ID: 1147012724

View in Genome Browser
Species Human (GRCh38)
Location 17:37464507-37464529
Sequence GCAGGAACTGCTGGCAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147012724_1147012732 11 Left 1147012724 17:37464507-37464529 CCATTACTGCCAGCAGTTCCTGC 0: 1
1: 0
2: 2
3: 16
4: 188
Right 1147012732 17:37464541-37464563 TTAAAAGACAGTGAGGTGGCCGG 0: 1
1: 0
2: 5
3: 46
4: 405
1147012724_1147012733 12 Left 1147012724 17:37464507-37464529 CCATTACTGCCAGCAGTTCCTGC 0: 1
1: 0
2: 2
3: 16
4: 188
Right 1147012733 17:37464542-37464564 TAAAAGACAGTGAGGTGGCCGGG 0: 1
1: 0
2: 7
3: 91
4: 556
1147012724_1147012731 7 Left 1147012724 17:37464507-37464529 CCATTACTGCCAGCAGTTCCTGC 0: 1
1: 0
2: 2
3: 16
4: 188
Right 1147012731 17:37464537-37464559 TAGTTTAAAAGACAGTGAGGTGG 0: 1
1: 0
2: 2
3: 28
4: 271
1147012724_1147012734 17 Left 1147012724 17:37464507-37464529 CCATTACTGCCAGCAGTTCCTGC 0: 1
1: 0
2: 2
3: 16
4: 188
Right 1147012734 17:37464547-37464569 GACAGTGAGGTGGCCGGGCGCGG 0: 1
1: 3
2: 13
3: 96
4: 753
1147012724_1147012730 4 Left 1147012724 17:37464507-37464529 CCATTACTGCCAGCAGTTCCTGC 0: 1
1: 0
2: 2
3: 16
4: 188
Right 1147012730 17:37464534-37464556 GTGTAGTTTAAAAGACAGTGAGG 0: 1
1: 0
2: 1
3: 24
4: 211
1147012724_1147012735 20 Left 1147012724 17:37464507-37464529 CCATTACTGCCAGCAGTTCCTGC 0: 1
1: 0
2: 2
3: 16
4: 188
Right 1147012735 17:37464550-37464572 AGTGAGGTGGCCGGGCGCGGTGG 0: 1
1: 20
2: 162
3: 1240
4: 5814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147012724 Original CRISPR GCAGGAACTGCTGGCAGTAA TGG (reversed) Intronic
900723294 1:4194727-4194749 GCAGGAACTGGTGCCAGGAAAGG - Intergenic
902519706 1:17009237-17009259 GCAGGTACTGTGAGCAGTAAGGG - Intronic
902880987 1:19371729-19371751 GGAGGAACTGCAGGCGGTAGGGG - Intronic
904695703 1:32329836-32329858 GAAGGAGGTGATGGCAGTAAGGG + Intronic
904741955 1:32684364-32684386 GCAGGAACAGCTGGAGGAAATGG - Exonic
908093266 1:60708924-60708946 GCTGGAACTGCTGGGACTACAGG - Intergenic
908162099 1:61420493-61420515 TCAGTGACTCCTGGCAGTAAAGG - Intronic
908549375 1:65193593-65193615 TCAGTATCTGCTGACAGTAAGGG + Intronic
909921997 1:81393453-81393475 GCAGGAACTGTTAGCTGTAGAGG - Intronic
910315184 1:85874674-85874696 GTTGGAACTGCTGGCAGTGTTGG - Exonic
910699135 1:90053447-90053469 CCAGCAACTGGTGGGAGTAAGGG + Intergenic
914240074 1:145847345-145847367 GCAGGTAGGGCTGGCAGTGAGGG + Exonic
916316928 1:163459408-163459430 CCAGGACATGCTGGGAGTAATGG + Intergenic
919816660 1:201445122-201445144 GCAGGGACTGCAGGCAGAAAGGG + Intergenic
920011472 1:202870962-202870984 GCACAAACTGCTGGCATTACAGG - Intergenic
921180996 1:212631005-212631027 GCAGGGACTGTTGGTTGTAAAGG + Intergenic
