ID: 1146996938

View in Genome Browser
Species Human (GRCh38)
Location 17:37329342-37329364
Sequence CCTAGCAGGTAGAAGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146996932_1146996938 16 Left 1146996932 17:37329303-37329325 CCTCAACCTAACTCTTACTCACT 0: 1
1: 0
2: 0
3: 13
4: 214
Right 1146996938 17:37329342-37329364 CCTAGCAGGTAGAAGTGGCCAGG 0: 1
1: 0
2: 1
3: 11
4: 192
1146996934_1146996938 10 Left 1146996934 17:37329309-37329331 CCTAACTCTTACTCACTAGGTCT 0: 1
1: 1
2: 1
3: 7
4: 118
Right 1146996938 17:37329342-37329364 CCTAGCAGGTAGAAGTGGCCAGG 0: 1
1: 0
2: 1
3: 11
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146996938 Original CRISPR CCTAGCAGGTAGAAGTGGCC AGG Intronic
902447899 1:16478677-16478699 CCTACCAGGTAGAAGAGGCCAGG + Intergenic
902467800 1:16628901-16628923 TCTACCACGTAGAAGAGGCCAGG + Intergenic
903754853 1:25653592-25653614 CCTAGTAGGTATCAGTGTCCAGG + Intronic
904808188 1:33146355-33146377 CCTAGCAGGTCACAGAGGCCTGG + Exonic
904960145 1:34326307-34326329 CCTAGCTGGCATAAGTGCCCTGG + Intergenic
905013079 1:34760053-34760075 CCTAGCACCTAGCACTGGCCTGG - Intronic
907428458 1:54396471-54396493 CTTAACAGGGAGAAGTGGCAGGG - Intronic
908102943 1:60810047-60810069 CCTAGCAGGTAAAAAGGGGCAGG + Intergenic
908606455 1:65802358-65802380 ACAGGCAGGTAGAGGTGGCCAGG + Intronic
909962786 1:81868143-81868165 CCTAGCACATAGCAGTGGCACGG - Intronic
910135406 1:83962654-83962676 CCTTACAGGTATACGTGGCCTGG + Intronic
910444345 1:87285243-87285265 CATAGAAGATAGAAGTGGACTGG - Intergenic
913328576 1:117649157-117649179 CTTAGCTGGTAGACCTGGCCAGG + Intergenic
920043014 1:203116156-203116178 CCTGGCAGGTGGAAGTTGGCGGG + Intronic
922109549 1:222543785-222543807 CCGAGCAGGTAGGAGTGGTGTGG - Exonic
1064032038 10:11888893-11888915 CGAAGAAGGTAGAATTGGCCAGG - Intergenic
1065206727 10:23364112-23364134 CCTTGCAGGTAGGGGTAGCCAGG - Intergenic
1067040822 10:42952249-42952271 CAGAGAAGGTAGAACTGGCCGGG - Intergenic
1068322820 10:55441979-55442001 CCCAGCAGGTGGAAGAGGCAAGG + Intronic
1068725392 10:60295387-60295409 CCGAGCAGTTAGAAATGGCATGG + Intronic
1070644684 10:78193570-78193592 CCTTGCAGGTAGGTGTGGCCAGG - Intergenic
1070949403 10:80418840-80418862 CCTAGCTGGCAGAAGAAGCCAGG + Intronic
1073314509 10:102569519-102569541 CCAAGCAGGTAGAAATGTCCTGG + Intronic
1074446792 10:113527336-113527358 CCAAGCAGCAGGAAGTGGCCTGG - Intergenic
1074903599 10:117840569-117840591 CCTGGCAGCCAGGAGTGGCCAGG - Intergenic
1074903799 10:117842535-117842557 CCTGGCAGCCAGAAGTAGCCAGG - Intergenic
