4:160231873-160231895 CAATTCTAGGAGAGGACTGATGG - Intergenic
983564418 4:169134134-169134156 TATTTCTAGAAGAGGCTGGGAGG - Intronic
984666688 4:182436728-182436750 CAATTCTTGGCCAGGCATGGTGG + Intronic
985046535 4:185946642-185946664 CATTTAGAGGAGAAGCAGGGTGG - Intronic
987672303 5:21026088-21026110 CAATTTTAGGCCAGGCAAGGTGG + Intergenic
988469429 5:31524905-31524927 CAATTTTAGGCCAGGCATGGTGG + Intronic
988550358 5:32195539-32195561 CAATTCTAGGCCAGGCACCGTGG + Intergenic
992317058 5:75566664-75566686 AAAGGCTAGGAGAAGCAGGGTGG - Intronic
993433150 5:87857082-87857104 CAATTCCAGGCCAGGCACGGTGG + Intergenic
993693632 5:91034174-91034196 CAAATCTAGTATAGGCGGGGAGG + Intronic
993820359 5:92607449-92607471 CAAATGTAGAAGAGGGAGGGAGG + Intergenic
994118077 5:96083468-96083490 CACTTCTGGGAAAGGGAGGGAGG - Intergenic
994164243 5:96592221-96592243 TATTTCTAGCAGAGACAGGGTGG - Intronic
994210226 5:97079582-97079604 CTGTTCTACTAGAGGCAGGGTGG + Intergenic
994658501 5:102624602-102624624 GAATGCAAGGAGAGACAGGGAGG - Intergenic
996749292 5:126872917-126872939 CGAATGTAGGAGAGGCAGGCTGG + Intronic
997633000 5:135384223-135384245 CACTTCTAGGAGATGGAGGCAGG + Intronic
997872360 5:137516899-137516921 CAAGTTCAGGAGGGGCAGGGAGG + Intronic
997905327 5:137811012-137811034 CGATTCTAGGCCAGGCATGGTGG + Intergenic
998161918 5:139817781-139817803 TGACTCTAGGAGAGGAAGGGAGG + Intronic
998190087 5:140016171-140016193 CACTTGTAGGAGAGGCAGAAGGG + Intronic
999470382 5:151849839-151849861 AAATTCTAGGCTAGGCATGGTGG - Intronic
999596526 5:153211200-153211222 CAACTCCAGGAGAGAAAGGGTGG + Intergenic
999745425 5:154588205-154588227 CAACCCTAGGAGTGGCCGGGAGG - Intergenic
1000099491 5:158001618-158001640 CAAGTCAAGAAGAGGTAGGGTGG + Intergenic
1000444470 5:161302846-161302868 AAATTCTATGAGAGCAAGGGAGG + Intronic
1000747192 5:165048136-165048158 CAATTATAGGCCAGGCATGGTGG - Intergenic
1001958353 5:175863847-175863869 CATGTGCAGGAGAGGCAGGGAGG + Intronic
1003859262 6:10307357-10307379 CAATTTTAGAAGCGGCAGTGTGG + Intergenic
1006459230 6:34148730-34148752 CAATGCTCAGAGAGGCTGGGGGG - Intronic
1006780933 6:36631792-36631814 AAATGCTAGGGGTGGCAGGGAGG + Intergenic
1011648119 6:89479763-89479785 CAATTCTAGGGGAGGCGGGAGGG - Intronic
1011752992 6:90472251-90472273 CAATTCTTGGCAAGGCACGGTGG + Intergenic
1012244019 6:96906126-96906148 CACTGTTAGGTGAGGCAGGGAGG + Intergenic
1012452966 6:99373145-99373167 CACTTCTAGGCCAGGCATGGTGG + Intronic
1013376413 6:109519505-109519527 CCATTCTAGGTCAGGCATGGTGG + Intronic
1015909762 6:138159008-138159030 TATTTTTAGTAGAGGCAGGGGGG + Intergenic
1016057083 6:139589538-139589560 CAGTTCTATGAGAACCAGGGAGG + Intergenic
1016815955 6:148303265-148303287 CAATTTTAGGCCAGGCATGGTGG - Intronic
1016958564 6:149650050-149650072 AAATTCTAGGCCAGGCACGGTGG + Intergenic
