ID: 1147015541

View in Genome Browser
Species Human (GRCh38)
Location 17:37489318-37489340
Sequence CCGTGGCGCCCGAGACCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147015541_1147015548 11 Left 1147015541 17:37489318-37489340 CCTCCGGGTCTCGGGCGCCACGG No data
Right 1147015548 17:37489352-37489374 TGTTCCAGCAAGCGTCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147015541 Original CRISPR CCGTGGCGCCCGAGACCCGG AGG (reversed) Intergenic
No off target data available for this crispr