923459622 1:234197011-234197033 GCAATAACTGCTGTCAGTAAAGG + Intronic
924897473 1:248357332-248357354 GCAGCAACTGCAGGCAGCAGGGG - Intergenic
1069881640 10:71597179-71597201 GCAGGAACCGATGGCAGTCCTGG + Intronic
1070841737 10:79492220-79492242 GAAGGACTTGCTGGGAGTAAGGG - Intergenic
1072528738 10:96298215-96298237 GCAGGAAAGGGTGGCAGGAAGGG - Intergenic
1077579885 11:3410146-3410168 ACCAGAACTGCTGGCAGAAAGGG + Intergenic
1077663897 11:4091799-4091821 GCAGGATGGGGTGGCAGTAAAGG + Exonic
1078786042 11:14493708-14493730 GCACGAATAGCTGGCATTAAAGG + Exonic
1081765679 11:45608392-45608414 GGAGGAAGAGCTGGGAGTAAAGG + Intergenic
1082874863 11:57977877-57977899 GCAGGGACTGTTGGCAGCAGTGG + Intergenic
1083282288 11:61634618-61634640 GCAGCAACTGCTGGCAGATCAGG + Intergenic
1084236799 11:67792990-67793012 ACCAGAACTGCTGGCAGAAAGGG + Intergenic
1084291437 11:68172064-68172086 GCAGGGACCAGTGGCAGTAAGGG + Intronic
1084473450 11:69376076-69376098 GCAGGAACTGCAGGCAGGCGTGG - Intergenic
1084835597 11:71799842-71799864 ACCAGAACTGCTGGCAGAAAGGG - Exonic
1087829911 11:102808247-102808269 GCTGGAGCTGCTGGCAGTGGTGG - Intergenic
1088185442 11:107162461-107162483 CTAGGAAATGCTGGCAGTAGGGG + Intergenic
1090274519 11:125410183-125410205 GCAGGAGGTCCTGGCAGTGAGGG - Exonic
1090462086 11:126900332-126900354 GCCGGAACTGCTTGCACTCAAGG - Intronic
1090510494 11:127369590-127369612 CAAGGAACTGCTGTCAGTTAGGG + Intergenic
1090885979 11:130877246-130877268 GGAGGAATTGCTGGTAGAAAAGG - Exonic
1094459768 12:30682967-30682989 GCAGCTACTACTGGCACTAAAGG - Intronic
1094699192 12:32852259-32852281 GCATAAACTGCTGGTAGTTAGGG - Intronic
1098283868 12:68888661-68888683 GCAGGAACTTTTGGGAATAAAGG - Intronic
1098861065 12:75710810-75710832 GCAGGAAAGGCAGGAAGTAAGGG - Intergenic
1106557054 13:30818805-30818827 GTAGGAACAGCTGGAAATAAGGG - Intergenic
1106922829 13:34582207-34582229 GAATAAACTGTTGGCAGTAATGG + Intergenic
1108505751 13:51110942-51110964 GCAGGTACTGCAGGCAGTCCTGG + Intergenic
1110552002 13:76820978-76821000 GTGGGAATTGCTGGCAGAAATGG - Intergenic
1112541472 13:100317897-100317919 GCAGGGACTGATGGCAAGAATGG - Intronic
1113464853 13:110505946-110505968 GCATGAAATGATGGCAGTGAGGG - Intronic
1114632004 14:24165041-24165063 GGAGGATCTGCTGGCAGATAGGG - Intronic
1120840795 14:89083223-89083245 GCTGGAGCTGGTGGCAGTAAGGG + Intergenic
1121347912 14:93149706-93149728 GCAGGGACTGCTGGCAGCCCTGG + Intergenic
1121716363 14:96078828-96078850 GCAGGAACTGCTGGGAGGCTGGG - Intronic
1122944268 14:104998780-104998802 GCAGGGACAGCTGGCAGGACAGG + Intronic
1125549692 15:40536283-40536305 GCTGCAACTGCTGGGAGGAAGGG + Intronic
1126440238 15:48680234-48680256 GCAGTAACTGCTTGCTGTACAGG - Intergenic
1132650176 16:1017659-1017681 TCACGCACTGCTGGCAGGAATGG - Intergenic
1132892124 16:2209643-2209665 CCAGGAGCTGCTGGCAGTGCAGG - Exonic
1133348395 16:5085429-5085451 ACCAGAACTGCTGGCAGAAAGGG + Exonic
1135432857 16:22401316-22401338 GCAGGAACTGCAGTAGGTAATGG - Intronic
1136411280 16:30078893-30078915 TCAGGACCTGCCTGCAGTAACGG - Intronic
1136428087 16:30182812-30182834 GCAGCAACAGCGGGCAGGAAAGG - Intronic
1137231447 16:46570795-46570817 TCAGGTACTTCTGGAAGTAAAGG - Intergenic
1137289931 16:47045537-47045559 CCAGGAAGTGCTGTCCGTAATGG + Intergenic
1138157713 16:54721390-54721412 GAAGGAAGTGGTGGCAGAAAAGG + Intergenic
1138189720 16:55004451-55004473 GAAGGTGCTGCTGGCATTAACGG + Intergenic
1138311524 16:56027597-56027619 TCAGGTACTGCTGGCAGGAATGG - Intergenic
1140722828 16:77786932-77786954 GCAGGTTCTTCTGGCAGAAAAGG - Intergenic
1140768034 16:78178099-78178121 TCAGGAAGTGCTGACAGTGAAGG + Intronic
1141223254 16:82091190-82091212 TCAGTAACTGCTGACAGTAGGGG + Intronic
1144996306 17:19271606-19271628 GCAGGGACTGGTGGTAGTGATGG - Intronic
1145074597 17:19841662-19841684 GAAGGGACTGCTGACAGGAAAGG + Intronic
1145234303 17:21197912-21197934 GCAGCAGCTGCGGGCAGTCATGG + Exonic
1145245150 17:21264133-21264155 GCAGGAAGTGCTGGGATTACAGG - Intergenic
1146384835 17:32360900-32360922 GGAGGAACACCTGGCATTAATGG - Exonic
1147012724 17:37464507-37464529 GCAGGAACTGCTGGCAGTAATGG - Intronic
1147183469 17:38701566-38701588 GGAGGAACTGGTGGGAGTGAGGG - Intergenic
1147491659 17:40873668-40873690 ACAGTAACTGCTGGCAGAACTGG + Intergenic
1148201017 17:45750093-45750115 GCAGGAGCAGCAGGCAGTATGGG - Intergenic
1148504017 17:48113314-48113336 ACAGGAAGTCTTGGCAGTAAAGG - Exonic
1148835243 17:50462528-50462550 ACAGGAACTGCTGGTTGTATTGG - Exonic
1150119150 17:62585142-62585164 GCAGGACTTGCTGGCAGTGGTGG + Intronic
1156096646 18:33540897-33540919 CCAGGAAATGCTGGGACTAAAGG - Intergenic
1156941392 18:42770866-42770888 ACATGAAATGATGGCAGTAATGG - Intronic
1160042849 18:75361094-75361116 GCAGGACCAGCTGGCCGTGAGGG + Intergenic
1163429123 19:17256470-17256492 GCAGGACCTGGTGGCCGCAAGGG - Exonic
1164158361 19:22610279-22610301 GGAGGGGCTGCTGGCAGTGATGG - Intergenic
1166720610 19:44993921-44993943 GCAGGGGCAGCTGGCAGGAAAGG - Intergenic
1167000313 19:46741880-46741902 TCAGCAGCTGCTGGCAGGAATGG + Intronic
1167597377 19:50434894-50434916 GCAGGGCCTGCTGGGGGTAAGGG + Intronic
1167651930 19:50736159-50736181 GAAGGAACTGCCTGCAGTAAAGG - Intergenic
1168354845 19:55694730-55694752 GCTGGAGCTGCTGGCAGGAGAGG + Exonic
930002366 2:46869858-46869880 GAAGGACTTGCTGGCTGTAACGG + Intergenic
930287224 2:49445786-49445808 GGAGTAAATGCTGGCAGCAAAGG - Intergenic
