ID: 1146989993

View in Genome Browser
Species Human (GRCh38)
Location 17:37261128-37261150
Sequence TTTAAGGTTTAGTTGGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146989993_1146989998 -5 Left 1146989993 17:37261128-37261150 CCACACACCAACTAAACCTTAAA 0: 1
1: 0
2: 1
3: 14
4: 294
Right 1146989998 17:37261146-37261168 TTAAAAAAGATGGTCTGAAAGGG 0: 1
1: 1
2: 6
3: 53
4: 563
1146989993_1146989997 -6 Left 1146989993 17:37261128-37261150 CCACACACCAACTAAACCTTAAA 0: 1
1: 0
2: 1
3: 14
4: 294
Right 1146989997 17:37261145-37261167 CTTAAAAAAGATGGTCTGAAAGG 0: 1
1: 0
2: 1
3: 12
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146989993 Original CRISPR TTTAAGGTTTAGTTGGTGTG TGG (reversed) Intronic
903627036 1:24738295-24738317 TTTAAGTTTTAATTTTTGTGGGG - Intergenic
904303331 1:29570402-29570424 TTTAAGGATAACTTGGTGGGTGG + Intergenic
905357671 1:37396119-37396141 TTTAAGGTTTGGAGGATGTGAGG - Intergenic
905785020 1:40748302-40748324 TTTAATGTTTTTTTGGAGTGGGG + Intronic
906264084 1:44415683-44415705 TTTAGAGTTTTGTTGGTGGGTGG + Intronic
906464343 1:46062805-46062827 TTTCAGTTTTGGTTGGTGGGTGG + Intronic
908484604 1:64578145-64578167 TTTTAGGTTTGGTTTGTCTGAGG + Intronic
908701860 1:66910941-66910963 CTGATTGTTTAGTTGGTGTGTGG - Intronic
910671326 1:89775776-89775798 TTTAATGTGTAGTTTTTGTGGGG - Intronic
910794478 1:91084383-91084405 TTTAAGGATAACTTGGTGGGTGG - Intergenic
910795185 1:91090814-91090836 TTTAAGGATAACTTGGTGGGTGG - Intergenic
910888629 1:91993510-91993532 TTTAATGTTTACTATGTGTGAGG - Intronic
912346708 1:108969586-108969608 TTTAAGGATAATTTGGTGGGTGG - Intergenic
912537180 1:110383398-110383420 TTTAAGGATAATTTGGTGGGTGG + Intronic
916808227 1:168280880-168280902 GTTAAGCTTTAGTTGGGGAGCGG - Intergenic
917998941 1:180472264-180472286 TGTAACGTTTAGGTGATGTGTGG + Intronic
918174566 1:182031522-182031544 TTTAAGGTTGGGTAGGTGAGTGG + Intergenic
918452552 1:184673522-184673544 TTTAAGGATAATTTGGTGGGTGG - Intergenic
919468749 1:197952969-197952991 TTTAAGGATAATTTGGTGGGTGG - Intergenic
920029401 1:203027337-203027359 TTTGAGGTTTTGATGGTGGGTGG + Intronic
920749074 1:208657189-208657211 TCTCAGATTTAGTTGGTGGGAGG + Intergenic
921213874 1:212921292-212921314 TTTCAGATTTAGCTGGTTTGGGG + Intergenic
921883095 1:220276058-220276080 TTTAAGGATAACTTGGTGGGTGG - Intergenic
923279516 1:232429652-232429674 CTGAAGATTTAGTTGGTTTGTGG + Intronic
923483719 1:234408749-234408771 TTTAAGGATAATTTGGTGGGAGG - Intronic
924512625 1:244740344-244740366 TTTAAGGATAATTTGGTGGGCGG - Intergenic
1062892881 10:1078253-1078275 TTTATGGTGTACTTGGTGTAGGG - Intronic
1063735551 10:8749681-8749703 TTTAATGTTTAGTTATAGTGTGG - Intergenic
1063937707 10:11096150-11096172 TTTAAGCTTTAGTTGTTCAGAGG - Intronic
1065217059 10:23459339-23459361 TTTAAGGATAACTTGGTGGGTGG - Intergenic
