ID: 1146992724

View in Genome Browser
Species Human (GRCh38)
Location 17:37289797-37289819
Sequence CCTTCCAACTTCACCCCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146992722_1146992724 -6 Left 1146992722 17:37289780-37289802 CCTTTGCTGATGGGGATCCTTCC 0: 1
1: 0
2: 2
3: 9
4: 114
Right 1146992724 17:37289797-37289819 CCTTCCAACTTCACCCCTTAAGG 0: 1
1: 0
2: 0
3: 14
4: 149
1146992718_1146992724 3 Left 1146992718 17:37289771-37289793 CCCAGTGAGCCTTTGCTGATGGG 0: 1
1: 0
2: 1
3: 20
4: 205
Right 1146992724 17:37289797-37289819 CCTTCCAACTTCACCCCTTAAGG 0: 1
1: 0
2: 0
3: 14
4: 149
1146992720_1146992724 2 Left 1146992720 17:37289772-37289794 CCAGTGAGCCTTTGCTGATGGGG 0: 1
1: 0
2: 3
3: 19
4: 199
Right 1146992724 17:37289797-37289819 CCTTCCAACTTCACCCCTTAAGG 0: 1
1: 0
2: 0
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146992724 Original CRISPR CCTTCCAACTTCACCCCTTA AGG Intronic
901983879 1:13058114-13058136 GCTTCCAAATTCACCACCTATGG + Intergenic
901997933 1:13168655-13168677 GCTTCCAAATTCACCACCTATGG - Intergenic
903050766 1:20599205-20599227 CCTTCCAGCTGCTCCCCTCAGGG - Intronic
906896493 1:49778803-49778825 CCTCCCAACTTCCCCCCTTTTGG - Intronic
907451359 1:54547820-54547842 CCTTCCAGCCTGACCCCTTGTGG + Intronic
908319167 1:62964058-62964080 GCCTCCAACTCCACCCCTGAGGG - Intergenic
908722941 1:67145937-67145959 GCTTCCAACTTCTCTCCTTTTGG + Intronic
910111970 1:83692755-83692777 CCTTCCACCTCCTACCCTTAAGG + Intergenic
910726732 1:90347882-90347904 CCTCCCAACTTGCCCCCTTTTGG - Intergenic
917451926 1:175154333-175154355 CTTTCCCACTTCACCCCCTTGGG - Intergenic
919187386 1:194170081-194170103 CCTACCACCTTCCCCCCTTTTGG + Intergenic
923347428 1:233067966-233067988 ACTTCCAACTTCTCTCCTTCTGG - Intronic
923438867 1:233996459-233996481 CCTTCCAAATTCACACCTGGTGG - Intronic
924702323 1:246466521-246466543 CCTTCCAACCTCCACCCTCAAGG - Intronic
1064012839 10:11749050-11749072 CCTTCCCACTTCAGCCATGACGG + Intronic
1067004368 10:42646990-42647012 CCTTCAAACTTCACCACATAGGG + Intergenic
1067509221 10:46881583-46881605 CCTTCCAAATTCCTCCCTTCAGG - Intergenic
1067653031 10:48170272-48170294 CCTTCCAAATTCCTCCCTTCAGG + Intronic
1068817835 10:61337488-61337510 CCTTCCAAGTACAACCCTTCAGG + Intergenic
1069615381 10:69803142-69803164 CCCTCCCCCTCCACCCCTTAAGG + Intronic
1076592998 10:131602016-131602038 CCTTCCATCTTCCACCCTCAAGG - Intergenic
1076739480 10:132476278-132476300 CCTGCCACCTTCACCTCTTGTGG + Intergenic
1077197395 11:1288287-1288309 CCTTCCAAGCTCTGCCCTTAGGG - Intronic
1078780679 11:14436212-14436234 CCTGCCAATTTCACTCCTTAGGG + Intergenic
1081267390 11:41042478-41042500 CTTTCCACCTACACTCCTTATGG - Intronic
1082918411 11:58464829-58464851 CCCTCCAACCTCACCCCATAAGG - Intergenic
1086367703 11:86124573-86124595 CCTTATAACCTTACCCCTTAAGG - Intergenic
1087488667 11:98793232-98793254 CCTTGCAACTTCACCTTTTGAGG + Intergenic
1087603228 11:100342301-100342323 CCTCACAACTTCTCCTCTTAGGG + Intronic
1088847418 11:113680142-113680164 CATTGCAAATTCTCCCCTTACGG - Intergenic
1089491526 11:118887050-118887072 CCTTCCAACTACACCCCAGTTGG - Intronic