932083929 2:68740536-68740558 GTAGGAACTGGTGGTGGTAAGGG - Intronic
932318318 2:70801208-70801230 GCAGGAATTGCTGGCTGGCAAGG + Intergenic
934514211 2:94974755-94974777 GCAGGAAGTGCTGGTTGTGATGG + Intergenic
935382833 2:102470368-102470390 CCAGTAACTGCTGGCTGAAATGG + Intergenic
937912387 2:127081900-127081922 GCAGGCTCTGCTGGGAGGAAGGG - Intronic
938323375 2:130380666-130380688 GAAGGAATTGTTGGCATTAAAGG + Intergenic
938879564 2:135571058-135571080 CCAGGAATTTCTGGCAGTATAGG - Intronic
940525888 2:154813034-154813056 GCAGAAACTGATGTTAGTAAGGG + Intronic
941674428 2:168328692-168328714 GCAGGCACTGCTGGCATGAATGG + Intergenic
943529162 2:189057327-189057349 GCAGGAACTCCTGGCCCCAAGGG - Exonic
943862208 2:192881953-192881975 GCAGGAACTGATAGCAGTAGAGG - Intergenic
944842268 2:203635513-203635535 GGAGGAACACCTGGCATTAATGG + Intergenic
948881187 2:240857985-240858007 GCAAGCACTGCTGGCAGAGAGGG + Intergenic
948941082 2:241196899-241196921 GCAGGGACTTCTGGGAGTAGGGG + Intronic
949069356 2:242014144-242014166 GCAGACACTGCAGGCACTAAAGG - Intergenic
1170949285 20:20921446-20921468 GCACCAACTGCTGGTGGTAATGG + Intergenic
1172386120 20:34535330-34535352 GCAGGAAAAGCTGGCTGTAAGGG - Intronic
1173788728 20:45813604-45813626 GGAGGGACTGCTGGAAGAAATGG - Intronic
1174898193 20:54472698-54472720 CCAGGAGCTGCTGGCACAAATGG - Intergenic
1175847836 20:62067921-62067943 GCAGGAACTGCGAGAAGTTAAGG + Intergenic
1177233321 21:18351440-18351462 GCAGGACCTGGTGGGAGTGATGG + Intronic
1177291829 21:19122541-19122563 GCAGGTCCATCTGGCAGTAAAGG + Intergenic
1179913343 21:44461400-44461422 GCAGGGGCTGCTGGCAGGAGGGG + Exonic
1180068341 21:45423990-45424012 GCAGGACCTGCTGGCAGGACAGG - Intronic
1180914010 22:19472645-19472667 GAAGGAACTGATGGTAGTGATGG + Intronic
1180959774 22:19757273-19757295 GCAGGACCTGCAGGCAGGCAGGG - Intronic
1181600625 22:23949809-23949831 ACAGGAACTGCGGGCAGGAATGG - Intergenic
1181607886 22:23991513-23991535 ACAGGAACTGCGGGCAGGAATGG + Intergenic
1181811809 22:25407750-25407772 GCAGAAACTGCTGGCAAGAGTGG - Intergenic
1182432241 22:30306194-30306216 ACAGGAAGTTCTGGCAGTTATGG + Intronic
1184089695 22:42285834-42285856 GCAGGAAGTGGTGGGAGTAGGGG - Intronic
950769483 3:15300345-15300367 TCATGAAATGCTGGCAGTCAAGG - Intronic
951540977 3:23781480-23781502 CCAGGTCCTGCTGGCAGCAAAGG - Intergenic
951928516 3:27937104-27937126 GCAGAAACTGCTGTGATTAAAGG + Intergenic
953245221 3:41184816-41184838 GCTGGCAGTGCTGGCAGTACTGG + Intergenic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
954787851 3:53108004-53108026 GCTGGAACTGTTAGCAGTGAGGG - Intronic
956359297 3:68429461-68429483 GTGGGAACTGCTGGAAATAATGG + Intronic