1065937958 10:30537886-30537908 TTTCAGGTTTTGTGGGTGGGGGG + Intergenic
1067208775 10:44241698-44241720 TTGAAGGTTTTCTTGATGTGGGG - Intergenic
1067400053 10:45964129-45964151 TTGAAGGTTTATTTGCTGTTTGG + Intergenic
1067868381 10:49933421-49933443 TTGAAGGTTTATTTGCTGTTTGG + Exonic
1069248567 10:66241109-66241131 TTTAAGGTTTTGTTTGTTTGTGG - Intronic
1072121339 10:92407795-92407817 TTTAAGGGTAATTTGGTGGGTGG + Intergenic
1072375507 10:94811876-94811898 TTTAAGGTTAATATTGTGTGTGG + Intronic
1072389386 10:94967682-94967704 TTTAAGGTTAATATTGTGTGTGG + Intronic
1073894507 10:108139190-108139212 TTACAAGTTTAGTTGCTGTGGGG + Intergenic
1074439574 10:113464415-113464437 TTTAAGCTTTTGTTGGAGTAGGG - Intergenic
1076795779 10:132797720-132797742 GTTAACATTTATTTGGTGTGAGG + Intergenic
1077966323 11:7137546-7137568 TTTAGGGTTTTTATGGTGTGGGG - Intergenic
1078751142 11:14164766-14164788 TTTAAGGATAACTTGGTGGGTGG + Intronic
1079938743 11:26651294-26651316 TCTAAGGTTTAGTTGCAATGCGG - Intronic
1080495880 11:32818466-32818488 TTTAAGGCTTAATATGTGTGTGG - Intergenic
1080703444 11:34666005-34666027 TTTAAGGATAACTTGGTGGGTGG - Intergenic
1080703876 11:34669696-34669718 TTTAGGGTTGAGTAGGTGGGAGG + Intergenic
1080751594 11:35155509-35155531 TTTGAGGTTTAGATGGTCTGTGG + Intronic
1080796637 11:35570023-35570045 TTTTAGGTTTTGTTTGTCTGGGG - Intergenic
1084181258 11:67447627-67447649 TTTAAGGATAACTTGGTGGGTGG - Intergenic
1086259281 11:84918214-84918236 CTTAAAATTTAGTTGGGGTGAGG + Intronic
1088661519 11:112052238-112052260 TTAATTGTTTGGTTGGTGTGTGG - Intronic
1089389703 11:118092351-118092373 TTTAAGGATAACTTGGTGGGTGG + Intronic
1090585093 11:128202594-128202616 TTTCAAGTTTCTTTGGTGTGTGG + Intergenic
1090641823 11:128736099-128736121 TTTCCTGTTTAGTGGGTGTGAGG - Intronic
1090701753 11:129302340-129302362 TTAAAGGTTTATTTTGTGGGAGG - Intergenic
1091069734 11:132551754-132551776 TTTAAGGATAATTTGGTGGGTGG - Intronic
1093258005 12:16896148-16896170 TTTAATATTTACTTGTTGTGTGG - Intergenic
1094603489 12:31931033-31931055 TTTAAGGATAAATTGGTGGGTGG - Intergenic
1095215628 12:39544117-39544139 TTTAAGGATAACTTGGTGGGTGG + Intergenic
1098295445 12:68999518-68999540 TTTAAGGATAATTTGGTGGGTGG - Intergenic
1098369451 12:69740612-69740634 TTTAATGTTTAGCTGCTTTGTGG + Intronic
1098382284 12:69881679-69881701 TTTGAGGTTTAGTTGATATGAGG - Intronic
1098530249 12:71533484-71533506 TTTCTGGTTTAGTAGGTCTGAGG - Intronic
1098603779 12:72365254-72365276 TTTGAGGTTTGCTTGTTGTGGGG + Intronic
1098686353 12:73425722-73425744 TTTAGGGTTTAATGGGTGTCAGG - Intergenic
1100294574 12:93248817-93248839 TTTAAGGATAATTTGGTGGGTGG + Intergenic
1102702935 12:114855291-114855313 GTGGAGATTTAGTTGGTGTGAGG + Intergenic
1103506841 12:121447040-121447062 TTTAAAGTTTAGTTGCAATGTGG - Intronic
1103539685 12:121657509-121657531 TTTAAGGATAACTTGGTGGGTGG - Intronic
1103539760 12:121658060-121658082 TTTAAGGATAACTTGGTGGGTGG - Intronic
1104320364 12:127745131-127745153 TTTAAGGATAATTTGGTGGGTGG + Intergenic
1104355628 12:128082696-128082718 TTTAAGGATAATTTGGTGGGTGG - Intergenic
1106005960 13:25770481-25770503 TTTAAGGATAACTTGGTGGGTGG - Intronic
1106540213 13:30683772-30683794 TTTAGGGTTTAATTTGAGTGAGG + Intergenic
1107211783 13:37866828-37866850 TTTAATGTTTATTTTTTGTGGGG + Intronic
1107868673 13:44727857-44727879 TTTAAGGATAACTTGGTGGGTGG - Intergenic
1107980206 13:45727924-45727946 TTTAAAGTTTATTTTCTGTGAGG + Intergenic
1107984714 13:45765702-45765724 TTGATTGTTTACTTGGTGTGTGG + Intergenic
1108337118 13:49455317-49455339 CTTAAAGGTTAGTTGGAGTGTGG + Intronic
1109292675 13:60495779-60495801 TTTAAGGACAAGTTGGTGGGTGG + Intronic
1110334580 13:74312596-74312618 CTTAATTTTTAGTTGGTGTTTGG + Intergenic
1111476968 13:88762235-88762257 TTTAAGGATAATTTGGTGGGTGG - Intergenic
1115349026 14:32373284-32373306 TTTAAGGATAACTTGGTGGGTGG + Intronic
1115730406 14:36262499-36262521 TGTTAGTTTTAGTCGGTGTGAGG + Intergenic
1116204254 14:41841795-41841817 TTAAATGTTTAGTTGTTTTGTGG + Intronic
1120694831 14:87633039-87633061 TTTAAGGATAACTTGGTGGGTGG - Intergenic
1121716543 14:96080325-96080347 TTTAAAGTTAAATTTGTGTGGGG - Intronic
1123842990 15:24268297-24268319 TTTAAGGATAATTTGGTGGGTGG - Intergenic
1126307949 15:47282694-47282716 TTTGAGGGTCAGTTAGTGTGGGG + Intronic
1126847751 15:52776938-52776960 ATTCAGGTTCAGTAGGTGTGGGG + Intronic
1127028738 15:54837099-54837121 TTTCAGATTTAGTGGCTGTGAGG - Intergenic
1128077833 15:64839350-64839372 TTGAAGGTTTGGGAGGTGTGGGG - Intergenic
1128351761 15:66895470-66895492 TTTAAGGATAACTTGGTGGGTGG + Intergenic
1130392853 15:83474057-83474079 TTTAAATTGTAGTTAGTGTGAGG + Intronic
1130837186 15:87662825-87662847 TTTAAGGATAACTTGGTGGGTGG - Intergenic
1130998690 15:88920830-88920852 TTTAAGGATAACTTGGTGGGTGG - Intergenic
1130999695 15:88929939-88929961 TTTAAGGATAACTTGGTGGGTGG - Intergenic
1133686254 16:8168119-8168141 TTTAAAGTTTCATAGGTGTGAGG - Intergenic
1134132355 16:11658364-11658386 GTTCATGTTTAGTAGGTGTGGGG - Intergenic
1134593857 16:15479442-15479464 TTTAAGGTTTACTTGCAATGTGG - Intronic
1135672760 16:24389269-24389291 TTTAAGGACTACTTGGTGCGTGG - Intergenic
1138876838 16:60961763-60961785 ACTAAGGTTAAGTTGGTGTTAGG + Intergenic
1139646140 16:68332125-68332147 TTTAAGCTTTCTTTGGAGTGGGG + Intronic
1141399632 16:83735987-83736009 CGTAAGCTTTACTTGGTGTGAGG - Intronic
1203141564 16_KI270728v1_random:1770655-1770677 TTTAAGGATAATTTGGTGGGTGG + Intergenic
1142633358 17:1240699-1240721 TTTAAGGATAACTTGGTGGGTGG - Intergenic
1143222254 17:5272460-5272482 TTTAAGGATAACTTGGTGGGTGG - Intergenic
1143274315 17:5698899-5698921 TTTAAGGATAAGTTGGTGGGCGG - Intergenic