1017263315 6:152413136-152413158 CAATTATAGGCCAGGCACGGTGG - Intronic
1017437991 6:154435777-154435799 GAATAGGAGGAGAGGCAGGGGGG - Intronic
1018444517 6:163842918-163842940 CAGCTCTAAGAGAGGGAGGGAGG - Intergenic
1018592511 6:165442829-165442851 CAAGTCTAGGCCAGGCATGGTGG + Intronic
1018725001 6:166605082-166605104 CAGTTCTAGGAGAGGCAAGAGGG - Intronic
1018914543 6:168125116-168125138 CCAAGCCAGGAGAGGCAGGGTGG - Intergenic
1019336621 7:485865-485887 CAATGCCAGGTGGGGCAGGGAGG + Intergenic
1020202103 7:6088010-6088032 CAACTCTAGGACAGGCATGGTGG + Intergenic
1020323466 7:6957077-6957099 CAATTCTAGGAGAGACTGTGAGG - Intergenic
1021209095 7:17823073-17823095 CAAATTTAGAAGAGGCAGGATGG - Intronic
1021683187 7:23155373-23155395 TAATTCTAGGCCAGGCACGGTGG + Intronic
1022305091 7:29139524-29139546 CTATTCTTGGGGGGGCAGGGGGG + Intronic
1023680815 7:42685401-42685423 CAATTATAGTAAAGACAGGGAGG + Intergenic
1024234191 7:47385483-47385505 CGATGCTCAGAGAGGCAGGGAGG + Intronic
1025125189 7:56338716-56338738 GAATTCAAGGACAGGCATGGTGG + Intergenic
1025212533 7:57028263-57028285 CCCTTCTAAGAGAGGCAGGTGGG - Intergenic
1025659422 7:63548564-63548586 CCCTTCTAAGAGAGGCAGGTGGG + Intergenic
1026178959 7:68022043-68022065 CAATTTTTGGGCAGGCAGGGTGG + Intergenic
1026461722 7:70620565-70620587 CAATTCAAGGAGAAGCAGTCAGG - Intronic
1027979103 7:85194647-85194669 TAAATCTAGGAGTGGAAGGGAGG + Intergenic
1028524816 7:91772385-91772407 CCAATCTAGAAGAGGCAGGCAGG + Intronic
1029471127 7:100754927-100754949 CAATTTTAGGCTAGGCACGGTGG - Intronic
1029675676 7:102066714-102066736 CTCTTCTAAGAGAGGCAGGTGGG - Intronic
1030040046 7:105441361-105441383 TGATTCTAGGACAGGCATGGTGG - Intronic
1030625710 7:111843985-111844007 CAATTCCAGGCTAGGCATGGTGG + Intronic
1032130782 7:129225457-129225479 CCTCTCTAGGAGAGGAAGGGAGG + Intronic
1032617503 7:133490395-133490417 AAGTTCTGGGAAAGGCAGGGAGG + Intronic
1033269782 7:139920378-139920400 CATTTCTAAAAGAGGCAGGAAGG - Intronic
1034797847 7:154029906-154029928 CAATTTTAGGCCAGGCACGGTGG + Intronic
1035577454 8:716844-716866 GGCTTCTAGGCGAGGCAGGGAGG + Intronic
1035925945 8:3727914-3727936 AAATTCAAAGAGCGGCAGGGAGG + Intronic
1036979630 8:13455721-13455743 AAATTCGAGGATAGGCAAGGTGG + Intronic
1037241199 8:16780297-16780319 CAATGCAAAGAGATGCAGGGTGG - Intergenic
1038971984 8:32646745-32646767 CAAATCAAAGAGAGGCAGGCAGG - Intronic
1040392741 8:46963537-46963559 CTATTCTAGGCTAGGCATGGTGG - Intergenic
1040446023 8:47494273-47494295 AAATTCTAGGCCAGGCATGGTGG - Intronic
1041079149 8:54199495-54199517 CAATTGTAGGCCAGGCACGGTGG - Intergenic
1041249639 8:55921718-55921740 CCAGCCTGGGAGAGGCAGGGAGG + Intronic
1043601215 8:81940636-81940658 CAATTCTAGCAGAGGGAGCATGG - Intergenic
1045575434 8:103415191-103415213 CATTTGTGGGCGAGGCAGGGCGG - Exonic
1046261936 8:111780114-111780136 CAATTTTAAGGAAGGCAGGGAGG + Intergenic