957052755 3:75422758-75422780 ACCAGAACTGCTGGCAGAAAGGG + Intergenic
959473906 3:106786354-106786376 GCATGAACTCCTGGAAGTAGGGG + Intergenic
961302097 3:125928776-125928798 ACCAGAACTGCTGGCAGAAAGGG - Intergenic
961474480 3:127138210-127138232 CCAGGAACTGGTGGCAGTAAGGG - Intergenic
961586918 3:127937144-127937166 GCAAGAACTGGTGGAAATAATGG + Intronic
961886377 3:130099055-130099077 ACCAGAACTGCTGGCAGAAAGGG + Intronic
962582249 3:136808846-136808868 CCAGAAACTGCTGGGAGAAAAGG - Intergenic
964563798 3:158027016-158027038 CCAGGAACTTCTGAAAGTAATGG + Intergenic
966103383 3:176304280-176304302 GCAGGAACTGCGGGGAGTGGAGG + Intergenic
966768804 3:183485827-183485849 TCAGTAACTGCTGACAGTAGCGG - Intergenic
967961687 3:194930549-194930571 GCAGGCACGGCTGTTAGTAAAGG - Intergenic
968506959 4:975172-975194 GCAGAAAGTTCTGGCAGAAATGG - Intronic
968524501 4:1049162-1049184 GCAGGAGCTGCTGGCTGTGCTGG - Intergenic
968995544 4:3943069-3943091 ACCAGAACTGCTGGCAGAAAGGG + Intergenic
969758433 4:9165636-9165658 ACCAGAACTGCTGGCAGAAAGGG - Intergenic
969818410 4:9703177-9703199 ACCAGAACTGCTGGCAGAAAGGG - Intergenic
971760567 4:30759424-30759446 TCAGGAAATTCTGGGAGTAAAGG + Intronic
972920430 4:43933777-43933799 GATGGAACTTCTGGAAGTAATGG + Intergenic
978386591 4:108181848-108181870 TCAGGAACTGGGGGCAGTATTGG + Intergenic
979570083 4:122212141-122212163 GCAGGAAGTGCTGGCTGAACTGG + Intronic
983316133 4:166134622-166134644 CCAGGAACTGCACGGAGTAAGGG - Intergenic
985965193 5:3334036-3334058 CCTGGCAATGCTGGCAGTAAGGG + Intergenic
991082256 5:62614437-62614459 GGAAGTGCTGCTGGCAGTAATGG + Intronic
992603141 5:78425616-78425638 GCAAGAACTGTTGGTAGAAAAGG - Intronic
993338312 5:86689611-86689633 GCAGGAACTGTTTTCAGTAATGG - Intergenic
996377364 5:122826066-122826088 GAATGAAGTGCTGGCAGAAATGG + Exonic
997521030 5:134524879-134524901 GCAGAAAGTGCTGGCAGGAGGGG - Intronic
998380437 5:141721119-141721141 GCAGGAACTGCTGTAAATATAGG + Intergenic
1000773578 5:165388554-165388576 GCAGGCACACATGGCAGTAATGG - Intergenic
1001452127 5:171835013-171835035 TCAGGAAGGGCTGGCAGTGATGG + Intergenic
1002279419 5:178121932-178121954 GCAGGAACTGCGGGCACTGCGGG + Exonic
1002567871 5:180122239-180122261 GCTGCAGCTGCTGGGAGTAATGG + Intronic
1003351258 6:5319601-5319623 GCAGGAACAGAAGGAAGTAAAGG - Intronic
1010452501 6:76018625-76018647 GCTGGAACTGTTCGCCGTAAGGG + Intronic
1010464521 6:76151288-76151310 GCAGGGACGGCTGGCAGGGATGG + Intergenic
1012463490 6:99490826-99490848 GCAGGAAGTGCTGGGATTACAGG + Intronic
1014055369 6:117008422-117008444 GCATGAAATGCTGGCTGCAATGG + Intergenic
1014462353 6:121711709-121711731 GAAGGAACTGCGGGCAGAAGTGG + Intergenic
1018329991 6:162717107-162717129 GCAAGATTTGATGGCAGTAAAGG + Intronic