1145754050 17:27377247-27377269 TTTAAGGATAATTTGGTGGGTGG - Intergenic
1146989993 17:37261128-37261150 TTTAAGGTTTAGTTGGTGTGTGG - Intronic
1151095072 17:71487904-71487926 TTTAAAGTTTAGTTGGGATGTGG - Intergenic
1151262318 17:72925935-72925957 TTTGAGGTTTCCTTGCTGTGAGG + Intronic
1151464765 17:74277448-74277470 GTTAAGGTTGAGTTGCTCTGGGG + Intronic
1153174573 18:2356704-2356726 TTTAACTTTAAGTTGGTGAGTGG - Intergenic
1155070531 18:22311849-22311871 TTTCAGGCATAGTTGGTTTGTGG + Intergenic
1156902844 18:42321409-42321431 TTTAAGGATAATTTGGTGGGTGG - Intergenic
1157217012 18:45792634-45792656 TTTAAGGATAATTTGGTGGGTGG - Intergenic
1158958129 18:62561789-62561811 TTTAAGGTTTTGTTGTTGTCTGG + Intronic
1159655258 18:71025167-71025189 TTTAAGGATAACTTGGTGGGTGG - Intergenic
1162715736 19:12631730-12631752 TTTAACTTTTTTTTGGTGTGTGG - Exonic
1166917157 19:46203240-46203262 TTGATGGATTAGTTGGGGTGGGG + Intergenic
1168227368 19:55005444-55005466 TTTAAGGATAACTTGGTGGGTGG + Intergenic
925024531 2:597267-597289 TTAAAGGTTTAGTGCGTGCGTGG + Intergenic
925104679 2:1281286-1281308 TTTATGGTGTATATGGTGTGTGG + Intronic
925104686 2:1281367-1281389 TTTATGGTGTATGTGGTGTGTGG + Intronic
925104695 2:1281471-1281493 TTTATGGTGTATATGGTGTGTGG + Intronic
926238127 2:11065070-11065092 TTTTAGTTGTAATTGGTGTGAGG + Intergenic
926472934 2:13284145-13284167 TTCAAGGTTTAGTTGATGATGGG - Intergenic
927630571 2:24770396-24770418 TTTAAGGTGCAGTTGGGATGGGG - Exonic
927793568 2:26029762-26029784 TTAAAGGTTTTGCTGGAGTGAGG - Intergenic
930245779 2:48982127-48982149 TTTAAGGCTTCTTTGGTGGGGGG - Intronic
930839316 2:55827512-55827534 TTTAAGGATAATTTGGTGGGTGG + Intergenic
932732590 2:74231726-74231748 TTTAAGATTTCGTTTTTGTGGGG + Intronic
932823840 2:74922860-74922882 CTTAAGGCTAGGTTGGTGTGAGG + Intergenic
934096432 2:88610403-88610425 TTTAAAGGTTAGTTGCAGTGTGG - Intronic
934670572 2:96209710-96209732 TTTAAGGATAATTTGGTGGGTGG - Intergenic
937492885 2:122388287-122388309 TTTAAGGGTAATTTGGTGAGTGG - Intergenic
938272149 2:129982447-129982469 TTTAAGGTTTTGTTGCAATGAGG - Exonic
938443863 2:131361379-131361401 TTTAAGGTTTTGTTGCAATGAGG + Intergenic
938504516 2:131863632-131863654 TTTTTGGCTTAGTTGGTGTCAGG + Intergenic
939104674 2:137935458-137935480 TTTAAGGATAATTTGGTGAGTGG + Intergenic
939255691 2:139742486-139742508 TTTAAGGATAATTTGGTGGGTGG - Intergenic
939502157 2:143001272-143001294 TTTAAAGTCTATTGGGTGTGAGG - Intronic
939713274 2:145550562-145550584 TTTAAGGTGAAGTTGATGTCAGG - Intergenic
940486854 2:154306602-154306624 TTTAAGGATAATTTGGTGGGGGG + Intronic
942166400 2:173245121-173245143 TTTAAGGGGTAGTTAGTGGGTGG - Intronic
942625999 2:177901352-177901374 TTTAAGGATAATTTGGTGGGTGG - Intronic
943758961 2:191587935-191587957 TTTAAGGATAACTTGGTGGGTGG - Intergenic
945155500 2:206833393-206833415 ATTATGGTTTTGTAGGTGTGGGG + Intergenic
945185495 2:207135475-207135497 TTTACGTTTTAGATGTTGTGAGG - Intronic
947179833 2:227402073-227402095 TTTAAGGATAACTTGGTGGGTGG + Intergenic
947407934 2:229800415-229800437 GTTGTGGTTTAGTTGGTCTGTGG + Intronic
947802695 2:232941059-232941081 TTTAAGGATAATTTGGTGGGTGG + Intronic
948511824 2:238472364-238472386 TGTTAGGTTTATTTGGTCTGTGG + Intergenic
948576217 2:238951529-238951551 TTGAAGGTTTATTTGGTGCCAGG + Intergenic
1168818305 20:756017-756039 TTTAAGGATAACTTGGTGGGTGG - Intergenic
1168989494 20:2082088-2082110 TTTCTGGTTTAGTAGGTTTGGGG - Intergenic
1170340150 20:15316680-15316702 TGTCAGGTCTAGTTGGTGTATGG - Intronic
1170936195 20:20811867-20811889 TTTAAGGATAAGTTGGTGGGTGG + Intergenic
1171344266 20:24453591-24453613 TTCAAGGTTTTGTGGGTGGGGGG - Intergenic
1173632614 20:44528093-44528115 TTTAAGGTTAACTTGGTGGGTGG - Intergenic
1175486227 20:59348583-59348605 TTTAAAGTTTGGATGGTGAGAGG + Intergenic
1178097502 21:29231852-29231874 TTTAAGGATAACTTGGTGGGTGG + Intronic
1178863128 21:36305889-36305911 TTTAAGGATAAGTTGGTGGATGG - Intergenic
1179036760 21:37764743-37764765 TTTAAGGTTGAATGGGTGTTTGG + Intronic
1179234800 21:39536171-39536193 TTTAAGGATAACTTGGTGGGCGG + Intergenic
1181024449 22:20120129-20120151 GTTAAGGTTTTGTTGCTCTGGGG + Intronic
1181304922 22:21910389-21910411 TTTAAGGATAACTTGGTGGGTGG + Intergenic
1182454491 22:30441212-30441234 TTTAAGGATAATTTGGTGAGTGG + Intergenic
1183250220 22:36725177-36725199 CTTAACGTCTAGCTGGTGTGGGG - Intergenic
1184325943 22:43785165-43785187 TGTGAGGTCTAGTTGGTTTGTGG - Intronic
1184946876 22:47809961-47809983 TGTGTGGTTTAGGTGGTGTGTGG + Intergenic
951564563 3:24000268-24000290 TTTCTGGTTTAGTGGGTCTGGGG + Intergenic
951743192 3:25946648-25946670 TTTGTGCTTTAGTTGGAGTGTGG + Intergenic
953425775 3:42796633-42796655 TTTAAGGATAATTTGGTGGGTGG + Intronic
955392042 3:58529017-58529039 TTTAAGGTTTTTATGGTGTCGGG - Intronic
957284134 3:78195557-78195579 TTTAATGTTAATTTGTTGTGGGG + Intergenic
958151300 3:89697581-89697603 TTTAAGGATAACTTGGTGTGTGG + Intergenic
961084295 3:124053392-124053414 TTTAATGTCTAGTTGATGTTGGG + Intergenic
965022568 3:163252422-163252444 TTTAAGGTTTATATGGTTTTAGG - Intergenic
966533876 3:181009437-181009459 TTTAAGGATAATTTGGTGGGTGG + Intergenic
966646531 3:182251542-182251564 TTTAAGGGTTAGGAGGTGGGGGG + Intergenic
966757438 3:183384633-183384655 TTTAAGGATAACTTGGTGGGTGG - Intronic
967799526 3:193640749-193640771 TTTCATGTTTAGCTGGTGGGGGG + Intronic
967959119 3:194905836-194905858 TTTGAGGTTGAGTTGTTTTGAGG - Intergenic
968210469 3:196844531-196844553 TTTAAGGATAATTTGGTGGGTGG + Intergenic
968291012 3:197539811-197539833 TTTAAGGATAATTTGGTGGGTGG - Intronic
971034797 4:22681576-22681598 TTTAAGGGTCAGTTGGTTTGAGG + Intergenic