1089817381 11:121188597-121188619 GCTTCCACCTCCACCACTTACGG + Intronic
1090406737 11:126480507-126480529 AATTCCAACTTCACCACTTATGG - Intronic
1093400174 12:18736643-18736665 CCTTCCAACTTCATGCCTTCAGG - Intronic
1095478180 12:42607540-42607562 CCTGCCACCTTCACCCTTTTGGG - Intergenic
1095637946 12:44454191-44454213 CTTTCCAACTTCGTCCCTCATGG + Intergenic
1095741070 12:45607866-45607888 CCATTCAAGTTCACACCTTATGG + Intergenic
1095978316 12:47954885-47954907 TCTTCCAACTTCAGCCCTCGGGG - Intergenic
1098393008 12:69989392-69989414 CCTTCCACCTTCCTCCCTTGAGG - Intergenic
1100091274 12:90974370-90974392 ACTTCCAACTTCTCCCTTAATGG - Intronic
1105884322 13:24628971-24628993 CCTTCCAAGTTCACACTTTATGG - Intergenic
1110671035 13:78178171-78178193 CCTTCCAACCTCCCCACTTTGGG + Intergenic
1115005852 14:28483693-28483715 CCATCCAACATTACCCCTTTGGG - Intergenic
1115817845 14:37181795-37181817 CTTTCCATCTGCACCCCATAGGG + Intergenic
1116351815 14:43872254-43872276 CCTGCAAACTTCACCACTGAAGG - Intergenic
1119510501 14:75207485-75207507 TCTTCCACCTTCACCTGTTATGG - Intergenic
1119644616 14:76339452-76339474 CCTTCCACCTGCACCTCTTGGGG + Intronic
1119735066 14:76976436-76976458 CCTTCCAGCTGCACACCTCAAGG + Intergenic
1120328232 14:83055446-83055468 CCTACCATCTTCACTCCTTCTGG + Intergenic
1121731991 14:96193672-96193694 GCTTCCAACTCTACCCCTTGGGG + Intergenic
1124152681 15:27196037-27196059 CCTTCCAACTACACCTCCAAGGG - Intronic
1125191049 15:36993949-36993971 CATCTCAACTTCACACCTTATGG - Intronic
1125579251 15:40774081-40774103 CCCTCCACCTGCACCCCTTGGGG - Intronic
1129758213 15:78111423-78111445 CCTCCCAACTTCACACCCTGTGG - Intronic
1132240491 15:100253701-100253723 CAGTCACACTTCACCCCTTAGGG + Intronic
1132942530 16:2515058-2515080 CCTCCCAACTTCAGGCCTCAGGG - Intronic
1135468949 16:22712212-22712234 CCTTCCAGCTCCACCCTTCAAGG - Intergenic
1135720600 16:24814358-24814380 CCTTCCAAATTTACTCCTTCTGG + Intronic
1136006500 16:27333860-27333882 CCTTCCAACTCCACCACTTCAGG + Intronic
1136238829 16:28932067-28932089 CCTTCCACCTTCACCACTAGAGG - Exonic
1139297117 16:65910621-65910643 CCTGCCACCTTCACACCATAGGG - Intergenic
1141234130 16:82199757-82199779 CCTTCCATTTTCAACCCTAATGG - Intergenic
1146482835 17:33218827-33218849 CCTTACCACTTCACCCCTTCAGG + Intronic
1146992724 17:37289797-37289819 CCTTCCAACTTCACCCCTTAAGG + Intronic
1149948050 17:60952765-60952787 CCTTCCATCTTCCACCCTCAAGG + Intronic
1151772559 17:76173874-76173896 CCTTCCTGCCTCACCTCTTAGGG - Intronic
1152150880 17:78600243-78600265 CCTGCACCCTTCACCCCTTAGGG - Intergenic
1154132698 18:11750668-11750690 GCTTCCACATTCACCCCATAGGG - Intronic
1157213964 18:45766861-45766883 CCTCCCAACCTCCCCCCTTCAGG + Intergenic
1161931588 19:7344281-7344303 CCTTCCTCCTTTACCCCTTCCGG - Intergenic
1166201837 19:41242802-41242824 CCCTCCCACATCACCCCTTTGGG + Intronic
1166545999 19:43635265-43635287 CCTTCCCCCTTCCTCCCTTAGGG + Intronic
1167695626 19:51014181-51014203 CCTTCCATCCCCAACCCTTAGGG - Exonic
926095442 2:10078601-10078623 ACTTCCAAATTCATCCCTTCGGG + Intronic
927959955 2:27234971-27234993 CCTTCCCAGATCACCCCTTTTGG - Intronic
929424012 2:41825683-41825705 CCATCCCACATCACCCTTTATGG + Intergenic
930541361 2:52711153-52711175 CATGCCAACTTCTCTCCTTAGGG + Intergenic
931463554 2:62468137-62468159 CCTTTCCACTTCACCCCTGCTGG + Intergenic
935688951 2:105713160-105713182 CCTTCCAATTTCATCATTTACGG - Intergenic
936794619 2:116190103-116190125 ACTTCCAAATTCACTCTTTAAGG - Intergenic
939629042 2:144513068-144513090 CATCCCAACTTCACCTCTCAGGG + Intronic
941521327 2:166547943-166547965 CCTTTCAACTTGTCCCCTTTTGG + Intergenic
941743811 2:169065121-169065143 CCCTCCAACCTCCCCCCTTTTGG + Intronic
941785321 2:169491691-169491713 CTTTCCCCCTTCTCCCCTTAGGG + Intronic
942207225 2:173631230-173631252 CTTTCCAACTTCAGGCTTTATGG - Intergenic
942951214 2:181724010-181724032 CCATCCAACTAAACCCCTGAAGG + Intergenic
945927002 2:215816135-215816157 CTTTCCAACTTTCCCCCTCATGG + Intergenic
945988358 2:216372198-216372220 CCTTCCAGCACCACCCCTTTGGG - Intergenic
1169567325 20:6869274-6869296 CCCTCCAACTTCTGCCCTTTCGG - Intergenic
1173289596 20:41702751-41702773 CCTTCCAGATACTCCCCTTAAGG + Intergenic
1173736486 20:45365152-45365174 CCTTACTACTTCACCCTTAAAGG - Intronic
1175334885 20:58189049-58189071 CTTTCCAAATTCCCCCCATAGGG - Intergenic
1176154645 20:63612462-63612484 CCTTCCCAGCTCACCCCTTGTGG - Intronic
1178488741 21:33034604-33034626 GCTTCCAAGATCACCCATTATGG - Intergenic
1179263276 21:39777564-39777586 CCTTCCATCTTCACCATTTTTGG + Intronic
1181185453 22:21100251-21100273 CCTTCCAAATTAACCCCTGAAGG - Intergenic
1182688231 22:32137146-32137168 CCATGCCACTTCACTCCTTAGGG - Intergenic
1182743079 22:32583002-32583024 TCTTCCAGCTTCACCCCTGGAGG + Intronic
1183050931 22:35260413-35260435 CCTTCTACCTGCACCCCTTTTGG + Intronic
953420902 3:42752470-42752492 CCTTCCAACTTCAGCTCTCCCGG + Intronic
954799185 3:53177359-53177381 CCTTCTAAATTGACCCCTTGGGG - Intronic
955338482 3:58106659-58106681 CCTTCCACCTCCACCCCCTAGGG + Exonic
956282449 3:67571887-67571909 CCTTCCATTATCACCACTTATGG + Intronic
956320686 3:67993028-67993050 TCTTCCATCTGCACCCCTGATGG - Intergenic
956713139 3:72055948-72055970 ACTTCCAACTTCATCCTTCATGG + Intergenic
962006078 3:131351422-131351444 CCTCCCAACATCACCACTTTGGG + Intergenic
967064430 3:185902300-185902322 CCTCCCAGCTTCACCATTTAGGG + Intergenic
967065772 3:185913981-185914003 CCTGCCAACTTCACCTTCTAAGG + Intergenic
968434697 4:578444-578466 CCTTCCACCCTCACCCTTTAGGG - Intergenic
975756594 4:77577849-77577871 CCTTCAGACTTTACCCCTTTCGG + Intronic
979291613 4:118984636-118984658 CCTTCCAGCTTCACCTCAGATGG + Intronic
980681533 4:136168716-136168738 ACTTCCAATTTCAGCCCTTGGGG - Intergenic
982231536 4:153212382-153212404 CCTTCCATCTTCCCACCTTTTGG - Intronic
982321671 4:154083238-154083260 CCTTCCTAATTCACCCATTTGGG - Intergenic
982564628 4:156971789-156971811 CCTTCCCTCTTCACCCCGTGCGG - Intergenic
983263641 4:165484893-165484915 CTTTCCAAATTCAAGCCTTAGGG + Intronic
983785557 4:171725714-171725736 CCTCCCAACTTCCACCCTCAAGG - Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
987788902 5:22538088-22538110 CCTTCCAACATCAGTCCCTAAGG - Intronic
989722672 5:44548237-44548259 CTTTGCAATTTCACTCCTTATGG + Intergenic
992816929 5:80451199-80451221 CCTTCCAATTTTTCTCCTTACGG - Intronic
993197357 5:84765315-84765337 CCTGCAAACCTCACCACTTAGGG - Intergenic
993462010 5:88194141-88194163 CCTTCCCACTTCCCCTCTTTTGG + Intronic
995864067 5:116672538-116672560 CATTCCATCTTCTTCCCTTAAGG - Intergenic
999269926 5:150290809-150290831 CCTGCCAACTTCAACTCTTCAGG + Intergenic
1003161521 6:3638634-3638656 TCTTCCATCTTCATCCTTTAGGG - Intergenic
1004345771 6:14847925-14847947 CCCTCCCACTTCACCCCTCCAGG + Intergenic
1005412753 6:25567503-25567525 CCTTCCAAATTCAGCCCTTGTGG + Intronic
1007036458 6:38678794-38678816 TCTTCCCACTTCATCCCTCAGGG - Intronic
1008551379 6:52635232-52635254 CCTTCCTGCTTCCCCGCTTAAGG + Intergenic
1008614620 6:53214458-53214480 CATCCCAACTTCACCCCCTGTGG + Intergenic
1009803252 6:68569456-68569478 CCAGCCAACATCACACCTTATGG - Intergenic
1011746144 6:90409683-90409705 CCTGCCCACTTCACCTCTCAGGG - Intergenic
1012404976 6:98885876-98885898 CCTCCCAACTTGATCCCTTGTGG + Intronic
1015449508 6:133348815-133348837 CCTTCTAACTTGTCTCCTTATGG + Intronic
1018811963 6:167304941-167304963 CCTGCCACCTTCTCCCCTCAAGG + Intronic
1020263917 7:6547781-6547803 CCTTCCAAATTAACCCCCTCAGG - Intronic
1023172608 7:37404282-37404304 CCTTCCACCTTCACTCCGTGTGG + Intronic
1027141685 7:75662061-75662083 CCCTCCACCTTCACCCCTTGTGG - Intronic
1029304333 7:99607598-99607620 CCTCCAAACTTCACCCCCTGTGG - Intronic
1030012644 7:105186341-105186363 CCTCCCAACTTTGCCCCTTTTGG + Intronic
1032885166 7:136129663-136129685 CATTCCAACCTCACATCTTACGG - Intergenic
1033507438 7:142019529-142019551 CTTTCCAACTTCCCCATTTATGG + Intronic
1033926106 7:146462426-146462448 CCTTCTAACTTCACACATAAAGG + Intronic
1039188642 8:34946630-34946652 CCTTCCAAGCTCAGCCATTAAGG + Intergenic
1039373187 8:37007697-37007719 CCTTCCAAATTCCCCACATAGGG + Intergenic
1044642499 8:94398592-94398614 CCTACCATCTTCAGCCCTTTTGG - Intronic
1046500386 8:115069233-115069255 CCTTTCAACTTGACACATTATGG + Intergenic
1047973940 8:130111127-130111149 CCTCCCACCTTGACCCCTCAAGG - Intronic
1048980428 8:139700981-139701003 TCTTCCATCTTCAACCCTAAAGG + Intronic
1049176086 8:141193532-141193554 CCTTCCAATTTCTCCCTTTTCGG - Intronic
1049295723 8:141835441-141835463 CCTTCCAAGGTCACACCTCAAGG - Intergenic
1050941918 9:11471428-11471450 CCTGCCACCTTGACCCCTTCCGG + Intergenic
1052103780 9:24485572-24485594 CCTTTCAACTTCTACCTTTATGG + Intergenic
1058667656 9:107335535-107335557 CCTTCTAGCTGCACCCCATAAGG + Intergenic
1060963783 9:127700300-127700322 CCTCCCACCCACACCCCTTATGG + Intronic
1062653202 9:137589207-137589229 CCTTCTAACTCCACCCATGATGG - Intronic
1188588202 X:31802577-31802599 CCTTCCCACCTCACCCCTGCTGG - Intronic
1192767184 X:74152670-74152692 CCTTCCAACCTCCACCCTCAAGG - Intergenic
1193649742 X:84115943-84115965 CCTTTTAACTTCTCCCCTTTTGG - Intronic
1194522167 X:94932201-94932223 CCTGCAAACTTCACCACTGAGGG - Intergenic
1197047357 X:122013807-122013829 TCTTACAACTTCCTCCCTTAAGG + Intergenic
1197369010 X:125602512-125602534 ACTCCCAACTTCTCCCCTTTTGG - Intergenic
1201235082 Y:11901494-11901516 CCTCCCACCTTCACCCTTTTTGG - Intergenic