1018737527 6:166698712-166698734 GAAGAAGCTGCTGGCAGGAAGGG + Intronic
1019642049 7:2108813-2108835 GCAGGAGCGGCTGTCAGAAATGG + Intronic
1020280654 7:6648355-6648377 CCAGGACCTGATGGCAGGAAAGG + Intronic
1020319827 7:6931478-6931500 ACCAGAACTGCTGGCAGAAAGGG + Intergenic
1022042654 7:26595099-26595121 GCAGGAGTTCCTGGCAGTGAAGG + Intergenic
1022312536 7:29210703-29210725 ACAGGAAATGCTGGGGGTAAGGG + Intronic
1022521624 7:31011870-31011892 GCTGGAACTCCTGTTAGTAAGGG + Intergenic
1022591253 7:31665621-31665643 GCAGGAACTACTAGCAGAAGAGG - Intergenic
1022845887 7:34209463-34209485 GGAGGAACTGCAGGCAGTTCTGG - Intergenic
1025015884 7:55438897-55438919 GCAGGACTTCCTGGCAGTCAGGG + Intronic
1026598583 7:71754428-71754450 GCAGGAAGTGGTCGAAGTAAGGG - Intergenic
1028455297 7:91031882-91031904 GCAGCACCTGCTGGGAGAAAAGG + Intronic
1028784954 7:94781924-94781946 TCAGTAACTACTGACAGTAAGGG - Intergenic
1029682325 7:102120087-102120109 GCAGGAACTTGGGGCAGTGAGGG - Intronic
1031427777 7:121628012-121628034 GCAGGAAATGATGGGAGGAAGGG - Intergenic
1036165980 8:6434073-6434095 GAAGGAACTGCTGGTATAAACGG - Intronic
1036848094 8:12183404-12183426 ACCAGAACTGCTGGCAGAAAGGG + Exonic
1036869456 8:12425687-12425709 ACCAGAACTGCTGGCAGAAAGGG + Exonic
1039593125 8:38767498-38767520 TCAGGAATAGCTGGCAATAATGG + Intronic
1039945842 8:42128462-42128484 GCAGGAACTGGAGGCACCAAGGG - Intergenic
1043337204 8:79191204-79191226 ACAGGAACTGCTGCCACTATTGG + Intergenic
1047773589 8:128050166-128050188 TCAGGAACTGCTGGCTGGAATGG - Intergenic
1048399094 8:134046906-134046928 GCAGGAAATGCAGAAAGTAATGG + Intergenic
1048699604 8:137074150-137074172 GAAGGAACTGCCCTCAGTAATGG + Intergenic
1052398827 9:27974907-27974929 TCAGGAAATGCTTGCTGTAAGGG + Intronic
1060650666 9:125323866-125323888 GCAGGACCTTCTGGCAGTAATGG + Exonic
1061530448 9:131207901-131207923 GAAGGAGCTGTTGGCAGTGATGG + Intronic
1185529903 X:809332-809354 CCAGGAACTGCTGCTAATAAGGG - Intergenic
1187387134 X:18859227-18859249 TCAGGCATTGCTGACAGTAATGG - Intergenic
1190013654 X:46807488-46807510 GCATGAACTGCTGGTAGTCAAGG + Intergenic
1190297114 X:49034171-49034193 GCAGGAGTTGCTGACAGTGATGG + Exonic
1190480527 X:50872310-50872332 TCAGCAGCTGCTAGCAGTAAGGG + Intergenic
1190900888 X:54672174-54672196 GCAGAAACTGCTGCCAAGAATGG + Intergenic
1190915691 X:54809542-54809564 GCAAGAACTGATGGCAGAAGAGG - Intronic
1192264934 X:69531512-69531534 ACAGGCCCTGCTGGCACTAAAGG - Exonic
1196015364 X:110934209-110934231 ACAGGAACTGCCGGCAATCAAGG - Intergenic
1196462154 X:115942642-115942664 GCAGGCACTGCAGCCAGTAAAGG + Intergenic
1196910371 X:120478763-120478785 CTAGGCACTGCTGGCAGTACCGG - Intergenic