972743811 4:41913789-41913811 TTTAAGGATAATTTGGTGGGTGG - Intergenic
974618751 4:64326814-64326836 TTAAAGGTTTCTTTTGTGTGAGG + Intronic
975100070 4:70502823-70502845 TTTAAAGTTTAGTTGAGCTGAGG - Intergenic
976031108 4:80754917-80754939 TTCAAGGTTTTGTTGTTGTAAGG + Intronic
978307580 4:107348512-107348534 TTTAAGGATAATTTGGTGGGTGG - Intergenic
978398539 4:108307871-108307893 TTTAAGGATAATTTGGTGGGTGG + Intergenic
979304879 4:119131026-119131048 TATTAGGTTTATTTGGGGTGAGG - Intergenic
979484693 4:121257222-121257244 TTTAAGGATAACTTGGTGGGTGG + Intergenic
979542393 4:121900258-121900280 TTTAAGGTTTAGCTTTTGAGTGG + Intronic
980121450 4:128732192-128732214 TTTAAGGATAATTTGGTGGGGGG + Intergenic
980270446 4:130577151-130577173 TTTAAGGATAATTTGGTGGGTGG - Intergenic
980466724 4:133196277-133196299 TTTAAGGATGATTTGGTGGGTGG + Intronic
980627840 4:135396946-135396968 TATATGGTTCAGTTGGTTTGTGG + Intergenic
980972308 4:139578259-139578281 TTTAAGGATAATTTGGTGGGTGG + Intronic
981696911 4:147568192-147568214 TTTAAGGATAATTTGGTGAGTGG - Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
984124918 4:175795953-175795975 ATGAAGGTTCAGTTGGGGTGGGG - Intronic
984701948 4:182824238-182824260 TTTAAGGATAACTTGGTGGGTGG - Intergenic
984706733 4:182852715-182852737 TTTCATGTTTGGTTGGGGTGGGG + Intergenic
985103898 4:186483539-186483561 TTTAATGTGTAGTTGGTGAAAGG - Intronic
988307208 5:29507745-29507767 TTTAAGGTTAGGTTTGGGTGTGG - Intergenic
988562068 5:32290432-32290454 TTTAGGGGTTCGGTGGTGTGCGG + Intronic
988801893 5:34703727-34703749 TTTAAGCTTTAGTTGCTTTATGG + Intronic
989010731 5:36869275-36869297 TTTAAGGATAATTTGGTGGGTGG + Intergenic
992389596 5:76318112-76318134 TTTATGTTTTAGTTGGTGGTGGG - Intronic
992428415 5:76683007-76683029 TTTAAGATTTAAATGGTATGAGG + Intronic
992661885 5:78970077-78970099 CTTAAAGTTTAGTTGCTGTATGG - Intronic
993032794 5:82724323-82724345 TTTTAGGTTTTGTTGGTGCATGG - Intergenic
993379231 5:87186952-87186974 TTGAAGGTAGAGTAGGTGTGGGG - Intergenic
993421938 5:87713862-87713884 TTTAAGGATAACTTGGTGGGTGG + Intergenic
993422723 5:87721593-87721615 TTTAAGGATAACTTGGTGAGTGG + Intergenic
995200984 5:109425063-109425085 TTTAAGGATAATTTGGTGGGTGG - Intergenic
995636994 5:114204192-114204214 TTTAAGGTGCAGTTGGGATGGGG - Intergenic
996416905 5:123220416-123220438 TTTAAGGTTTAAATGGTCAGAGG + Intergenic
998496378 5:142594117-142594139 TTTAAGGGTTAGTTGAGGTCAGG + Exonic
998677916 5:144430357-144430379 GGTAAGGTTCAGGTGGTGTGAGG + Intronic
999464947 5:151794015-151794037 TTTCAGTTTTTGTTGTTGTGGGG - Intronic
1000831814 5:166111259-166111281 TTTAAGGATAACTTGGTGGGTGG - Intergenic
1000875677 5:166635020-166635042 TTTATGTTTTCGTTGGTGTAAGG - Intergenic
1002497660 5:179626275-179626297 TTTAAGTTTTAGTTGAGATGGGG + Intronic
1003267970 6:4583213-4583235 TTTAAGGATAATTTGGTGGGTGG - Intergenic
1003520095 6:6850961-6850983 ATTTAGATTTAGTTGGTTTGAGG - Intergenic
1006308927 6:33243457-33243479 TTGAAGGTTGGGTTGGTCTGGGG + Intergenic
1007132483 6:39488743-39488765 TCTAATGTTTAGTTGGTGAATGG - Intronic
1008813528 6:55534789-55534811 TTTAAAGATTATTTGGTGTGCGG + Intronic
1009474343 6:64070147-64070169 GTTAAAGTTTAGTTGCAGTGTGG + Intronic
1010424096 6:75707124-75707146 TTTCTGGTTTAGTTTGTGTAAGG + Intronic
1011452170 6:87505019-87505041 TTTATGGTTCAGTAGGTCTGGGG + Intronic
1015507674 6:134006316-134006338 TATAAGGTATAGTGGGGGTGAGG + Intronic
1015913202 6:138188675-138188697 TTAAAGGTTGGGTTTGTGTGTGG - Intronic
1016618991 6:146085820-146085842 TTTAGGATTTAGTTGCTTTGAGG + Intronic
1016680458 6:146823404-146823426 TTTAAGGATGATTTGGTGTTTGG - Intergenic
1016741628 6:147534565-147534587 TTTAAGGATAACTTGGTGGGAGG + Intronic
1016742485 6:147542503-147542525 TTTAAGGATAACTTGGTGGGTGG + Intronic
1017177780 6:151520850-151520872 TTTAAGGATAACTTGGTGGGTGG - Intronic
1018313201 6:162531453-162531475 TTTAAGGATAACTTGGTGGGTGG + Intronic
1019100097 6:169623299-169623321 TTTAAGGATAATTTGGTGGGTGG - Intronic
1020832708 7:13111343-13111365 TTTAAGGACAAGTTGGTGGGTGG + Intergenic
1020928862 7:14368154-14368176 TATAAGGTTTTGATGGTGGGGGG - Intronic
1020930293 7:14384681-14384703 GTAAAGGTTTAGTTTGTGTTAGG - Intronic
1023800792 7:43832658-43832680 TTTAAGGATAACTTGGTGGGTGG - Intergenic
1024929475 7:54655018-54655040 TGTGAAGTTTAGTTGGAGTGTGG - Intergenic
1026793185 7:73348530-73348552 TTTCAGAATTGGTTGGTGTGGGG - Intronic
1027975219 7:85145328-85145350 TTTAATGTTTTATTGGTTTGGGG + Intronic
1028557286 7:92137653-92137675 TTTAAGGATAACTTGGTGGGTGG + Intronic
1029317029 7:99724653-99724675 TGTAAGGTGGAGTGGGTGTGAGG - Intronic
1029917784 7:104230284-104230306 TTTAAGGTTTAGTTGGTGGTTGG - Intergenic
1029953667 7:104614172-104614194 TCTAAAGTTTAGTTGGGCTGAGG + Intronic
1031702273 7:124941510-124941532 TTTAAGGATAACTTGGTGGGTGG + Intergenic
1031840831 7:126737390-126737412 TTTAAGGATAATTTGGTGGGTGG - Intronic
1032124202 7:129180277-129180299 TTGAAGGTTGAGGTGGTGAGGGG + Intergenic
1033071519 7:138207727-138207749 TTTAAGGATAATTTGGTGGGTGG + Intergenic
1033310566 7:140258975-140258997 TTTAAGTTTCAGTTGCTGGGAGG - Intergenic
1033775559 7:144606311-144606333 TTCCAGATTTGGTTGGTGTGGGG - Intronic
1034346857 7:150390984-150391006 TTTAAATTTTTGTTGGTATGAGG + Intronic
1038731622 8:30133041-30133063 TTTAAGATTTATTTTGTGTGGGG - Intronic
1039935733 8:42043143-42043165 TTTAAGATTTAGGTCCTGTGAGG - Intronic
1043706692 8:83358958-83358980 TTTAAGGACAAGTTGGTGCGTGG + Intergenic
1044753556 8:95439256-95439278 TTTAAGGTTTAGGTGGAGCCAGG + Intergenic
1045036900 8:98182875-98182897 TTTAATGTTTATTTTGGGTGGGG + Intergenic
1045472888 8:102528046-102528068 TTTAAGGATAACTTGGTGAGTGG - Intergenic
