ID: 1147000306

View in Genome Browser
Species Human (GRCh38)
Location 17:37358046-37358068
Sequence AAGTAGAAACAGAATCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 768
Summary {0: 1, 1: 0, 2: 5, 3: 120, 4: 642}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147000304_1147000306 9 Left 1147000304 17:37358014-37358036 CCACACATTAGGAAATTACTGAA 0: 1
1: 0
2: 1
3: 18
4: 298
Right 1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG 0: 1
1: 0
2: 5
3: 120
4: 642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147000306 Original CRISPR AAGTAGAAACAGAATCAGGA AGG Intronic
900209668 1:1448179-1448201 AAGTACTTACAGAACCAGGAAGG - Intergenic
900219656 1:1500999-1501021 AAGTACTTACAGAACCAGGAAGG - Intergenic
900764789 1:4497463-4497485 CAGTGGAAACAGAATCAAGTTGG - Intergenic
901266828 1:7917248-7917270 AAGTAGAAAAAGAAGGTGGAGGG + Exonic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
902953614 1:19908350-19908372 AAATAACATCAGAATCAGGAAGG - Exonic
903583274 1:24388271-24388293 AAGTGGAGACAGAAACAGGGAGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904393664 1:30203650-30203672 AAGTAGACACAGAGTCAAAAAGG - Intergenic
904571268 1:31467551-31467573 AAGTACTTACAGAACCAGGAAGG - Intergenic
904946978 1:34206557-34206579 ACATAGAAACAGAAACAGGCAGG + Intronic
905479103 1:38248973-38248995 AAGCAGAAACAGAAACAAAATGG - Intergenic
905567758 1:38979408-38979430 AAGTACTTACAGAATTAGGAAGG - Intergenic
905751483 1:40468406-40468428 AAGAAGAAAAAGAAACTGGATGG + Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
906507552 1:46391446-46391468 AAGCACTTACAGAATCAGGAAGG - Intergenic
906516722 1:46443360-46443382 AAGAAGAAAAAGAAGAAGGAGGG - Intergenic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906689269 1:47781908-47781930 AAGTACAGAGAGAACCAGGATGG - Intronic
906767052 1:48443143-48443165 AAGTACTTACAGAATCAGGAGGG + Intronic
906848221 1:49218044-49218066 GAGCAGAAACAGAATCAGTAGGG - Intronic
906885678 1:49644708-49644730 AACTAGATAGAAAATCAGGAAGG + Intronic
907073872 1:51561815-51561837 AAGTAGAAAGAGCCTCAGGCTGG - Intergenic
907799421 1:57750091-57750113 AAGGAGAGAAAGAATCAGGTGGG - Intronic
907847202 1:58219616-58219638 AAGTAGAAATTGACTAAGGAAGG - Intronic
908300910 1:62760353-62760375 AAGTACTTACAGAATCAGGAAGG + Intergenic
908918260 1:69158043-69158065 CAGAAGAAACAGCTTCAGGAAGG - Intergenic
909162017 1:72164035-72164057 AAGTAAAAGCAGAAACAAGAAGG + Intronic
909252649 1:73378847-73378869 AAGCAGAAACAGAATAAAAAGGG + Intergenic
909661016 1:78082150-78082172 ATGTGGAAACAGGCTCAGGAAGG + Intronic
909684101 1:78326640-78326662 AAATAGAATCAGTATCATGAAGG - Intronic
909779053 1:79520035-79520057 AAGAAGAAAAAGAAGAAGGAAGG + Intergenic
909865310 1:80661226-80661248 AAGAAGCCACTGAATCAGGAAGG - Intergenic
910396950 1:86803094-86803116 AAGTACTTACAGAATCAGGAAGG - Intergenic
911185775 1:94903369-94903391 GAGCAGAAACAGATTCTGGAGGG + Intronic
911299216 1:96152221-96152243 AAGTACTTATAGAATCAGGAAGG + Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911751882 1:101504912-101504934 AAGTACTTACAGAACCAGGAAGG + Intergenic
911912728 1:103655304-103655326 AGGGAGAAACAGAATATGGAAGG + Intronic
911915727 1:103696644-103696666 AGGGAGAAACAGAATACGGAAGG - Intronic
911920140 1:103749442-103749464 AGGGAGAAACAGAATATGGAAGG + Intronic
913610324 1:120504343-120504365 AAATAGAGCCAGAAACAGGAAGG + Intergenic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
913713743 1:121512855-121512877 TAGTACTTACAGAATCAGGAAGG + Intergenic
913984474 1:143552491-143552513 AAATAGAGCCAGAAACAGGAAGG - Intergenic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914460797 1:147882823-147882845 AAGTAGATAAAAAATCAGTAAGG - Intergenic
914580867 1:149017896-149017918 AAATAGAGCCAGAAACAGGAAGG - Intronic
915835993 1:159175150-159175172 AACTAGGAACAGAAACTGGATGG - Intronic
916084162 1:161256432-161256454 AAGTACTTACGGAATCAGGAAGG + Intergenic
916126759 1:161578238-161578260 AGATAGACACAGAATCAGGTAGG - Intergenic
916136678 1:161660078-161660100 AGATAGACACAGAATCAGGTAGG - Intronic
916544535 1:165790405-165790427 AAGTAGACAGAAAATCAGTAAGG + Intronic
917147385 1:171907014-171907036 AAATAAAAACAGAGCCAGGATGG - Intronic
917198170 1:172488327-172488349 AACTAGAATAAGAATTAGGAGGG + Intergenic
917227820 1:172802708-172802730 AAGTACTTACAGAATCAGGAAGG + Intergenic
917676609 1:177324633-177324655 AAGTACTTACAGAATCAGGAAGG + Intergenic
918460308 1:184769730-184769752 AAGTGGAAAGAGAAAGAGGAAGG + Intergenic
918497145 1:185153560-185153582 GAGTAGAAACAGAATTGGAAGGG + Intronic
918847210 1:189632339-189632361 AAATAGAAACAAAATAAGAAGGG - Intergenic
919257277 1:195140771-195140793 AAGTACTTACAGTATCAGGAAGG + Intergenic
919559197 1:199096531-199096553 AAGTACTTACAGTATCAGGAAGG + Intergenic
919905025 1:202072439-202072461 GGGTAGCGACAGAATCAGGAGGG - Intergenic
920124840 1:203685737-203685759 AAGAAGAAACAGACTCAGGGAGG - Intronic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
920762142 1:208794773-208794795 AAGTTAAAAAAGAGTCAGGAAGG - Intergenic
921020180 1:211228046-211228068 AAGTACTTACAGAATCAGGAAGG + Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG + Intronic
922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG + Intronic
922653820 1:227363705-227363727 AAGTGGAAAAAGAATGAGGCCGG + Intergenic
922895529 1:229097177-229097199 AAGAAGAGCCAAAATCAGGAAGG + Intergenic
922904833 1:229166219-229166241 AAGTAGAAAGAGCATCAGGTGGG + Intergenic
922943389 1:229489135-229489157 AAGAAGAAAAAGAAAAAGGAAGG - Intronic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
924252680 1:242150354-242150376 AAGTAGAGAGAAAATCAGTAAGG - Intronic
924500432 1:244633210-244633232 AAGTAGAGAGAAAATCAGTAAGG + Intronic
924597624 1:245461246-245461268 AAGCAGAAGCAGAATCAGTCTGG - Intronic
1063638920 10:7812527-7812549 AAGCAGCAAGAGAATCACGAAGG + Intergenic
1063917526 10:10898706-10898728 AAGTAGACAGGAAATCAGGAAGG + Intergenic
1064011637 10:11741114-11741136 TAGTAGTTACAGAGTCAGGACGG - Intergenic
1064603061 10:17012716-17012738 AAGTACTTACAGAATCAGGAAGG - Intronic
1064825631 10:19396039-19396061 GAGTAGAAACAGAAATAGAATGG - Intronic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1065082918 10:22144951-22144973 AAGTACTTACAGAATCAGGAAGG + Intergenic
1065402140 10:25317528-25317550 AAGAAGAAAACTAATCAGGAAGG - Intronic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1066237143 10:33496494-33496516 AATTAGAAACAGAAACGGAATGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067169012 10:43890117-43890139 AAGTAGAAAGAAAATCAGTAAGG - Intergenic
1068197252 10:53732761-53732783 AAGTACAAAGAAAATCAGTAAGG + Intergenic
1068240908 10:54299826-54299848 AAGTACTTACAGAATCAGGAAGG + Intronic
1068376068 10:56182735-56182757 AAGAAGAAAAAGAAAAAGGAAGG + Intergenic
1068824684 10:61422248-61422270 AAATAGACACAAAATCAGTAAGG + Intronic
1069301831 10:66917380-66917402 AAGTACTAACAGTATAAGGAAGG + Intronic
1069364722 10:67685294-67685316 AAGTACTTACAGAATCAGGAAGG - Intronic
1069835432 10:71305019-71305041 AAGTAGAGACAGAGGAAGGAGGG - Intergenic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1069972548 10:72184700-72184722 AAGTAGATACAAAATCAGTATGG + Intronic
1070110148 10:73478079-73478101 AAGGAGAAACAGAAGCACTAGGG + Intronic
1070437502 10:76407617-76407639 AAGTAAAAAGAGACACAGGAGGG + Intronic
1070485454 10:76926285-76926307 AATTAGAAACAGAAAGAGGCAGG - Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1071283265 10:84122440-84122462 AAGTACTTACAGAATCAGGAAGG - Intergenic
1071835231 10:89411414-89411436 AAATACTTACAGAATCAGGAAGG + Intronic
1071933677 10:90501879-90501901 AAAAAGAAACAAAACCAGGAAGG - Intergenic
1072813596 10:98483314-98483336 AAGTAGAAAAAGAATCACATGGG - Intronic
1073744257 10:106447626-106447648 AAGATGAAATAGAATCAGAAAGG - Intergenic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074613293 10:115041337-115041359 AAGTACTTACAGAATCAGGAAGG + Intergenic
1074813863 10:117130510-117130532 AAGGAGAAACAGCTGCAGGAGGG - Intronic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1074910846 10:117906909-117906931 AAGTATAAACAGAATGATGGAGG + Intergenic
1075846704 10:125550879-125550901 AAGTAGAAATACATCCAGGAAGG - Intergenic
1076333114 10:129686146-129686168 CAGCAGAAACAGAAACTGGAGGG + Intronic
1077436943 11:2546498-2546520 AAGTAGATACAAAATCAGTAAGG - Intronic
1078603494 11:12754763-12754785 AAGGAAAACCTGAATCAGGATGG - Intronic
1078764747 11:14284546-14284568 AGGTAGAAAGAAAATCAGTAAGG - Intronic
1079540924 11:21573750-21573772 AAGTAGAAAGAAAAGAAGGAAGG + Intronic
1079811168 11:25001226-25001248 AAGTACTTACAGAATCAGGAAGG - Intronic
1080107027 11:28521577-28521599 AAATAGAAAGTGAATCTGGAGGG - Intergenic
1080930339 11:36803569-36803591 AAGTAGAAAAGGAAGCAGAAGGG - Intergenic
1081033684 11:38115715-38115737 AAGTACTTACAGAATAAGGAAGG + Intergenic
1081515943 11:43829738-43829760 CACCAGAAACAGAATAAGGAAGG - Intronic
1081966174 11:47171477-47171499 AAGAAGCTACAGAATCTGGAAGG - Exonic
1082068625 11:47920730-47920752 AAGTAGAAAGAGAGCTAGGATGG + Intergenic
1082741445 11:56916037-56916059 TAGAAGAACCAGAACCAGGATGG - Intergenic
1083233598 11:61338297-61338319 ATGTAGAAACAGATTCAGAGAGG - Intronic
1083471204 11:62885267-62885289 CAGTAGAACCAGAATCAGACAGG - Exonic
1083899317 11:65636139-65636161 AGGTAGAAAAGGGATCAGGAGGG - Intronic
1084848046 11:71916263-71916285 AAAGAGAAACAAAATCAGGGGGG + Intronic
1086317904 11:85612508-85612530 AAGTACTTACAGAATCAGGAAGG + Intronic
1086987307 11:93264274-93264296 AAGTACTTACAGAACCAGGAAGG + Intergenic
1087282044 11:96221971-96221993 AAGTAGAAACGGAAACTGGGAGG - Intronic
1087458752 11:98420768-98420790 AAGTACTTACAGAATCAGGGAGG - Intergenic
1087553579 11:99685410-99685432 AAATAGAAAGAAAATCAGAAGGG - Intronic
1087640184 11:100748222-100748244 AAGTACTTATAGAATCAGGAAGG - Intronic
1088500924 11:110481462-110481484 AAGTAGAAAGAGAAAAAGAAAGG + Intergenic
1089175812 11:116548002-116548024 AATTAGAGACAGAGGCAGGAGGG - Intergenic
1089916956 11:122166173-122166195 AAGAAGAAACTGAATTAAGAGGG + Intergenic
1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG + Intergenic
1090522337 11:127492645-127492667 AAGTATGAACAGAATCTTGATGG + Intergenic
1090560923 11:127931072-127931094 ACATAGAAACAGAAACAGAATGG + Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1091126836 11:133107662-133107684 AAATGGAAACTGAGTCAGGAAGG - Intronic
1091332736 11:134743445-134743467 GAGGAGAAACACAGTCAGGAGGG - Intergenic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1092606588 12:10126950-10126972 AAGAAGAAATAGAATGAGGGAGG + Intronic
1092867253 12:12774246-12774268 AAGAAGAAAAAGAACCTGGACGG + Intronic
1092986511 12:13850880-13850902 ATGAAGAAAGAGAATCAGAAAGG - Intronic
1093356595 12:18174670-18174692 AAGTACTTACAGAACCAGGAAGG + Intronic
1093452737 12:19334239-19334261 AAGTAAAGACAGAAACAGGTAGG + Intronic
1093784577 12:23177313-23177335 CAGGAGATACAGAATCAGCAGGG - Intergenic
1093828361 12:23723506-23723528 AAGTAGAAAGAGAATTAAAAAGG + Intronic
1093859826 12:24150959-24150981 ATTTAAAAACAGAATCAGGAAGG + Intergenic
1094319500 12:29170096-29170118 AAGTACTTACAGAATCAGGAAGG - Intronic
1095611108 12:44129011-44129033 AAGTAGAAGAATAATCAGAATGG - Intronic
1095779866 12:46047860-46047882 ATGTAGTAAAAGAAACAGGAGGG + Intergenic
1095881978 12:47147499-47147521 CAGTAGAAATAGAATATGGATGG - Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096435233 12:51585003-51585025 AAGTATAAAGAAAATCAGTAGGG + Intergenic
1099077757 12:78132457-78132479 AAGTATGAAGAGAATCAAGAGGG - Intronic
1099576607 12:84391291-84391313 AAGTACTTACAGAATCAGGAAGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1099956476 12:89355568-89355590 AAGTAAACACAGAAACAAGACGG - Intergenic
1100050636 12:90444866-90444888 AAGTACTTACAGAATAAGGAAGG - Intergenic
1100471365 12:94896319-94896341 AAGCAGAACCAGAATAGGGAAGG + Intergenic
1100797060 12:98193438-98193460 AAGCCAAAACAGAATTAGGAAGG - Intergenic
1101051711 12:100870535-100870557 AAGAAAATAGAGAATCAGGATGG - Intronic
1101220557 12:102634819-102634841 AAGGTAAAACAGAATCATGAAGG + Intergenic
1102606181 12:114069183-114069205 AAGTACTTACAGAACCAGGAAGG + Intergenic
1102749171 12:115277248-115277270 AAGAAGAAAAAGAAGAAGGACGG + Intergenic
1102841610 12:116130891-116130913 AACTAGAAAAATAAACAGGAAGG + Intronic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1103883239 12:124182622-124182644 TACTAGAAACAGAATAAAGAAGG - Intronic
1104094067 12:125540357-125540379 AAGTGGGAAAAGAATCAGCAAGG - Intronic
1104263312 12:127205581-127205603 AAGGAGAAACAGAACCAATAGGG + Intergenic
1104705568 12:130943770-130943792 AAGTAGACAGAAAATCAGTAAGG - Intergenic
1104793043 12:131495878-131495900 GAGAAGAAATAGACTCAGGAGGG - Intergenic
1105590672 13:21790379-21790401 AACAAGAAACAGAATCAGGCTGG + Intergenic
1105960964 13:25338828-25338850 GAGTAAAAACTGAATCAGGGAGG - Intronic
1106163211 13:27218790-27218812 AAGTACTTACAGAATCAGGAGGG + Intergenic
1106683645 13:32033960-32033982 AAGTAGAAACAGAAGCCCTAAGG + Intronic
1106791122 13:33155542-33155564 AAGAAGATACAAAATCAGGGAGG - Intronic
1108170184 13:47733440-47733462 AAGTAGAAATAGAAACAGAATGG + Intergenic
1108399852 13:50029145-50029167 AAGTAGATACAGTATAATGAAGG - Intergenic
1108451198 13:50565762-50565784 AAGTAGAGAGAAAATCAGTAAGG - Intronic
1108515813 13:51201507-51201529 AAGTACTTACAGAATCAGGAAGG - Intergenic
1108818317 13:54316747-54316769 AAGTACTTACAGAATCAGGAAGG + Intergenic
1109299384 13:60575185-60575207 AATTAAAAACAGAAGAAGGAAGG + Intergenic
1110212873 13:72993525-72993547 AAGGAAATAAAGAATCAGGATGG + Intronic
1110212906 13:72993752-72993774 AAAAAAAAAAAGAATCAGGATGG + Intronic
1112071717 13:95859365-95859387 AAGTAAAATCAAAATCAGAATGG - Intronic
1112383761 13:98918793-98918815 AAGTAGAACAAGAAAGAGGAAGG + Intronic
1112553799 13:100447714-100447736 GAGTAGAAAAAAAATCAGTATGG - Intronic
1112946817 13:104938417-104938439 AAGAGGAAATAGAATCAGCAAGG - Intergenic
1113376441 13:109768746-109768768 CAGAAGATACAGAATCAGGCAGG + Intronic
1113394011 13:109927358-109927380 AAGTAGACAGAAAATCAGCAAGG + Intergenic
1113723203 13:112577052-112577074 GACAAGACACAGAATCAGGAAGG + Intronic
1115285087 14:31706929-31706951 AAGTACTTACAGAATCAGGAAGG - Intronic
1115634894 14:35281782-35281804 AAATAGAGACAGGATCAGGTTGG + Intronic
1116083665 14:40206799-40206821 AAGTAGAAACAGAAAGTGTAGGG - Intergenic
1116215669 14:42014099-42014121 AAGGAGAAAGAGAAAAAGGATGG - Intergenic
1116725723 14:48559370-48559392 AAGTACTTACAGAACCAGGAAGG + Intergenic
1116840259 14:49813449-49813471 AACTGGACACAGAATCAGCAAGG - Intronic
1118668423 14:68095992-68096014 AAAAAGAAACAGACTCAGAAAGG + Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1120033501 14:79669229-79669251 AAGTATAAATACAATCAAGAAGG + Intronic
1120395958 14:83967002-83967024 AAGAAGAAAGAGAAGAAGGAAGG - Intergenic
1120963353 14:90145671-90145693 AAATAGAAAGAAAATCAGTAAGG - Intronic
1121808272 14:96852433-96852455 AAGGAGAAACAGTCACAGGAAGG + Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122011671 14:98754345-98754367 AAGTAGAAACAGAGGGTGGAAGG + Intergenic
1122382540 14:101319127-101319149 AAGTACTTACAGAACCAGGAAGG + Intergenic
1123727259 15:23115455-23115477 GATTAGAAACAGAATAAGGAAGG + Intergenic
1124446805 15:29741892-29741914 AAGACAAAACAGAATCAGCAAGG - Intronic
1125076924 15:35630315-35630337 AAGTAAAAAAAGAAGGAGGATGG + Intergenic
1125113292 15:36059054-36059076 AAGTGGCAATAGGATCAGGATGG + Intergenic
1125118439 15:36123071-36123093 ATGTAGACACAGAATCAGTTTGG - Intergenic
1125261033 15:37824948-37824970 AAGTAGAAGCTGAGTCATGAGGG - Intergenic
1125472768 15:40020824-40020846 AAGTGAAACCAGCATCAGGAGGG - Intronic
1125621154 15:41063391-41063413 AAGTAGAAAAACAATTAGGAAGG + Intronic
1125690124 15:41589277-41589299 AAGTACTTACAGAACCAGGAAGG + Intergenic
1125710996 15:41786336-41786358 AAGTAGAAAAAAAATAAAGATGG + Intronic
1126118637 15:45231519-45231541 AAGTAGAAAGAGATGAAGGAAGG + Intergenic
1126394349 15:48197344-48197366 AAGTAGAAAGAGAATGATGGTGG - Intronic
1126496377 15:49295147-49295169 AAGAAGAAAGAGAAGAAGGAGGG + Intronic
1126964041 15:54030886-54030908 AGGTAGTAATAAAATCAGGAGGG - Intronic
1127317036 15:57806814-57806836 AAGGAGAAACAGACTCATAAAGG - Intergenic
1127808315 15:62541352-62541374 AAGAAATAACAGAATGAGGAAGG - Intronic
1127830570 15:62747278-62747300 AAGTAGATACAGAATTGGGGTGG - Intronic
1128705752 15:69836549-69836571 CAGTGGAAACAGAAACAGAAAGG - Intergenic
1128720752 15:69946636-69946658 AGGTAGAATAAGAATCAAGAAGG + Intergenic
1128877210 15:71212150-71212172 GAGTAGAAACAGAAAGAGAAAGG - Intronic
1129291725 15:74573428-74573450 AAGAAGAGACAAAATCAGGCAGG - Intronic
1130301847 15:82686094-82686116 AAGAAGACACAAAATCAGGAGGG + Intronic
1130731929 15:86503972-86503994 AACTAGACACAGAATCAAAAAGG - Intronic
1131069098 15:89453339-89453361 AATTAGAAACATAATAATGAAGG - Intergenic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1133117803 16:3588063-3588085 AATTAAAAAAAGAATCAGGTGGG - Intronic
1133855085 16:9542152-9542174 AAGAAGAAACTGAAACAAGAAGG + Intergenic
1134333843 16:13275820-13275842 ACAAAGTAACAGAATCAGGAAGG - Intergenic
1134441362 16:14301573-14301595 AAGTAGGAGCAGCATCAGGCAGG - Intergenic
1135339149 16:21631439-21631461 AAGTACTTACAGAATCAGGAAGG - Intronic
1136156673 16:28387626-28387648 GAATAGAAACACAAACAGGAGGG + Intronic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137534013 16:49303689-49303711 AAGTAGGAACAGAGTAAAGAAGG + Intergenic
1138775202 16:59713570-59713592 AAGTAAAAAGAGAATCAAGATGG - Intronic
1139813826 16:69649406-69649428 AAGTAGAAGCAGAAAAATGAAGG - Intronic
1140167428 16:72567429-72567451 AAGTAAAAACAAAAAAAGGATGG + Intergenic
1141346195 16:83248276-83248298 AAGGAGAAACAGAGGCAGGGGGG + Intronic
1142923093 17:3208223-3208245 AAGGAGAAACATTATCAGAAGGG - Intergenic
1143588327 17:7863628-7863650 ATTTAGAAACAGTTTCAGGATGG - Intronic
1144274735 17:13655366-13655388 AAGTAGAAACAAGATCACCAGGG - Intergenic
1145853549 17:28129125-28129147 AAGTAAAAACAGTGCCAGGATGG + Intronic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1147254319 17:39173147-39173169 AAAAAGAAAAAGAACCAGGAGGG + Intergenic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1149817204 17:59737071-59737093 AACAAGAAACAGAATCAGGTTGG + Intronic
1150466829 17:65400698-65400720 AAGGAGAAACAAAAGAAGGAAGG - Intergenic
1150989251 17:70236851-70236873 AAGTAGAAACAGAGGAAGTAGGG + Intergenic
1152036213 17:77874712-77874734 AAGAGGAAACAGGCTCAGGATGG - Intergenic
1152260563 17:79264685-79264707 AAACAGAAACAGCATCAGGTGGG - Intronic
1153068213 18:1072707-1072729 AAGTAGAAACAGACTCTTGGTGG - Intergenic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153273273 18:3344047-3344069 ATGAAGAAACAGATTCAAGAAGG - Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153538026 18:6123842-6123864 AAGTAAAAACAGTTTCAGGTGGG - Intronic
1153645609 18:7193401-7193423 AAGAAAAAAAAGAAACAGGATGG - Intergenic
1153763850 18:8356501-8356523 AAACAGAAACACACTCAGGATGG + Intronic
1153870131 18:9310815-9310837 AAATAGAAAGAAAATCAGTAAGG + Intergenic
1153923174 18:9809144-9809166 AGGTAAAAACAGGCTCAGGATGG - Intronic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155712406 18:28899458-28899480 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1156001364 18:32388363-32388385 TAGTAAAAACAGAATCAGACAGG + Intronic
1156378736 18:36537786-36537808 AATTAGAAAGAAAATCAGTAAGG + Intronic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156839608 18:41595644-41595666 AAGTAGAATCATCAACAGGATGG - Intergenic
1157020084 18:43770801-43770823 AAATAGGAAGAGAATTAGGAGGG + Intergenic
1158044583 18:53140640-53140662 AAGTAGGGACACATTCAGGAAGG + Intronic
1158224264 18:55184317-55184339 AAGTAGTAACTTAATTAGGATGG + Intergenic
1158897721 18:61930875-61930897 CAGTAGAAATAGAAGCAAGATGG + Intergenic
1158965833 18:62621584-62621606 AAGTAGAAAAAGAGCCAGGAAGG + Intergenic
1159936762 18:74375100-74375122 AAGTAGATAAAAAATCAGTAAGG - Intergenic
1160348309 18:78152893-78152915 GAGTAGAAACATCTTCAGGAGGG - Intergenic
1160485130 18:79284285-79284307 TAGTAAAAACAGAACCAGTAAGG - Intronic
1161096428 19:2394528-2394550 GAGTAGAAACAGAGTGAGGTTGG + Intronic
1161247537 19:3261828-3261850 AAATAAAAACAAAAACAGGAGGG + Intronic
1161597717 19:5159794-5159816 AAGTACTTACAGAATCAGGAAGG - Intronic
1161735444 19:5989624-5989646 AGGAAGAAACAGAAGCAGGGGGG - Intergenic
1162815817 19:13193778-13193800 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163929184 19:20372308-20372330 AAGTACTTACAGAATGAGGAAGG + Intergenic
1163997103 19:21061223-21061245 AAGTATAAACAGAATTTGCATGG - Intergenic
1164167030 19:22689383-22689405 AAGTAAAAACAGAATTTGCATGG - Intergenic
1164992537 19:32694785-32694807 AAGTACTTACAGAATCAGGAAGG - Intronic
1165112036 19:33508087-33508109 AAGGAGAAACAGCTTCAGGGAGG - Intronic
1165177350 19:33939970-33939992 AAGTAAAAACAAAATTAGCAAGG - Intergenic
1165650971 19:37489714-37489736 AAATATCAACAGAAACAGGATGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166624436 19:44337186-44337208 AAGAAGAAACACAAGAAGGAAGG - Intronic
1166738592 19:45100752-45100774 GAGGAGAAACAGAAACAGGTGGG + Intronic
1167308685 19:48723608-48723630 ATGAGGAAACAGAATCAGGTAGG - Intronic
1167906758 19:52666981-52667003 AAGTAGTTACAGAATCAGGAAGG + Intronic
1168159443 19:54499603-54499625 AAGAAGAGTCAGAAGCAGGAAGG + Intronic
1168209039 19:54875668-54875690 AAATAGAATCAGCATAAGGAAGG - Intronic
925065233 2:924441-924463 AAGTAGCTACAGAACCAGTAAGG + Intergenic
925949379 2:8896668-8896690 AAGTACTTATAGAATCAGGAAGG - Intronic
926411850 2:12612857-12612879 GAATACAAAGAGAATCAGGAAGG + Intergenic
926503221 2:13680011-13680033 AAGTACTTACAGAACCAGGAAGG + Intergenic
927271837 2:21218963-21218985 AAGTGGATACAAAATCACGAAGG - Intergenic
927524907 2:23729987-23730009 AAGTAGACAGAAAATCAGCAAGG + Intergenic
927537119 2:23872170-23872192 AAATAAAAACAGAAACAGGCTGG - Intronic
928114198 2:28535282-28535304 AAGAAGAAATAGAATAAAGAGGG - Intronic
928347975 2:30518454-30518476 AAGTACTTACAGAACCAGGAAGG + Intronic
928448572 2:31356214-31356236 AAATAGACAGAAAATCAGGAAGG + Intronic
929417041 2:41754131-41754153 AGGGAGAAAGTGAATCAGGATGG - Intergenic
929597588 2:43186094-43186116 AAGAAGAAACAAACCCAGGAAGG - Intergenic
929868832 2:45740772-45740794 AGGTAGAATCAGAATGAGGCAGG - Intronic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930510254 2:52335492-52335514 AAGAAGGAGCAGAAGCAGGAAGG - Intergenic
931028697 2:58145181-58145203 AAGTAGACTCAGAAACAGAAGGG - Intronic
931328156 2:61249783-61249805 TGGTAGAAACAGAAACAGGCTGG - Intronic
931540822 2:63327265-63327287 AAGTACTTACAGAATCAGGAAGG + Intronic
931592854 2:63904640-63904662 AAGTAGACAGAAAATCAGTAAGG + Intronic
932600021 2:73117268-73117290 AGGTGGAAACAGACTCAGTAGGG - Intronic
932688186 2:73891354-73891376 AAGACGAAGCAGAGTCAGGAAGG + Intergenic
932705783 2:74023949-74023971 TAGGAAAAACTGAATCAGGAGGG - Intronic
933204725 2:79493201-79493223 AAGTAGAAAGAAAAACAGGAGGG + Intronic
933332967 2:80918387-80918409 AAAGACAAACAGAATCTGGATGG - Intergenic
933342400 2:81039461-81039483 AAGTACCTACAGAATCAGGAAGG + Intergenic
933389669 2:81653827-81653849 AAGTACTTACAGAACCAGGAAGG - Intergenic
934483109 2:94672303-94672325 AAGGAGAAAAAGAACCAGAACGG + Intergenic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
935247908 2:101235271-101235293 AAGTATTTACAGAATCATGAAGG + Intronic
935800307 2:106689172-106689194 AATAAGCAACAGGATCAGGAGGG + Intergenic
936557863 2:113511758-113511780 AATTAGAAACAGTATCAGTGGGG - Intergenic
936958679 2:118049891-118049913 AAGCAGAAAGAGAATGAGTATGG - Intergenic
937259472 2:120576392-120576414 AAGAAGAAACAGAAGCAGAGCGG + Intergenic
937411496 2:121680767-121680789 AAGTACTTACAGAACCAGGAAGG - Intergenic
937564564 2:123268397-123268419 AGGTAGAAATAGCATCTGGAAGG + Intergenic
937782536 2:125855452-125855474 AACTTTAAACAGAATCTGGAAGG + Intergenic
938805699 2:134805433-134805455 ACGTACTTACAGAATCAGGAAGG - Intergenic
939335407 2:140820889-140820911 AAGAAGCAACAGAAAGAGGAGGG - Intronic
939575567 2:143891014-143891036 AAGCAGACACAGAACCAGAATGG - Intergenic
939669060 2:144987219-144987241 AAGCAGAAACATCAGCAGGATGG - Intergenic
939717143 2:145598673-145598695 AAGAAGAAACAGAATCACCGGGG - Intergenic
939751890 2:146058299-146058321 AATTAGAATGAGAAACAGGAGGG - Intergenic
940016191 2:149107898-149107920 AAGTAGAAAAACAATTAGTAAGG - Intronic
940736788 2:157462645-157462667 AAGAAGAAAAAGTAGCAGGAGGG + Intronic
941243770 2:163071938-163071960 AAGTACTTACAGAATCAAGAAGG + Intergenic
941320648 2:164049987-164050009 AAGTAGAAAAATAAACAGAAAGG + Intergenic
941677132 2:168355855-168355877 AAGAAGAAAAAGAATTTGGAAGG - Intergenic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
941780838 2:169442800-169442822 AAGTAGACAGAAAATCAGCAAGG + Intergenic
941920987 2:170850524-170850546 AGGTAGAAGCAGACTAAGGAGGG + Intronic
942101895 2:172591848-172591870 AAGTACTTACAGAATCAGGAAGG - Intronic
943102818 2:183508688-183508710 AAGTACTTACAGAATCAGCAAGG - Intergenic
943369439 2:186999950-186999972 AAGTAGATAGAAAATCAGTAAGG - Intergenic
943419162 2:187647343-187647365 AAGTATAAACAAAATTTGGAAGG + Intergenic
943902264 2:193455414-193455436 AAGTACTTACAGAATCAGGAAGG + Intergenic
943958168 2:194220834-194220856 TAGCAGAAAAAGAAACAGGAGGG - Intergenic
944080344 2:195780924-195780946 AAGTAGAAACAGTAGCACTAGGG + Intronic
944453501 2:199869425-199869447 AAGAAGAAAGAGAAAAAGGAAGG - Intergenic
945464473 2:210151645-210151667 AAGAAGAAACAGACTCAGCATGG - Intronic
946996459 2:225397887-225397909 AAGAAGAAACAAAACAAGGAAGG + Intergenic
946996660 2:225400321-225400343 GAGGAGAAAGAGAAGCAGGAAGG + Intergenic
946997582 2:225412643-225412665 TAGTAGAAAAAGAAACAGAAAGG + Intronic
947231194 2:227888389-227888411 AAGCAGAAGCAGGATCAGGCGGG + Intronic
947292382 2:228590614-228590636 AAGAAGAGAGAGAATTAGGAAGG + Intergenic
947476246 2:230450065-230450087 AAGTAGAAACAGGAGAAGAAAGG + Intronic
947538844 2:230960515-230960537 AAGGAGAAAAAGAATTAGTAGGG + Intronic
947572796 2:231249163-231249185 AAGTAGAGACAGCAGCAGGATGG - Intronic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
948382141 2:237558261-237558283 AAGTAGCAACAGCACCATGATGG - Intergenic
948537341 2:238655948-238655970 AAGTGGTAACAGCATCAGTAGGG + Intergenic
1168823019 20:789291-789313 AAGTACTTACAGAACCAGGAAGG - Intergenic
1169316734 20:4597990-4598012 GAAAAGAAATAGAATCAGGATGG - Intergenic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1169886222 20:10400995-10401017 TACTAGAAACAAAATCAAGATGG + Exonic
1170940684 20:20845654-20845676 AAGGAGGAACAGAAGCAGAAAGG + Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1171261853 20:23741095-23741117 AAGTACTTACAGAATCAGGAAGG + Intergenic
1171270988 20:23816975-23816997 AAGTACTTACAGAATCAGGAAGG + Intergenic
1172340910 20:34156737-34156759 AAGTACTTACAGAATCAGGAAGG + Intergenic
1173916995 20:46715044-46715066 AGGAAGCAACAGGATCAGGATGG - Intronic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175620123 20:60436746-60436768 AAGGAGAAACAAAATCTGAATGG - Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
1177333042 21:19685497-19685519 AACCAGAAAGAGAATCAAGAAGG - Intergenic
1177926696 21:27225790-27225812 TGGTAGAAACAGAAGGAGGAGGG + Intergenic
1178109520 21:29356388-29356410 AAGTACTTACAGTATCAGGAAGG - Intronic
1178135264 21:29619774-29619796 AAGCAGCAACAGAAGCAGCATGG + Intronic
1178285551 21:31322607-31322629 AAGTAGAAACACCCACAGGAGGG - Intronic
1178353068 21:31886825-31886847 TAGTAGAAACGGAGTCAGGCTGG + Intronic
1178836958 21:36106471-36106493 AAGTACTTACAGAATCAGGAAGG + Intergenic
1179068082 21:38045111-38045133 TAGTAGACACAGAAAAAGGAGGG - Intronic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179944515 21:44662560-44662582 AAGTAGACAGAAAATCAGGAAGG + Intronic
1180650673 22:17374233-17374255 ACGTACAAACACAACCAGGAAGG - Intronic
1181076843 22:20384457-20384479 AAGCAAAAATAGAAACAGGATGG - Intronic
1181647387 22:24240287-24240309 AAGAAGAAACAGAATAGGCATGG + Intronic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1182438145 22:30344499-30344521 AAGCAGAAACAGGCTCAGAAAGG - Intronic
1182615480 22:31586169-31586191 AGGTACAAAGAGAAGCAGGAGGG - Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1185408317 22:50670040-50670062 ATTTAGAAAAAGAATCAGGCTGG + Intergenic
949140338 3:625692-625714 AAGTAGAAAGAGAATTAGCTAGG - Intergenic
949611328 3:5706788-5706810 AAGTACCTACAGAACCAGGAAGG - Intergenic
950594749 3:13969820-13969842 AAGTACTTACAGAACCAGGAAGG - Intronic
950846347 3:16019496-16019518 AAGTACTTACAGAACCAGGAAGG - Intergenic
950996419 3:17502404-17502426 AAGTAGAAGGAAAACCAGGATGG - Intronic
951020995 3:17780701-17780723 AAGTACTTAGAGAATCAGGAAGG + Intronic
951346133 3:21548254-21548276 AGGTAGAAACAGTATCAGCCAGG - Intronic
951448880 3:22814081-22814103 CAGTGGCAACAGAAACAGGATGG - Intergenic
951601242 3:24378112-24378134 AGGCAGAAACTGAATCAGGCAGG + Intronic
951773902 3:26287412-26287434 GAGTAGAAATAGAAATAGGAGGG + Intergenic
952054147 3:29424121-29424143 AAGTAGAAACTGAAAAAGTATGG + Intronic
952554813 3:34520062-34520084 AAGTACTTACAGAATCAGGAAGG - Intergenic
953179261 3:40581337-40581359 ATGTAAGAACAGAATCAAGAGGG + Intergenic
953622455 3:44544829-44544851 AAGTACTTGCAGAATCAGGAAGG - Intergenic
954599288 3:51855293-51855315 AAGAACTTACAGAATCAGGAAGG + Intergenic
954604582 3:51898946-51898968 AAGTACTTACAGAATCAGGAAGG + Intronic
954752474 3:52821435-52821457 GTGTAGAAACAGCAGCAGGAAGG + Intronic
956105722 3:65816112-65816134 AATTAGAATCAGAATTGGGAGGG - Intronic
956609291 3:71106055-71106077 AGGTAGTAACAGCACCAGGATGG - Intronic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956648400 3:71479899-71479921 AAATAAAAACAGAAACAGGCTGG + Intronic
956842588 3:73154352-73154374 AAGTACTTACAGAATCAGAAAGG - Intergenic
956929785 3:74029788-74029810 AAGTATAAGCAGAATAATGAGGG - Intergenic
957335501 3:78822689-78822711 AAGTTGGACCAGAATGAGGAAGG - Intronic
957538325 3:81534609-81534631 GAGAAGAAACAGAAAAAGGAAGG + Intronic
957887563 3:86308221-86308243 AAGTAAAAAAAAATTCAGGATGG - Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959664524 3:108905885-108905907 ACGTAGAAAAAGAAGCAGGTGGG - Intergenic
960063972 3:113351127-113351149 AAGTACTTACAGAATCAGGAAGG + Intronic
960720497 3:120620856-120620878 AAGTACTTACAGAACCAGGAAGG - Intergenic
960904003 3:122580202-122580224 AAGTAGACATAAAATCAGTAAGG - Intronic
961104591 3:124230322-124230344 AAGTAGAAACTGACTCTGGAAGG - Intronic
961141960 3:124563303-124563325 AAGATGAAACTGACTCAGGAAGG - Intronic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961611262 3:128141866-128141888 AATTAAAAACATAATCATGAAGG - Intronic
962200023 3:133393270-133393292 AAGAGGAAACAGAATGAGGTTGG - Intronic
962332485 3:134490718-134490740 TAGTAAAAACAGTATCAGTAAGG - Intronic
962644456 3:137422235-137422257 AAGAAGTAAGAGAATCAGAAAGG + Intergenic
962944011 3:140151180-140151202 AAATATAAACAGCTTCAGGAAGG + Intronic
963524060 3:146394069-146394091 AAATAGAAACAGAAACAAAATGG - Intronic
963608565 3:147436379-147436401 AACTAGAAACAGCATCAGACAGG - Intronic
963697228 3:148576800-148576822 AAGTACTTACAGAATCAGGAAGG + Intergenic
963991808 3:151664892-151664914 AAGTACTTACAGAATCAGGAAGG - Intergenic
964421861 3:156511696-156511718 AAGTAGAAAGAGCTTGAGGAAGG - Intronic
964972487 3:162578813-162578835 AAGTACTCACAGAATCAGGAAGG + Intergenic
965123853 3:164598510-164598532 GAATAGAAACAAAACCAGGAAGG + Intergenic
965139697 3:164817508-164817530 AAGTACTTACAGAATCAGGAAGG + Intergenic
965655565 3:170980103-170980125 AAGTAGACAAAAAATCAGTAAGG - Intergenic
966041225 3:175490716-175490738 AAGTACCATCAGAAGCAGGATGG + Intronic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
969020620 4:4137868-4137890 AATTAGAAACAGTATCAGTGGGG - Intergenic
969733213 4:8969468-8969490 AATTAGAAACAGTATCAGTGGGG + Intergenic
969918853 4:10517605-10517627 AAGTAGGAACATACTCAAGAAGG + Intronic
970181547 4:13402281-13402303 AAGTAGACTGAGAATCAGTAGGG - Intronic
970792084 4:19869487-19869509 AAGTAATAACAAATTCAGGAAGG - Intergenic
971399322 4:26261429-26261451 AAGTAGAAAAGAAATGAGGAAGG + Intronic
971464597 4:26942707-26942729 TAGTAGAAATAAAATAAGGATGG - Intronic
971578937 4:28309046-28309068 AACCTTAAACAGAATCAGGAAGG + Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972332741 4:38078990-38079012 CAGTAGAAACAGAAGCAGAAAGG + Intronic
972594303 4:40516558-40516580 AAGGAGAAATAGAATGATGAGGG - Intronic
972651336 4:41020504-41020526 AAGTACTTACAGAATCAGGAAGG + Intronic
972737855 4:41863345-41863367 CAGTAAAAACAAAATCAGGTGGG - Intergenic
972784833 4:42316735-42316757 AAGTACTTACAGAATCAGGAAGG + Intergenic
973039631 4:45454143-45454165 AAGTAGGAAGAAACTCAGGAAGG + Intergenic
973738705 4:53898839-53898861 AAGTAGACATAGTATGAGGAGGG + Intronic
973887827 4:55340549-55340571 AAATACTTACAGAATCAGGAAGG + Intergenic
973962783 4:56128547-56128569 AAGTGGAAACACAATTAGGAAGG + Intergenic
974164302 4:58181031-58181053 AAGTAGAGAGATAATCAGTAAGG - Intergenic
974317609 4:60302858-60302880 AGGTGGAAAGAGAATAAGGAAGG + Intergenic
974593898 4:63992512-63992534 AAATAGAAACAGAAATATGAAGG - Intergenic
974634897 4:64549686-64549708 AAGTAGACAGAAAATCAGTATGG - Intergenic
974685927 4:65229229-65229251 AGGAAGAAACAGAAACAGCAGGG - Intergenic
976120649 4:81777462-81777484 AGAAAGAAACAGAATCAGAAAGG + Intronic
976441920 4:85085673-85085695 AATTAGAGACTGAATCTGGAAGG + Intergenic
976510169 4:85899470-85899492 ACGTAGAAACAGAATCACCAAGG + Intronic
976960024 4:90958882-90958904 AAGTAGAGACAGAAGAAGGATGG - Intronic
977415298 4:96725246-96725268 AATTAGAAACATAAACATGAGGG - Intergenic
977640666 4:99354911-99354933 AAGTACTTACAGTATCAGGAAGG + Intergenic
977834454 4:101632301-101632323 AAGTACTTACAGAATCAGAAAGG - Intronic
977975345 4:103257913-103257935 AAGTAGAAAGAACATCAGAAAGG + Intergenic
978093186 4:104742838-104742860 GGGCAGAAACAGGATCAGGAAGG - Intergenic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
978455861 4:108890664-108890686 AAATAGAAACAGCCACAGGAGGG + Intronic
978687862 4:111469535-111469557 AAAAACATACAGAATCAGGAGGG - Intergenic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
978915231 4:114117928-114117950 AAGAAAAAACAGAATTAAGATGG - Intergenic
979098396 4:116581402-116581424 GAGTAGAAAGAGAAAAAGGAAGG - Intergenic
980012288 4:127610275-127610297 AAATAGAAAAAGAATCTGCAAGG + Intergenic
980204264 4:129697556-129697578 AGGAAGAAAAAGATTCAGGAAGG - Intergenic
980438943 4:132816468-132816490 AAGTACTTACAGAACCAGGAAGG - Intergenic
981092148 4:140742956-140742978 ATGTACATACAGTATCAGGAAGG + Intronic
981119318 4:141030764-141030786 TTATAGAAACAGAATCAGAATGG + Intronic
981856147 4:149295306-149295328 AAGAAGAAAGAGAAACACGAGGG + Intergenic
981892580 4:149755615-149755637 AAGAAGAAAATAAATCAGGAGGG - Intergenic
982095809 4:151922452-151922474 AAGTAGAAAGTGAGTCATGAAGG + Intergenic
982701620 4:158664031-158664053 AAGTACTTGCAGAATCAGGAAGG + Intergenic
982793202 4:159616183-159616205 TAGTAGCAACAGAATGAGAAGGG - Intergenic
982877523 4:160666541-160666563 AAGTACTTACAGAATCAGGAAGG + Intergenic
983089099 4:163483283-163483305 AAGTTGAGAAAGAAACAGGAAGG + Intergenic
983376883 4:166941123-166941145 CAGTTAAAACAGATTCAGGAGGG + Intronic
983461823 4:168034353-168034375 AAGTAAAAACAGAGTTAAGAAGG - Intergenic
983591788 4:169421220-169421242 AAGTAGAAAGAAAATCAGTAAGG + Intronic
983834450 4:172371060-172371082 AAGTACTTACAGAATCAGGAAGG - Intronic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984091676 4:175382552-175382574 AAATAGACAGAGAATCAGAAAGG + Intergenic
984277947 4:177633189-177633211 AAGTATAAAGAAAATCATGAGGG - Intergenic
984449347 4:179879087-179879109 AAATAAGAACAGATTCAGGAAGG + Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984765352 4:183396582-183396604 AAGTGGAAACAGAAACAGGAAGG - Intergenic
984868301 4:184303233-184303255 AACTAGAAAGAAAATCAGTAAGG + Intergenic
984940334 4:184925853-184925875 AAGTAGACAGAAAATCAGTATGG - Intergenic
984995537 4:185426627-185426649 AACTAGAAACAGATTTAAGAAGG - Intronic
985837146 5:2279963-2279985 AATTATAATCAGAATCAGGAAGG - Intergenic
986089057 5:4484905-4484927 AAGTAGAGAGAAAATCAGTAAGG + Intergenic
987546843 5:19321593-19321615 AAAAAAAAAAAGAATCAGGAGGG - Intergenic
987931063 5:24399719-24399741 GAGTACTTACAGAATCAGGAAGG + Intergenic
988531878 5:32034917-32034939 AAGCAGGAACAGAATCTTGAGGG - Intronic
989177023 5:38538196-38538218 AAGTAGGAATAGAATCTGAATGG - Intronic
989405798 5:41059111-41059133 AAAGAGAAACAGAGTCAGGTGGG - Intronic
989613736 5:43319161-43319183 AAGTACTTACAGAACCAGGAAGG - Intergenic
989784055 5:45305744-45305766 AAGAAGAAACAGAAGAAGGGAGG + Intronic
989964132 5:50449288-50449310 AAGTACTTACAGAATCAGGAAGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990367489 5:55085843-55085865 AGGTACTTACAGAATCAGGAAGG - Intergenic
990419392 5:55616641-55616663 AAGTACTTACAGAATCAGGAAGG + Intergenic
990462277 5:56040384-56040406 AAGCTGAAACAGAATCTGGTGGG - Intergenic
991381184 5:66029784-66029806 TAGTAGAAACAGGGCCAGGATGG + Intronic
992130560 5:73688229-73688251 AAGTGGAACAATAATCAGGAAGG + Intronic
992751010 5:79860777-79860799 AAGTAGACATAAAATCAGCAAGG - Intergenic
993055327 5:82973953-82973975 AAATACTTACAGAATCAGGAAGG - Intergenic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
993316098 5:86408032-86408054 AAGAAGAAAAAGAATAAGGTGGG + Intergenic
993415731 5:87627766-87627788 AAAATGAAACAGAATGAGGAGGG + Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994834732 5:104835119-104835141 AAGTTGAAATAGAACCAGGCAGG + Intergenic
996098879 5:119427705-119427727 AAGTACTTACAGAAACAGGAAGG - Intergenic
996100344 5:119438872-119438894 AAGTACTTACAGAATCAGGAAGG + Intergenic
996246274 5:121267370-121267392 AAGTAGAAGCAGATTTGGGAGGG - Intergenic
996306757 5:122055770-122055792 AATTAAAAACACAATGAGGATGG + Intronic
996861665 5:128073966-128073988 AAGAAGAAACAGATGCAGAAAGG + Intergenic
997576430 5:134981090-134981112 AAGAAGAAACAAAAGAAGGAAGG - Intronic
997595738 5:135106185-135106207 AAGGAGAAACAGAATCAGTCGGG + Intronic
997787212 5:136724429-136724451 ATGTAGAAACATAGACAGGAAGG - Intergenic
998915422 5:147006279-147006301 AAGTACTTACAGAATCAGGAAGG + Intronic
998987615 5:147778579-147778601 AAGTGGAAACAGATTCAGGGAGG - Intronic
999255436 5:150207435-150207457 TAGTAGAAACAGGACCAGGCTGG + Intronic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
1000060780 5:157653105-157653127 CAGTAGAAAGAGAATGATGATGG - Intronic
1000065786 5:157691934-157691956 CAGTAGAAAGAGAATGATGATGG - Intergenic
1001399872 5:171440099-171440121 AAGAGGAAACAGGATCAGAAAGG - Intronic
1001410842 5:171510243-171510265 TAGTAGAGACAGGGTCAGGATGG + Intergenic
1003049614 6:2767307-2767329 GAGAAGAACCAGCATCAGGAAGG + Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003652676 6:7975819-7975841 ATGTAGACAGAGAAGCAGGATGG + Intronic
1004812718 6:19277252-19277274 AAGTCCTTACAGAATCAGGAAGG + Intergenic
1004990039 6:21126613-21126635 AAATAGAAACTGATTCATGAGGG - Intronic
1005279163 6:24252622-24252644 AAGTAGAAAGAGAATGGTGAGGG + Intronic
1005526963 6:26660236-26660258 AATCAGAAACATAATCAGCAAGG - Intergenic
1005725886 6:28648283-28648305 AAGAAGCCACAGAATCAGCACGG - Intergenic
1006222072 6:32499636-32499658 AAGTACTTACAGAATCAGGAAGG + Intergenic
1006795436 6:36729398-36729420 AAGTGGGAAGAGAAACAGGAAGG - Intronic
1006836917 6:37004610-37004632 AGGAAGAAACAGAATCAGAGAGG - Intergenic
1007334663 6:41146063-41146085 AAGTAGACAGAAAATCAGCAAGG - Intergenic
1007531827 6:42549523-42549545 AAAAAGAAACAGGATCAGGCTGG - Intergenic
1007982804 6:46176333-46176355 AAGTGAAAACAGAAAAAGGAAGG + Intergenic
1008121886 6:47627827-47627849 AGATGGAAACAGAATCTGGAAGG + Intergenic
1008151719 6:47960883-47960905 AAGTAGACAAAAAATCAGCAGGG + Intronic
1008443990 6:51567126-51567148 AAGTAGAAACAAAACCAGCAGGG + Intergenic
1008626760 6:53324693-53324715 GAAAAGAAATAGAATCAGGAAGG + Intronic
1008639628 6:53448550-53448572 AAGTGGAATTAGAATCATGAGGG - Intergenic
1010075304 6:71790847-71790869 AAGTACTTACAGAATCAGGAAGG + Intergenic
1010472722 6:76248918-76248940 AAGCAGAAACTGATTCAAGAAGG + Intergenic
1010752000 6:79626265-79626287 AAATAAAAATAAAATCAGGACGG + Intergenic
1011449995 6:87482482-87482504 AAGTACTTACAGAATCAGGAAGG - Intronic
1011882951 6:92053485-92053507 GAGAAGAAAAAGAAGCAGGAGGG + Intergenic
1012003369 6:93682241-93682263 AAGAATAAACAGGATCAGAAAGG - Intergenic
1012441059 6:99262776-99262798 AAGTACTTACAGAATCAGGAAGG - Intergenic
1012646189 6:101684983-101685005 GAGAAGACACAGAAGCAGGAAGG - Intronic
1012840636 6:104324994-104325016 ATGTAGAAACAGCCTCTGGATGG - Intergenic
1013036757 6:106392483-106392505 AAGGCAAAAGAGAATCAGGAAGG + Intergenic
1013210607 6:107983518-107983540 AAAAAAAAACAGAATCAGGCTGG + Intergenic
1013977649 6:116095354-116095376 AAGTATTTACAGAATCAGGAAGG + Intergenic
1015472544 6:133621963-133621985 AACTTGAAACAGAATGAGGCAGG - Intergenic
1015710141 6:136130327-136130349 CAGTAGAAAAGGAATGAGGAAGG - Intronic
1015996811 6:139003205-139003227 AAGTTGAAAGAGAAACAGAATGG + Intergenic
1016554345 6:145318774-145318796 AAGGAGAAACTGAGTAAGGAAGG + Intergenic
1016787599 6:148029369-148029391 AACTAGAAAGAAAATCAGCAAGG + Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017601327 6:156085362-156085384 AAGTAGATATAAAATCAGTAAGG - Intergenic
1018191525 6:161313553-161313575 AAGTGCTTACAGAATCAGGAAGG - Intergenic
1020470694 7:8531099-8531121 AAGAAGGAACAGAATCTTGATGG - Intronic
1020655581 7:10924808-10924830 AAGTATTTACAGAACCAGGAAGG + Intergenic
1020786308 7:12577552-12577574 AAGCAGAAACAAAAACAGGCCGG + Intronic
1020868351 7:13594362-13594384 AAGTAGACAAAAAATCAGTAAGG - Intergenic
1021356119 7:19654968-19654990 AAGTATGTACAGAATCAGGAAGG - Intergenic
1021499434 7:21314295-21314317 AACTAGAAAGAAAATCAGTAAGG + Intergenic
1021636397 7:22698399-22698421 AACCAGAAACAGAGTCAGGCTGG - Intergenic
1022091088 7:27108492-27108514 AAGTACAAAAAGGATCAGAAGGG - Exonic
1022255399 7:28651606-28651628 AAGTTGAAACAGAAATAGAAAGG - Intronic
1022365871 7:29715622-29715644 AAATAAAAACAGATTCAGAAAGG - Intergenic
1022695025 7:32696625-32696647 AAATACAAACAGATTCAGAAAGG + Intergenic
1022724480 7:32968313-32968335 AACTGAAAACAGAATCAGGCCGG - Intronic
1022885677 7:34640927-34640949 AAGTAGAAAGAGAATCATTCAGG + Intergenic
1023077735 7:36500469-36500491 AAGTACTTACAGAATCAGGAAGG - Intergenic
1023436484 7:40145745-40145767 AAGTACTTACAGAATCAGGAAGG - Intronic
1023671321 7:42579950-42579972 AGGTAGAAATAAAATCAGCAGGG - Intergenic
1023795178 7:43786475-43786497 AAGGAGACAGAAAATCAGGAAGG + Intronic
1023798955 7:43816388-43816410 AAGTACTTACAGAATCAGGAAGG + Intergenic
1024472747 7:49780225-49780247 CAATAGACACAGAATCAGAATGG - Intronic
1024934403 7:54698237-54698259 GAGTAGAACCCGGATCAGGACGG - Intergenic
1025798232 7:64759681-64759703 AAGTACTTACGGAATCAGGAAGG - Intergenic
1025875520 7:65477157-65477179 AATTAGAATCAGAATCTGGGTGG - Intergenic
1026148683 7:67770199-67770221 AAGAAGAAACATAAGAAGGATGG - Intergenic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1027843092 7:83339092-83339114 AAGTAGAAAGAGATACTGGATGG - Intergenic
1028735116 7:94200927-94200949 AAGTAGACAGAAAATCAGTAAGG - Intergenic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1030556713 7:111034155-111034177 AAGTAGTTACAAAATGAGGAGGG + Intronic
1030640043 7:111994461-111994483 AAGAAGGAACAGCATCAGAAGGG + Intronic
1030901141 7:115125396-115125418 AAGAAGAAATAGAATCAGTAGGG - Intergenic
1031282849 7:119826451-119826473 CAGTAGAAACATAAGAAGGAAGG + Intergenic
1031790686 7:126099344-126099366 AAGTAGAAGAAGAATTAAGAAGG - Intergenic
1033318616 7:140319206-140319228 GAGCAGAAAGAGAAACAGGATGG + Intronic
1033757107 7:144404238-144404260 AAAAACAAACAAAATCAGGAAGG - Intronic
1034015882 7:147586033-147586055 AAGGTGAAACTGAAGCAGGAAGG + Intronic
1034384249 7:150725494-150725516 AAGTAGAAACAGCTTAAAGATGG + Intronic
1034410985 7:150942129-150942151 GAGCAGGAACAGAAGCAGGAGGG - Intergenic
1034579414 7:152029611-152029633 AAGTACTTACAGAATCAGGAAGG - Intronic
1034702370 7:153107733-153107755 AAGTAGACATAGGATCAGGGTGG + Intergenic
1035110831 7:156480278-156480300 ACATAGAAACAGAATCTGCAGGG + Intergenic
1035636973 8:1155007-1155029 GAGTGGGAACAGAAGCAGGATGG - Intergenic
1035794719 8:2344256-2344278 AAGTAGATACAGACTGATGAGGG + Intergenic
1036508453 8:9378399-9378421 AAGTAGAAAGAAAAGAAGGAAGG + Intergenic
1036624407 8:10455157-10455179 AAGTATAAACAGACTCAGAAAGG - Intergenic
1036828256 8:11997067-11997089 GAGGTGAAAGAGAATCAGGAGGG - Intergenic
1037642465 8:20759335-20759357 AAGTAGAAAGAAAATCACTAAGG - Intergenic
1038138243 8:24814068-24814090 AAGTAGAAGGAGAGACAGGAAGG - Intergenic
1038326806 8:26577972-26577994 AAGGAGAGAGAGAAACAGGAGGG - Exonic
1038625189 8:29185727-29185749 ATGTAAAAACAGCATTAGGAAGG - Intronic
1039080767 8:33732087-33732109 AAGTAGAAATTGACTGAGGAAGG + Intergenic
1039118293 8:34116852-34116874 GAGGAGAAAGAGAATCAGGGAGG + Intergenic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1040667416 8:49651120-49651142 AAGTACTTACAGAATCAGGAAGG - Intergenic
1040728397 8:50411489-50411511 AAATAAAAACAGAAGGAGGAAGG + Intronic
1041863101 8:62536501-62536523 CTGTAGAAACTGAATAAGGAAGG + Intronic
1041904142 8:63013196-63013218 AAGAATGAACAGAAACAGGAAGG - Intergenic
1042049663 8:64689862-64689884 AATTAGAAACAGAAGCAGGCCGG - Intronic
1042088064 8:65130447-65130469 AAGTACTTACAGAACCAGGAAGG - Intergenic
1042187617 8:66152633-66152655 CTGTAGAAAGAGACTCAGGAGGG - Intronic
1042767337 8:72338042-72338064 AAGACGTAACAGAATCAGGAAGG - Intergenic
1042890020 8:73598703-73598725 AAGTAAAAAAAGAAGCAGAAGGG + Intronic
1043044617 8:75306027-75306049 TAGAAGAAACAGAATAGGGATGG + Intergenic
1043261709 8:78208373-78208395 GAGTAAAAACAGAAGCAGCATGG + Intergenic
1043341584 8:79246504-79246526 AAGGATAAACAGAATCAATAAGG - Intergenic
1043419546 8:80084523-80084545 AAGGAGAAACAGAAACAGACAGG + Intronic
1043613336 8:82092932-82092954 AAGTACTTACAGAATCAGGAAGG - Intergenic
1043617877 8:82149535-82149557 AAATAGAAACTGGATAAGGAAGG + Intergenic
1043714967 8:83470677-83470699 CAGTAGAAAAAGAATGAGCAAGG - Intergenic
1044456189 8:92395027-92395049 AAGTACTTACAGAATCAGGAAGG - Intergenic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1044726170 8:95196012-95196034 AAGTAGAAGCAGAGTCCGGGCGG - Intergenic
1045781244 8:105865571-105865593 TAGTAGAAATAGAGACAGGATGG - Intergenic
1045803265 8:106126573-106126595 AAGTAGAAACAAAATTTGGAGGG + Intergenic
1046385614 8:113505743-113505765 AAATAAAAACAAAATCATGAAGG + Intergenic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1047444746 8:124909439-124909461 AAGTACTTACAGAATCAGGAAGG + Intergenic
1047880808 8:129190788-129190810 AACGAGAAATAGAATCAGAATGG + Intergenic
1049012373 8:139895780-139895802 AACTCCAAAGAGAATCAGGAGGG - Intronic
1049336259 8:142088047-142088069 AAGTAGACAGAAAATCAGTAAGG + Intergenic
1050692184 9:8240581-8240603 AAACAGAAACAGAAACAGGTAGG + Intergenic
1051177863 9:14379179-14379201 TATTAGAAACAGAGTCATGAAGG - Intronic
1051715150 9:19975104-19975126 AAGTGGAAACAGGATCACCATGG + Intergenic
1052289982 9:26829450-26829472 AAGTACTTACAGAATCAGGAAGG + Intergenic
1052498883 9:29262848-29262870 AAGTAGAAAGAAAATCACAATGG - Intergenic
1052972430 9:34385226-34385248 AAGTTGACATAGAATCAGGATGG + Intronic
1053421116 9:37979258-37979280 AAGCAGAAACATTAACAGGATGG + Intronic
1053585878 9:39458182-39458204 AAATAATAACAGAATCAGGAGGG + Intergenic
1054580428 9:66907040-66907062 AAATAATAACAGAATCAGGAGGG - Intronic
1054783245 9:69185465-69185487 CAATAGATACAGAATCTGGAAGG - Intronic
1054853986 9:69878440-69878462 ATGCTGAAACAGAATCAGGCAGG - Intronic
1054923278 9:70563090-70563112 AAGTGGAAACAGAAACATTAAGG - Intronic
1055116608 9:72612010-72612032 AAATCCAAACAGAAGCAGGAGGG - Intronic
1055178889 9:73358125-73358147 AAGTAGAAACAGAAACATTTTGG - Intergenic
1055367195 9:75557145-75557167 AAGAAGATAAAGAATGAGGAAGG + Intergenic
1055457959 9:76490674-76490696 AAGTACTTACAGAATCAGGAAGG - Intronic
1055493493 9:76829959-76829981 GAATAGAAACAGAATCAGAGGGG + Intronic
1056586222 9:87929104-87929126 AAGTAGAAGCAGGTTCAGAAGGG - Intergenic
1056610660 9:88123839-88123861 AAGTAGAAGCAGGTTCAGAAGGG + Intergenic
1056918183 9:90762715-90762737 AATTAGAAACAATATCAGTAGGG - Intergenic
1057023840 9:91721285-91721307 AGGAAGCCACAGAATCAGGAAGG + Intronic
1057411730 9:94822255-94822277 AAGCTGAAACAGCAGCAGGAGGG + Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058593967 9:106595025-106595047 AAGTAAAAACAAAATGAAGAAGG - Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1059772300 9:117438813-117438835 AAATAGGAACAGCATCAGGAAGG + Intergenic
1060232795 9:121838153-121838175 AAGGAAAAACAGAATTGGGAAGG - Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061156189 9:128863197-128863219 AAGTAGACACACAAGGAGGAGGG + Intronic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186115178 X:6297800-6297822 ATGTGGAAACAGAACGAGGAAGG + Intergenic
1186424839 X:9455700-9455722 AAGTAGAAAGAGAAGGAGAAAGG - Intergenic
1186679728 X:11859711-11859733 AACAAAAAACAGAAGCAGGATGG - Intergenic
1186899643 X:14040052-14040074 AAGTAGTGACACAACCAGGAAGG - Intergenic
1187839430 X:23471517-23471539 AAGTAGTAACAGAATGAAGCAGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1189034422 X:37480915-37480937 AAGTACTTACAGAACCAGGAAGG + Intronic
1189105791 X:38233903-38233925 AAGCAGCAACAGAATCAGTAAGG - Intronic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189504041 X:41593306-41593328 AAGTAAGAACTGAAGCAGGAGGG + Intronic
1189834028 X:45003088-45003110 AAGTACTTACAGAACCAGGAAGG - Intronic
1189907582 X:45777375-45777397 AAAGAGAAACAGGATAAGGAAGG + Intergenic
1189923423 X:45926890-45926912 AACTAGAAAGAAAATCAGCAAGG - Intergenic
1190827116 X:54027917-54027939 AGGTAGAAAAAAAAACAGGAAGG + Intronic
1191890053 X:65930732-65930754 ACGTACTTACAGAATCAGGAAGG - Intergenic
1191900103 X:66032108-66032130 AAGAGGAAACAGAGTCAGAAAGG - Intronic
1192121137 X:68457099-68457121 AAGTAAAAAAAGAAGCAGGATGG + Intergenic
1192125384 X:68497171-68497193 TTGTAGAAAGAAAATCAGGAAGG - Intergenic
1192139396 X:68634666-68634688 AAGATGAAACAGATTCATGAAGG + Intergenic
1192257565 X:69476197-69476219 AAGTAGAAAGAAAATTAGTAAGG + Intergenic
1192354251 X:70385154-70385176 AGGTAGAAAAATAATTAGGATGG + Intronic
1192482291 X:71496014-71496036 AAGTACTTACAGAATCAGGAAGG - Intronic
1193879632 X:86906182-86906204 AAGTAGACACAAAAGCAGTAAGG + Intergenic
1194158070 X:90417928-90417950 AATTAGAAAGGGAAGCAGGATGG + Intergenic
1194432606 X:93828601-93828623 AAGTAGACAGAAAATCAGCAAGG - Intergenic
1194858158 X:98959977-98959999 CAGAAGAAACAGAAACAAGATGG + Intergenic
1194942492 X:100028082-100028104 AAGTATAAAGAAAATCTGGATGG - Intergenic
1195847040 X:109240123-109240145 AAGTACTTACAGAACCAGGAAGG - Intergenic
1196002790 X:110804709-110804731 AAGCAGCATCAGAATCTGGAAGG + Intergenic
1196126901 X:112110679-112110701 AAGTACTTACAGAATCAGGAAGG - Intergenic
1196360076 X:114842972-114842994 AAGTAGCAACAACTTCAGGAAGG + Intronic
1196906304 X:120439858-120439880 AAGTGGAAACAGGATCAGGAAGG + Intronic
1197137963 X:123084776-123084798 ATATACAAACATAATCAGGAGGG - Intergenic
1197662179 X:129186250-129186272 TAGTTGAATCAGAATCAGAATGG + Intergenic
1198460861 X:136861758-136861780 AAGTAAAAACAAAATGAGGAGGG + Intronic
1198742328 X:139854195-139854217 AAGTACTTACAGAATCAGGAAGG + Intronic
1199937907 X:152595148-152595170 AAGGAGAAACAGACACAGGCAGG - Intergenic
1200343944 X:155429363-155429385 ATGAGGAAACAGAATCAGGTGGG - Intergenic
1200711594 Y:6489614-6489636 ATGTACTTACAGAATCAGGAAGG + Intergenic
1200763419 Y:7060730-7060752 AAGTACTTACAGAACCAGGAAGG - Intronic
1200945527 Y:8831646-8831668 AAGTACTTACAGAATCAGAATGG + Intergenic
1201022339 Y:9672365-9672387 ATGTACTTACAGAATCAGGAAGG - Intergenic
1201271739 Y:12262394-12262416 AAGTACTTACAGAATCAGGAAGG - Intergenic
1201297298 Y:12474795-12474817 AAGTACATACAAAACCAGGAAGG - Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201568175 Y:15387807-15387829 AAGTACTTACAGAATCAGGACGG - Intergenic
1201648550 Y:16261762-16261784 AAGTACTTACGGAATCAGGAAGG - Intergenic
1201654260 Y:16323539-16323561 AAGTACTTACGGAATCAGGAAGG + Intergenic
1201900040 Y:19039808-19039830 AAGTACCTACAGAATCAGGAAGG - Intergenic
1202074411 Y:21023966-21023988 AAGTACATACAGAATCAGGAAGG - Intergenic
1202089673 Y:21176709-21176731 AAGTACTTACAGAATCAGGAAGG - Intergenic