ID: 1147007312

View in Genome Browser
Species Human (GRCh38)
Location 17:37413942-37413964
Sequence GAGGGTGAACAGTGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4841
Summary {0: 1, 1: 26, 2: 325, 3: 1373, 4: 3116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147007312_1147007318 -10 Left 1147007312 17:37413942-37413964 CCCTCCTCCCACTGTTCACCCTC 0: 1
1: 26
2: 325
3: 1373
4: 3116
Right 1147007318 17:37413955-37413977 GTTCACCCTCAAGAAGGCCCTGG 0: 1
1: 1
2: 34
3: 211
4: 537

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147007312 Original CRISPR GAGGGTGAACAGTGGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr