ID: 1147015631

View in Genome Browser
Species Human (GRCh38)
Location 17:37489677-37489699
Sequence GGCTGCTGCCTCGGGAGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147015622_1147015631 11 Left 1147015622 17:37489643-37489665 CCAGGGGACCTGCACGGAGGAGC 0: 1
1: 0
2: 1
3: 21
4: 204
Right 1147015631 17:37489677-37489699 GGCTGCTGCCTCGGGAGCTAGGG 0: 1
1: 0
2: 1
3: 29
4: 173
1147015623_1147015631 3 Left 1147015623 17:37489651-37489673 CCTGCACGGAGGAGCGCTCTAGG 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1147015631 17:37489677-37489699 GGCTGCTGCCTCGGGAGCTAGGG 0: 1
1: 0
2: 1
3: 29
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147015631 Original CRISPR GGCTGCTGCCTCGGGAGCTA GGG Intergenic
900095698 1:939281-939303 TGCTGCTGCCGCGGGAGCTGGGG + Exonic
900123260 1:1058604-1058626 GGGTGCTGCCTGAGGAGCTGTGG + Intergenic
900931327 1:5739731-5739753 GGCTGCTGCCTCGAGTGGGATGG + Intergenic
901481273 1:9527019-9527041 GGCTGAAGCCTGGGGAGCCAGGG - Intergenic
906416491 1:45624066-45624088 GGTTGCTGTCCAGGGAGCTAAGG - Intergenic
907461454 1:54608030-54608052 GGCTTCTGCCTCTGGCGCGAGGG + Exonic
910330534 1:86068298-86068320 GGCTGCTGCCAGGGGAGATGGGG - Intronic
910759040 1:90717721-90717743 GGCTGCCACCTCGGGAGCCGCGG - Intergenic
913189954 1:116405057-116405079 GGCTGCTGCCTGGGGTGATAGGG + Intronic
913450180 1:118987826-118987848 GGCTGCTCCCTCGGTAGCGGGGG - Intronic
913615583 1:120557213-120557235 GCCTGCTCCCTCGGGGGCTCTGG + Intergenic
914574692 1:148953689-148953711 GCCTGCTCCCTCGGGGGCTCTGG - Intronic
918250241 1:182696926-182696948 GTCTGCTGGCTAGGGTGCTAGGG + Intergenic
919822865 1:201483901-201483923 GGCCGCAGCCTCAGGAGCCAGGG + Exonic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
923107166 1:230863653-230863675 GCCTGCTGCCCTGGGAGCTCAGG - Intronic
1067415266 10:46097640-46097662 GGCTGCCGCATCTTGAGCTAGGG - Intergenic
1067750668 10:48969216-48969238 AGCTGCTGCTTGGGGAGCTACGG + Exonic
1068950172 10:62769019-62769041 GGCTGCTGCCTAGTTAGCAATGG + Intergenic
1070776592 10:79113398-79113420 TGCTGCTGCCCGGGCAGCTAGGG + Intronic
1072740774 10:97907825-97907847 GGCTGGAGCCAAGGGAGCTAAGG + Intronic
1074494133 10:113964268-113964290 GGCTGCAGCTTCGGGAGGAATGG + Intergenic
1074682006 10:115916763-115916785 AGCTGCAGCCTTGGGAGCTCAGG + Intronic
1075715184 10:124551531-124551553 GGCTGGTGCGTGGGGAGGTAAGG + