ID: 1146991549

View in Genome Browser
Species Human (GRCh38)
Location 17:37278063-37278085
Sequence TGCACAGCAAAACTACGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146991548_1146991549 -10 Left 1146991548 17:37278050-37278072 CCAGAAATATAATTGCACAGCAA 0: 1
1: 0
2: 3
3: 25
4: 355
Right 1146991549 17:37278063-37278085 TGCACAGCAAAACTACGTAAAGG 0: 1
1: 0
2: 1
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146991549 Original CRISPR TGCACAGCAAAACTACGTAA AGG Intronic
903104461 1:21063608-21063630 TGCACAGCAAAACAACTTGAAGG + Intronic
904668587 1:32144425-32144447 TGCAAAGCAAAACTGAATAAGGG + Intronic
907172142 1:52478244-52478266 TGCACATGAAAATTACTTAAGGG - Intronic
908610214 1:65849621-65849643 TCCACTGCAAAACTACCTGAGGG + Intronic
911157421 1:94651237-94651259 TGCCCACATAAACTACGTAAGGG - Intergenic
915729066 1:158040058-158040080 TGCAAAGGAAAAATACGCAAGGG - Intronic
918017200 1:180647456-180647478 TGCACAGCATAACGACGTTTTGG - Intronic
920042464 1:203110853-203110875 TGTACAGCAAAGCTACATAAGGG + Intronic
924782567 1:247165588-247165610 TTCACAGCAAAACAAACTAACGG + Intronic
1065244184 10:23741037-23741059 TGGACAGCTAAACTACAGAAAGG - Intronic
1065787305 10:29228740-29228762 AGCACATCAAAACTGCTTAATGG + Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1069938168 10:71933852-71933874 TCCACAACAAAACTAGGTGACGG - Intergenic
1071136420 10:82459238-82459260 TGCACAGCAATGCAAGGTAAAGG - Intronic
1072516931 10:96193676-96193698 TGGACAGAAAAACAACGTATTGG + Intronic
1074675658 10:115847782-115847804 TGTACAGCACAGCTACCTAAAGG + Intronic
1078115783 11:8448837-8448859 TGCACAGGCAACCTACGGAATGG + Intronic
1082673371 11:56064156-56064178 TGAACAACAAAATTACATAATGG + Intergenic
1083683035 11:64359958-64359980 TGCCCAGCAAAACCAGGGAAAGG - Intronic
1087102204 11:94376574-94376596 TGCACAGCTAAACTGGGAAAAGG - Intergenic
1091949387 12:4580411-4580433 TGCACAGCAAAGGGACTTAAAGG + Intronic
1093551411 12:20416318-20416340 CGCACAGGAAAACAACCTAACGG - Intronic
1099337647 12:81384154-81384176 TGAAAAGCAAAACTATGAAATGG - Exonic
1099943740 12:89221003-89221025 TGAACAGGAAAACTACAGAATGG - Intergenic
1105564851 13:21534620-21534642 TGCATAGCAAAAATACTCAAGGG + Intronic
1108617455 13:52148211-52148233 TGCACAGCCAAACTGAATAATGG + Intronic
1110805774 13:79752381-79752403 TTCACAGAAAAACTAGGTACCGG + Intergenic
1112579540 13:100666427-100666449 TGCTCAGCAGAACCACGAAATGG + Intronic
1116161976 14:41279077-41279099 TGAACAGGAAAACTACAGAATGG - Intergenic
1117312561 14:54542532-54542554 AGCACATTAAAACTACGGAATGG - Intergenic
1118116806 14:62787156-62787178 TGCACAGTAAAAGTTCTTAAAGG + Intronic
1118651777 14:67903871-67903893 TGCACTGAAAAACTACCTACTGG - Intronic
1118809591 14:69263144-69263166 TGCACAGCAAGGCTTCTTAAAGG + Intronic
