ID: 1146993031

View in Genome Browser
Species Human (GRCh38)
Location 17:37292914-37292936
Sequence CGGCACTACCCGTGCAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 22}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146993029_1146993031 -4 Left 1146993029 17:37292895-37292917 CCAATAAGTACTTCAGTGCCGGC 0: 1
1: 2
2: 8
3: 6
4: 54
Right 1146993031 17:37292914-37292936 CGGCACTACCCGTGCAAAACAGG 0: 1
1: 0
2: 0
3: 0
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146993031 Original CRISPR CGGCACTACCCGTGCAAAAC AGG Intronic
918144815 1:181746251-181746273 AGGCACTGCCAGTGCAAAAGGGG + Intronic
1067972393 10:50987668-50987690 TGGCAATACCTGTGAAAAACTGG - Intergenic
1073713341 10:106071543-106071565 CAGCACTATCCCTGCAAGACAGG + Intergenic
1095921844 12:47539629-47539651 CGGCTCTTCCCATGCAAACCTGG - Intergenic
1112435141 13:99386596-99386618 TGGCATTACCTGTGCAAACCTGG + Intergenic
1119385748 14:74257359-74257381 CTGCAGTTCCCGCGCAAAACTGG - Intronic
1146993031 17:37292914-37292936 CGGCACTACCCGTGCAAAACAGG + Intronic
1152432074 17:80254078-80254100 CGGGACTGCCCGGGCAGAACGGG - Intergenic
1167430829 19:49453474-49453496 CGGGACTCCCCGCGAAAAACCGG - Intronic
947601263 2:231451994-231452016 CTGCACAACCCCTGCAAAAGGGG - Intergenic
953080149 3:39609001-39609023 GGTCTCTACCTGTGCAAAACTGG - Intergenic
967979950 3:195059747-195059769 CGGCACGGCGCGTGCAAAAGGGG - Intergenic
1011595034 6:89008016-89008038 CGGGACTACAGGTGCACAACTGG + Intergenic
1012229816 6:96747647-96747669 CAGCACTATCTGTGCAAGACAGG + Intergenic
1020841122 7:13219162-13219184 AGGCACTAGCCATGTAAAACTGG - Intergenic
1023534448 7:41193560-41193582 CGACACCACGCGTGAAAAACTGG + Intergenic
1028371610 7:90098821-90098843 CGGTACTACCCGTGAAAGATGGG + Intergenic
1033245931 7:139716269-139716291 CGGCACTCTCCGTGCTCAACCGG + Exonic
1035382578 7:158449059-158449081 CGGCACCACCTGTGGACAACAGG + Intronic
1041571091 8:59337604-59337626 TGGCACTGCCCGGGCAAAGCAGG - Intergenic
1052303610 9:26981007-26981029 CGGCACTATCTGTGAGAAACAGG - Intronic
1192583267 X:72301933-72301955 AGGCAGGACCCCTGCAAAACTGG - Exonic
1193256103 X:79350963-79350985 CTTCTCTACCCATGCAAAACTGG - Intergenic