1045603426 8:103745796-103745818 TTTAAGGTTGGGTTGTTGTTGGG + Intronic
1045690834 8:104758282-104758304 TTTAAGGATAACTTGGTGGGTGG + Intronic
1047585017 8:126262073-126262095 TAGAAAGTTTAGTTGGTGTGGGG - Intergenic
1047789987 8:128193356-128193378 TGTCAGGTTTAGTTCGTGTTTGG - Intergenic
1048265211 8:132979764-132979786 TTGAAGAATTGGTTGGTGTGGGG - Intronic
1048265383 8:132980762-132980784 TTGAAGAATTGGTTGGTGTGGGG + Intronic
1048443054 8:134474124-134474146 TTTAAGGCTTCGGTGGTTTGTGG - Intergenic
1049177105 8:141200728-141200750 TTTAAGGAATAGGTGGTGTTTGG - Intergenic
1051393173 9:16589090-16589112 TTTTTGGTTTTGTTTGTGTGTGG - Intronic
1051957981 9:22720608-22720630 TTTAAATTTTAGTTGAGGTGGGG - Intergenic
1052641841 9:31178406-31178428 TTTAATGTTTATTTTCTGTGAGG + Intergenic
1055662029 9:78513344-78513366 TTTAAAGTGTTTTTGGTGTGTGG + Intergenic
1056160819 9:83890836-83890858 TATAAATTTTAGTTTGTGTGTGG - Intronic
1056345386 9:85689357-85689379 ATTAAGATTTAATTGGTTTGGGG + Intronic
1056518148 9:87374318-87374340 TTTAAGGATAACTTGGTGGGTGG + Intergenic
1056660569 9:88540030-88540052 TTTAAATTTTAGGTGTTGTGCGG + Intronic
1057692780 9:97301027-97301049 TTTAGGGGTTGGGTGGTGTGGGG - Intergenic
1058599340 9:106652678-106652700 TTTTAGGTTGAGTCTGTGTGAGG - Intergenic
1058966425 9:110043161-110043183 TTTATGTGTGAGTTGGTGTGGGG - Intronic
1185550965 X:982066-982088 TTTAAGGATGATTTGGTGGGTGG - Intergenic
1186027209 X:5326393-5326415 TTTAAGGATAATTTGGTGGGTGG + Intergenic
1186956817 X:14691612-14691634 ATTGAGGTTTAGTTGGTGTAAGG - Intronic
1188345918 X:29065224-29065246 TTTCAGTTTTTGTTTGTGTGGGG + Intronic
1188402356 X:29761341-29761363 TTAAAGGTTTCTTTGGTGGGGGG - Intronic
1188474439 X:30575193-30575215 TTTAAGACTTTCTTGGTGTGGGG + Intronic
1188686565 X:33076913-33076935 TTTAAGGATAACTTGGTGGGTGG + Intronic
1189483497 X:41411171-41411193 TTTAAGGATAACTTGGTGGGTGG + Intergenic
1190412730 X:50153162-50153184 TTGAAGAATTGGTTGGTGTGGGG - Intergenic
1191219585 X:57973946-57973968 TTTAAGGATAATTTGGTGTTGGG + Intergenic
1194014833 X:88606008-88606030 TTTTAAGTTTTGTTGGTGAGGGG + Intergenic
1194476097 X:94361543-94361565 TTTAAGGATAATTTGGTGCGTGG - Intergenic
1194650143 X:96504469-96504491 TTTAAGGAAGAGTTGTTGTGAGG + Intergenic
1194758472 X:97765789-97765811 TTTAAGGATAACTTGGTGGGTGG + Intergenic
1195954381 X:110314023-110314045 TTTCTGATTCAGTTGGTGTGGGG - Intronic
1196862736 X:120042972-120042994 TTTAAGGATAACTTGGTGGGTGG - Intergenic
1196880366 X:120193372-120193394 TTTAAGGATAACTTGGTGGGTGG + Intergenic
1196963521 X:121030123-121030145 TTTAAGGATAATTTGGTGGGTGG + Intergenic
1199362118 X:146933309-146933331 TTTAAGGATAATTTGGTGGGTGG - Intergenic
1201481395 Y:14443317-14443339 TTTAAGGACAAGTTGGTGAGTGG - Intergenic
1201534210 Y:15027856-15027878 TTTAAGGATAATCTGGTGTGTGG - Intergenic