1047026204 8:120827189-120827211 CAATTCTTGGAAATGCAGGCAGG + Intergenic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1048962300 8:139590678-139590700 CAATTATAGGCCGGGCAGGGTGG + Intergenic
1050522079 9:6511487-6511509 CAATTCCAGGCCAGGCATGGTGG - Intergenic
1051266491 9:15314199-15314221 CAATTCCAGGTTAGGCATGGTGG - Intergenic
1053366877 9:37529062-37529084 CAAATGGAGGAGAGACAGGGAGG + Intronic
1053673869 9:40400992-40401014 CATGTCTAGGAGAGGCATGCAGG - Intergenic
1053923675 9:43027360-43027382 CATGTCTAGGAGAGGCATGCAGG - Intergenic
1054384971 9:64541058-64541080 CATGTCTAGGAGAGGCATGCAGG - Intergenic
1054510758 9:65975298-65975320 CATGTCTAGGAGAGGCATGCAGG + Intergenic
1055030885 9:71770220-71770242 CCCTTCTGGGATAGGCAGGGAGG + Intronic
1056399174 9:86210125-86210147 CAATTCCAGGCCAGGCACGGTGG + Intergenic
1056803324 9:89709111-89709133 CCATGCTAGGAGAGGCTGAGTGG - Intergenic
1057404411 9:94755970-94755992 CAACCCTAGGCCAGGCAGGGTGG + Intronic
1057813449 9:98275792-98275814 CAACTCTAGGCCAGGCATGGTGG + Intergenic
1057927896 9:99169311-99169333 CATTTCTGAGAGAGGCAGGCAGG + Intergenic
1057943444 9:99304974-99304996 AAAATCTAGGCCAGGCAGGGTGG + Intergenic
1059142776 9:111869908-111869930 AAATTCTAGGTGGGGCATGGTGG - Intergenic
1059302882 9:113329587-113329609 AAAATCTAGGCCAGGCAGGGTGG - Intronic
1059319491 9:113457256-113457278 CAAGTATAGGAGAGGAAGGAAGG - Intronic
1060206923 9:121687524-121687546 GCATTGTGGGAGAGGCAGGGTGG + Intronic
1061661340 9:132132314-132132336 CAGTTTCAGGAGGGGCAGGGAGG + Intergenic
1062729922 9:138103114-138103136 CATTCCTAGGAAAGGAAGGGAGG - Intronic
1203772366 EBV:56072-56094 GATGTTTAGGAGAGGCAGGGAGG + Intergenic
1186021520 X:5261737-5261759 CAGTTCTGGGAAAAGCAGGGTGG + Intergenic
1188977341 X:36691171-36691193 TAATTCTAGGAGGGACAGGCTGG - Intergenic
1190568441 X:51755817-51755839 AAATTATAGGAGATGCAGGGAGG + Intergenic
1191926909 X:66322761-66322783 CATTTCTAGGCCAGGCACGGTGG + Intergenic
1194289684 X:92055063-92055085 CTATTCCAGGAAAGGCAGAGTGG + Intronic
1195483455 X:105374659-105374681 GAATTCTAGGCCAGGCACGGTGG + Intronic
1196830599 X:119772742-119772764 CAACTTTGGGAGAGGCAGGGAGG - Intergenic
1197460780 X:126737937-126737959 CAGCTCCAGGAGAGGGAGGGAGG - Intergenic
1197659319 X:129152613-129152635 CCATTCTAGGCCAGGCATGGTGG - Intergenic
1197745304 X:129928774-129928796 CAATCCTAAGAGAGGGAAGGAGG + Intronic
1198464709 X:136894595-136894617 CAATACTAGGACGGGCATGGTGG + Intergenic
1198559522 X:137833740-137833762 CAATCCTAGGCCAGGCACGGTGG - Intergenic
1198712680 X:139523009-139523031 CAATTCTAGGCCAGGCACGGTGG + Intergenic
1199458212 X:148053196-148053218 AACTACTAGAAGAGGCAGGGAGG - Intergenic
1199766848 X:150947549-150947571 CAAAGCTGGGAGAGGCAGGAAGG - Intergenic
1200607197 Y:5279639-5279661 CTATTCCAGGAAAGGCAGAGTGG + Intronic