1124491301 15:30158162-30158184 TGCACAGCAAAACAAACTACAGG - Intergenic
1127676525 15:61244557-61244579 TGCATAGCAAAACTTGCTAATGG - Intergenic
1128936688 15:71752316-71752338 TGCAAAGCAAAATTACTTTAAGG - Intronic
1129370773 15:75093304-75093326 TGCACTGCACAACAACGTCATGG - Intronic
1130053775 15:80505547-80505569 TGCACACAAAAACTATCTAAAGG + Intronic
1140775567 16:78246184-78246206 TGTACAGGAGAACTACTTAATGG + Intronic
1144152200 17:12459714-12459736 TGCACATCAAAACTATTTAGAGG - Intergenic
1146991549 17:37278063-37278085 TGCACAGCAAAACTACGTAAAGG + Intronic
1152383970 17:79957803-79957825 TTCACAGCAAAACTGAGTGAAGG - Intronic
1153175313 18:2365616-2365638 TGCACAGTACAACTACATAGAGG - Intergenic
1153345808 18:4024734-4024756 GGCACAGCTATACTATGTAAAGG - Intronic
1157709663 18:49841541-49841563 TGCTCAGGAACACTAGGTAAGGG - Intronic
1157868760 18:51210045-51210067 TGCACAGTAAAACTTCCCAAAGG + Intronic
1158223745 18:55178812-55178834 TGGACAGGAGAACTACGTGAGGG - Intergenic
935295186 2:101643389-101643411 TGCACAGGAAAACTTCTTGAAGG - Intergenic
936473788 2:112822389-112822411 TTTACAGCAAAACTACTCAAGGG + Intergenic
940313013 2:152298289-152298311 TTCACAGCAAAACTGAGCAAAGG + Intergenic
942626032 2:177901648-177901670 TGGACAGCAAATCTCTGTAAGGG + Intronic
943856788 2:192805134-192805156 TTCACAGCAATAATATGTAAGGG + Intergenic
946084743 2:217159380-217159402 TGCACAGAAAAACTTCTGAATGG - Intergenic
947000037 2:225443493-225443515 TACACATCAATACTACGTACTGG + Intronic
1168907062 20:1414177-1414199 TCCACAGCTAATATACGTAATGG + Intergenic
1177575675 21:22951866-22951888 AGGACAGAAAAATTACGTAATGG - Intergenic
1182236317 22:28879657-28879679 TGCAATGCAAACCCACGTAAGGG - Intergenic
952245564 3:31587107-31587129 GGTACAGCTAAAGTACGTAAAGG - Intronic
963283741 3:143412740-143412762 TGCACAGAAAATCTAAGAAAAGG - Intronic
963963449 3:151336923-151336945 TGCACAGCATAACTACTGAGAGG - Intronic
967778304 3:193407558-193407580 TGCACAGAAAAAGTACGGAAAGG + Intronic
970826635 4:20284173-20284195 TGCACAGCAACACAAGGAAAGGG - Intronic
971895709 4:32591079-32591101 TACACAGAAAGACTACGTACAGG + Intergenic
972438742 4:39062533-39062555 TACACAACAAAAATATGTAAAGG - Exonic
978818999 4:112943770-112943792 TTTACAGCAAAACAAGGTAAAGG - Intronic
981112610 4:140953133-140953155 TGCACTGCATAACTACGTTTTGG - Intronic
982271128 4:153589629-153589651 TGGAAAGCAAAACTGCATAAGGG + Intronic
982519465 4:156394626-156394648 TGAACAGCAAACCTACAGAATGG - Intergenic
984369801 4:178848294-178848316 TGGACAGGAAAACTACATGAAGG + Intergenic
988347748 5:30060552-30060574 TGCACAGCAAACCAAATTAATGG - Intergenic
990268550 5:54107300-54107322 GGCACAGCCAAACTACATCAGGG + Intronic
991537899 5:67693322-67693344 TTAACAGCAAAACCACCTAAAGG + Intergenic
995856883 5:116602080-116602102 TTCACAGCAAGACTTCATAAAGG + Intergenic
998562778 5:143186752-143186774 TGCACAGCAAAGCTCCCCAATGG - Intronic
1000979214 5:167798682-167798704 TCCACAGGAAAACTAAATAAAGG + Intronic
1009705006 6:67238882-67238904 AGCACAGTAAAAATATGTAAAGG + Intergenic
1010431430 6:75782732-75782754 TGCACAGCAATAATAGATAAAGG - Intronic
1011834844 6:91419430-91419452 TGCACAGCAAAACAAGCTATTGG + Intergenic
1012086493 6:94832233-94832255 AGGACAACAAAATTACGTAAAGG - Intergenic
1012833354 6:104233395-104233417 TGCACAGCATCAGTACGCAAGGG + Intergenic
1015630094 6:135223382-135223404 TCCTCAGCAAAACTGCTTAAGGG + Intergenic
1016865288 6:148759874-148759896 TGCACAGAAAAATTACCTCAGGG - Intronic
1016974989 6:149798771-149798793 TGCACTGCAAAACTCTGAAAAGG + Intronic
1017621436 6:156303383-156303405 TTCACAGCAAAACTAAGTAAAGG - Intergenic
1018881385 6:167885276-167885298 TGCAAAGGAAAACTTCTTAAAGG - Intronic
1019886344 7:3909221-3909243 AGGACAGCAGAACTCCGTAATGG - Intronic
1021504432 7:21365782-21365804 TGCACAGCATAACTAGGAAAAGG + Intergenic
1023491273 7:40744733-40744755 TGCTCAGCAAAACTCCTTAAGGG - Intronic
1024183650 7:46925065-46925087 TGCACAGAAAACCTACAGAATGG - Intergenic
1028015906 7:85711801-85711823 TAAACAGCAAAACTCTGTAATGG - Intergenic
1028687914 7:93613328-93613350 TGCACAACAGCACTTCGTAAAGG + Intronic
1032916227 7:136493141-136493163 TGCAAAGCACAACCACCTAAAGG - Intergenic
1033396667 7:140980676-140980698 TGCACAGCAAAACTATCAACAGG - Intergenic
1036790611 8:11716353-11716375 TGCACAGGAAAACTGCTTTAAGG + Intronic
1043686386 8:83092013-83092035 TGCACAGCATAACAACGTTTTGG + Intergenic
1044481754 8:92698737-92698759 TGCATGGCAAAACTCCTTAAAGG - Intergenic
1045073148 8:98532079-98532101 TGCAAAGAAAAACTTCTTAAAGG - Intronic
1047421108 8:124709150-124709172 TGGACAGCAAGACTACATAAAGG + Intronic
1050246568 9:3696245-3696267 GGCACAGAAAAAATACATAATGG - Intergenic
1057916359 9:99058535-99058557 TCCACAGCAACACTACATTAGGG + Intronic
1059644015 9:116246265-116246287 TGCTCAGATAAACTATGTAACGG + Intronic
1203445140 Un_GL000219v1:46868-46890 ACAAGAGCAAAACTACGTAAAGG + Intergenic
1186156900 X:6734885-6734907 TGCACAGACAAATTACGTATAGG + Intergenic
1193590153 X:83379548-83379570 TGGACACCAAAACTGAGTAAGGG - Intergenic
1193622814 X:83777525-83777547 TGCACAGGCAACCTACGGAATGG - Intergenic
1194859156 X:98974116-98974138 TGCTCAGCAAAATTACTTGAGGG + Intergenic
1195902089 X:109809697-109809719 TGCACATCAAAACTACAGTAAGG + Intergenic
1199046409 X:143179387-143179409 TTCACATCAAAAGTGCGTAAGGG - Intergenic
1202235007 Y:22702370-22702392 TGAACAGCCAACCTACGAAATGG + Intergenic
1202308152 Y:23493798-23493820 TGAACAGCCAACCTACGAAATGG - Intergenic
1202562649 Y:26176788-26176810 TGAACAGCCAACCTACGAAATGG + Intergenic