1075088210 10:119428230-119428252 CCTAGCTGGTAGCGGTGGGCTGG - Intronic
1076769296 10:132654336-132654358 CCTGGCAGGTAGGAGGGTCCAGG + Intronic
1081906927 11:46676077-46676099 CCTGGCAGGTGGAAATGGCCTGG + Intergenic
1084656370 11:70522068-70522090 CCTAGGAGGTGGAGGTAGCCTGG - Intronic
1085409850 11:76284474-76284496 CATAGCTGGTAGAGGTGGGCAGG - Intergenic
1085960684 11:81458032-81458054 ACTAGCAGGTGAAAGGGGCCTGG - Intergenic
1086036437 11:82420793-82420815 TCTAGCTGGTAGAAGTGGGATGG - Intergenic
1088693774 11:112349171-112349193 CCTGGCAGGCAGCAATGGCCTGG + Intergenic
1090783798 11:130030528-130030550 CCTTGCAACTAGCAGTGGCCAGG + Intergenic
1092970516 12:13689741-13689763 CCAAACAGGTAGAAGGGACCAGG - Intronic
1093442528 12:19215400-19215422 TCTAGCATGCAGAAATGGCCAGG + Intronic
1094160360 12:27383598-27383620 CATACCAGGCAGAAGTGGGCTGG - Intronic
1096323249 12:50634181-50634203 ACTTCCAGGGAGAAGTGGCCAGG + Intronic
1096777655 12:53973920-53973942 CCCAGTAGGTAGCAGCGGCCGGG + Exonic
1098219349 12:68252384-68252406 GCTAGCAGGAAGAAGTGTCTTGG - Intronic
1102557288 12:113735554-113735576 CATAGCAGGCAGAATTGTCCAGG - Intergenic
1103895508 12:124270558-124270580 GCTAGAAGGTAGAAGTTGCATGG + Intronic
1104509251 12:129361028-129361050 CTTTGCAGGTGGAAGTGTCCCGG - Intronic
1108672815 13:52709040-52709062 CTTTGCAATTAGAAGTGGCCAGG + Intronic
1109952578 13:69518400-69518422 CCTAGCTGCTAGATGTGGCCAGG + Intergenic
1114588852 14:23840714-23840736 CATAGCAGGTACAGGTAGCCTGG + Intergenic
1115171567 14:30513919-30513941 CCTAGCGGGTAGAAATGGGGTGG + Intergenic
1117404873 14:55392289-55392311 CCCAGTAGGTATATGTGGCCTGG + Intronic
1119321121 14:73731080-73731102 CCTAGCAGGGAGAAGTAGGAGGG - Intronic
1119711690 14:76827233-76827255 CAGTGCAGGTAGCAGTGGCCTGG - Intronic
1120768684 14:88355695-88355717 CCTCCCAAGTAGAAGTAGCCAGG + Intergenic
1121164378 14:91777781-91777803 CTTAGCTGGTAGAAGGGGCAAGG + Intronic
1121783220 14:96635971-96635993 CCTAGCTGGGTGACGTGGCCAGG + Intergenic
1122314386 14:100817244-100817266 CCTGGCAGGGCGAAGTGGGCAGG + Intergenic
1122416248 14:101550991-101551013 CCTGGCAGGCAGAAGTAGCAGGG - Intergenic
1122787399 14:104170125-104170147 CCTAGCGGGAAGGAGTGGCGTGG - Intronic
1123492830 15:20796272-20796294 CCGAGTAGGTAAAAGTGGGCAGG + Intergenic
1123549331 15:21365368-21365390 CCGAGTAGGTAAAAGTGGGCAGG + Intergenic
1125679698 15:41523095-41523117 CCTAGCAGGCAGCAGTGGGGTGG - Intronic
1127527787 15:59810944-59810966 CCTGGGAGGTAGAAGTTGCAGGG + Intergenic
1127885330 15:63194079-63194101 CCTAACAGGAAGAAGGGGGCAGG - Intronic
1128391860 15:67187651-67187673 CCTGGCAGGCAGGAGGGGCCGGG + Intronic
1128661350 15:69503208-69503230 CCTAGCAGCTAGTAGGGGGCAGG + Intergenic
1128786021 15:70398024-70398046 CCCAGCAGGCAGCAGCGGCCAGG - Intergenic
1129991647 15:79969462-79969484 GCTATCAGCTAGAAATGGCCAGG + Intronic
1130879650 15:88044205-88044227 GCTAGTAGGTAGCAGTGTCCTGG + Intronic
1202957664 15_KI270727v1_random:92584-92606 CCGAGTAGGTAAAAGTGGGCAGG + Intergenic
1134093473 16:11403867-11403889 CCGGGCAGGGAGAAGGGGCCAGG - Intronic
1136050755 16:27648215-27648237 CCTAGGAGGTAGAGGTTGCAGGG + Intronic
1136183719 16:28572693-28572715 CTTTGCAGGTAGGAGTGGGCAGG + Intronic
1137585862 16:49663856-49663878 CCAAGCAGGTGGTGGTGGCCAGG - Intronic
1137761685 16:50945981-50946003 CCTTGCAGGTAATTGTGGCCAGG + Intergenic
1137923906 16:52521384-52521406 CAGAGAAGGTAGAACTGGCCAGG - Intronic
1138156969 16:54714962-54714984 TCTAGCAGGTGGCACTGGCCAGG - Intergenic
1138441074 16:57035318-57035340 TCTGCCAGGTGGAAGTGGCCAGG - Intronic
1140575263 16:76160397-76160419 TGTAGAAGGTAGAAGTGGCAAGG - Intergenic
1142774649 17:2127219-2127241 GCTAGAAAGTAGAAGTTGCCAGG + Intronic
1144368524 17:14568437-14568459 CCCAGAAAGTAGAAGTGGGCAGG - Intergenic
1144694200 17:17290540-17290562 TCTTAAAGGTAGAAGTGGCCGGG - Intergenic
1145390928 17:22454783-22454805 CCTAGCAGGTAGCAGTAACTCGG - Intergenic
1146308217 17:31746848-31746870 CCAAGCAGGAAGAAGGGGGCTGG - Intergenic
1146996938 17:37329342-37329364 CCTAGCAGGTAGAAGTGGCCAGG + Intronic
1151197972 17:72445449-72445471 CCTAGCAGCTAAGTGTGGCCAGG + Intergenic
1151574823 17:74947497-74947519 CCTGGAGGGTAGAGGTGGCCAGG + Intronic
1151767487 17:76139883-76139905 CCTGGCAGGTAGAGGAGGCACGG - Exonic
1153808782 18:8733768-8733790 CCTCGCAGGTGGGAGTGGGCCGG + Intronic
1160806191 19:993256-993278 CCTAGGAGGAGGCAGTGGCCGGG - Intronic
1162731721 19:12722309-12722331 CCTGGCAGCTAGAACGGGCCGGG - Intronic
1163123015 19:15229302-15229324 CCCAGGAGGTAGAGGTTGCCAGG + Intronic
1163716263 19:18874160-18874182 CCAAGAAAGCAGAAGTGGCCGGG - Intronic
1163794599 19:19330053-19330075 CCCAGGAGGCAGAAGTGGCAGGG - Intronic
1166749108 19:45156318-45156340 CAGAGCAGGCAGGAGTGGCCTGG - Intronic
935818566 2:106870394-106870416 TCTAACAAGAAGAAGTGGCCTGG - Intronic
936061518 2:109298160-109298182 CCCAGCTGGTAGAAGTAGCTGGG + Intronic
936732981 2:115406113-115406135 ACTAGCAGTTAGAAGTAACCAGG + Intronic
938557591 2:132439789-132439811 CCTAGGAGCTAGTGGTGGCCAGG + Intronic
938669240 2:133571387-133571409 CCTAGTAGGTAGAGGTGGTGAGG - Intergenic
938934726 2:136117956-136117978 CCGAGCGGGCAGAAGCGGCCAGG - Intronic
941036265 2:160572179-160572201 CCTTGCAGTTAGATGTAGCCAGG + Intergenic
942602723 2:177657937-177657959 CCAATCAGCTAGAACTGGCCAGG + Intronic
943738903 2:191389630-191389652 CTTTGCAAGTAGATGTGGCCAGG - Intronic
944218187 2:197276197-197276219 CCTGGGAGGTAGAAGTTGCAGGG + Intronic
944412968 2:199459851-199459873 CCTACCAGGTAGATGCGGCGAGG - Intronic
946599041 2:221339333-221339355 CCCAGCAGGGAGCAGTGACCTGG + Intergenic
947853734 2:233309157-233309179 CCAAGGTGGTAGAAGTTGCCAGG + Exonic
948271222 2:236674563-236674585 CATAACAGGTAGAAGAGACCTGG - Intergenic
948422951 2:237871619-237871641 CCCAGAGGGTAGAAGTGCCCAGG - Intronic
1169276530 20:4236852-4236874 TCTAGAAGGTGGAAGGGGCCGGG + Intronic
1169631279 20:7635219-7635241 CCTGGGAGGCAGAAGTGGCAGGG - Intergenic
1170463157 20:16598122-16598144 CCTAGGAGGCAGACGTTGCCTGG + Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1173673249 20:44812216-44812238 CCTTGAAGGTGGAAGGGGCCAGG - Intergenic
1174444663 20:50582587-50582609 CCTCGGAGGTTGAAGTTGCCGGG + Intronic
1178250769 21:31001220-31001242 CCTGGGAGGTAGAAGTTGCAGGG + Intergenic
1178808638 21:35860649-35860671 GCTAGCAGGTAGGAGAGGCGAGG + Intronic
1181667409 22:24407651-24407673 CCTTGCAGGGAGAGGGGGCCAGG - Intronic
1182317539 22:29458017-29458039 ACTGGCAGATAGAAGAGGCCCGG + Intergenic
950540859 3:13611818-13611840 CCTTGCAGCTAGATGTAGCCAGG - Intronic
952111631 3:30130427-30130449 CCAAGCAAGTAAAAGTGGGCAGG - Intergenic
952846392 3:37691140-37691162 CCTGGCAGCTGGAAGTGGGCTGG + Intronic
952872383 3:37912271-37912293 CCTGGAAGGTAGGAGTGGCCGGG - Intronic
953813885 3:46137359-46137381 CCTAGGAGGCAGAAGTGCCGGGG - Intergenic
954176942 3:48852220-48852242 CCTGGCATGTAGAGGTGGTCAGG - Intergenic
955324996 3:58003176-58003198 CCTAGCAGGGAGGAGGGCCCTGG + Intergenic
955485917 3:59434218-59434240 ACTGGAAGCTAGAAGTGGCCAGG - Intergenic
955902298 3:63770056-63770078 CCTAGGAGGTAGAAGGGGCAAGG - Intergenic
959154742 3:102653210-102653232 CCCAACAGTTTGAAGTGGCCCGG - Intergenic
960003949 3:112762813-112762835 CCTAGAAGGGAAAAGTGGTCAGG - Intronic
960081735 3:113548735-113548757 AATGGCAGGGAGAAGTGGCCAGG - Intronic
961254555 3:125537082-125537104 CCTAGGAGGTGGAAGTTGCAGGG + Intronic
962122453 3:132576331-132576353 CCTGGCAGGTATCAGGGGCCTGG + Intronic
962733679 3:138305187-138305209 CACAGCAGGCAGAGGTGGCCAGG - Intronic
967930512 3:194687217-194687239 TGCAGCAGGTAGAGGTGGCCCGG - Exonic
969334392 4:6499045-6499067 TCTGGCAGGCAAAAGTGGCCAGG + Intronic
970616472 4:17772812-17772834 CCTGGCAGGCAGAACTGCCCTGG - Intronic
971347424 4:25823906-25823928 CCTAGCAGGTGCACCTGGCCAGG + Intronic
971553767 4:27985963-27985985 TCTATCAGGTAAAAATGGCCAGG - Intergenic
973818983 4:54645948-54645970 CCCAGCAGGGAGAAGGGGACAGG - Intergenic
977294298 4:95193858-95193880 CCGAGCAGGTGGGAGAGGCCGGG - Intronic
979084619 4:116391053-116391075 CCCATCAGGTGGAAGTGGACAGG - Intergenic
981871867 4:149496592-149496614 CCTAGAAGGTAGATGAGGCAAGG + Intergenic
983150371 4:164271442-164271464 TCTAGAAGGTAGAAAAGGCCAGG + Intronic
983471939 4:168167837-168167859 CTTAGAAGGTAAAACTGGCCGGG + Intronic
984586958 4:181575878-181575900 CCTTGCAGTTAGACATGGCCAGG + Intergenic
987220994 5:15790454-15790476 CTTAGCAGGAAGAATTCGCCAGG - Intronic
989524193 5:42434279-42434301 CCTAGCAGAAAGGAGTGGCTTGG - Intronic
992422084 5:76616553-76616575 GTTAGAAGGTAGAGGTGGCCTGG + Exonic
993592862 5:89816848-89816870 CCTTGCAGCTAGAGGTGGCCAGG + Intergenic
996074196 5:119170308-119170330 CCTAACAGGAAAAAGTGGACTGG + Exonic
997895376 5:137711476-137711498 CCCAACAGGGAGAAGTGGACAGG + Intronic
998109090 5:139487360-139487382 ACCAGAAGGTAGAAGTGGCAAGG - Intergenic
1001842464 5:174890378-174890400 CCTAGCAGGTAGAAACAGCCAGG + Intergenic
1003896627 6:10614329-10614351 CTAAGAAGGTAGAAGAGGCCGGG + Intronic
1003904829 6:10689558-10689580 CCTTGCAGCAAGATGTGGCCAGG + Intronic
1004927016 6:20425691-20425713 TCTAAAAGGTAGAAGGGGCCGGG - Intronic
1006385349 6:33727664-33727686 CCTAGCAGTTGGAAGGGGCCAGG - Intronic
1013372453 6:109482949-109482971 CCCAGCAGGGAGAGGTGGCGCGG + Intronic
1013489712 6:110634290-110634312 CCTAGGAGGTAGAGGTTGCAGGG - Intronic
1015319043 6:131850848-131850870 TTTAGCAGGTAGAAGAAGCCAGG + Intronic
1016317323 6:142805239-142805261 GCTGGCTGGTACAAGTGGCCAGG - Intronic
1016360425 6:143261425-143261447 CCTAACAGCTACCAGTGGCCAGG - Intronic
1016423611 6:143911596-143911618 CCTAGAAGGTAGAAGAGACTGGG - Intronic
1016949650 6:149566943-149566965 CCGAGCAGGCACAAGTGGCCTGG - Intronic
1016987851 6:149908634-149908656 CCTAGGAGGAAAAAATGGCCTGG + Intergenic
1018862578 6:167721728-167721750 CCTAGCAGGTAGCAGCGGACAGG - Intergenic
1019710586 7:2516538-2516560 CCTGGCAGTTAGAGGAGGCCTGG + Intronic
1022480415 7:30739894-30739916 CCTGGCAGGCAGTAGGGGCCTGG - Intronic
1022823754 7:33987609-33987631 CATGGCAGGTATAAGTGACCAGG + Intronic
1022943090 7:35257926-35257948 CCAAGCTGCAAGAAGTGGCCGGG + Intergenic
1024049217 7:45608371-45608393 CCATGCAGCTAGATGTGGCCAGG - Intronic
1024206946 7:47171476-47171498 CCTAGGAGGTAGAGGTTGCAGGG + Intergenic
1024354467 7:48400279-48400301 CCTAGCAGGTGGCAGGTGCCAGG + Intronic
1024766721 7:52668869-52668891 CCCATCTGTTAGAAGTGGCCTGG + Intergenic
1025116092 7:56259751-56259773 CCTAGCATGTACAAGTGGGAAGG - Intergenic
1026025608 7:66741293-66741315 CCTAGGGGGCAGAAGTGTCCCGG + Intronic
1026450427 7:70524518-70524540 CCTGGCAGAAAGAAATGGCCTGG + Intronic
1026975069 7:74492786-74492808 CCCAGGAGCTAGAAGAGGCCAGG - Intronic
1028472517 7:91220420-91220442 CCTTACAGGTGGATGTGGCCAGG + Intergenic
1029104283 7:98162865-98162887 GCTGGGAGGTGGAAGTGGCCAGG + Intronic
1029726646 7:102410436-102410458 CCTTGCAGGTAGACGTTTCCAGG + Intronic
1030096289 7:105903115-105903137 ACTAGGAGGTAGCTGTGGCCAGG + Intronic
1033790791 7:144790570-144790592 CAGAGCAGGAAGAAGTGGCAGGG + Intronic
1036426264 8:8647482-8647504 CCTAGCAGGCAGAAGTGTTTTGG - Intergenic
1036650991 8:10643935-10643957 TCAAGCAGGTAGACATGGCCAGG + Intronic
1038672895 8:29596697-29596719 ACTGTAAGGTAGAAGTGGCCGGG + Intergenic
1039775528 8:40732522-40732544 CCTACCAGGGAGAAGAGTCCTGG - Intronic
1039987710 8:42461906-42461928 CCTAGAATACAGAAGTGGCCAGG + Intronic
1044608511 8:94068907-94068929 ACAAAAAGGTAGAAGTGGCCAGG - Intergenic
1055500497 9:76898092-76898114 ACTAGCAAGTAAAAGTGGCGGGG + Intronic
1056419575 9:86410541-86410563 CCTAGGAGGTGAATGTGGCCGGG - Intergenic
1057596606 9:96419434-96419456 CCTACCCGCTAGATGTGGCCTGG + Intergenic
1057885202 9:98824475-98824497 CCTTGCAGCTACACGTGGCCAGG - Intronic
1059497151 9:114719283-114719305 CCTAGCAGTGAGAGGTGCCCAGG - Intergenic
1060927504 9:127465307-127465329 CCCAGCAGCTACAAGTGGCTGGG - Intronic
1061188496 9:129068947-129068969 CCAAGCAGGAAGATGGGGCCAGG - Intronic
1061444586 9:130630742-130630764 CCCAGCAGATCGAGGTGGCCAGG + Exonic
1061550019 9:131329009-131329031 CCTGGCAGGTATCAGTGGGCTGG - Intergenic
1187363490 X:18648625-18648647 CTTTGCAGTTAGAAGTGCCCAGG + Intronic
1187447383 X:19371691-19371713 CCCACCAGGGAGAAGGGGCCAGG - Intronic
1190361256 X:49650960-49650982 AAAAGCAGCTAGAAGTGGCCAGG - Intergenic
1195223131 X:102765650-102765672 CCTACCAGGTACAAGCAGCCCGG + Intergenic
1198454157 X:136798918-136798940 CAAAGCAGGTAGGAGGGGCCAGG + Intergenic
1199264849 X:145818099-145818121 CCTCGCAAGGAGAGGTGGCCGGG - Intronic
1199820222 X:151438177-151438199 AACAGCAGGTGGAAGTGGCCTGG + Intergenic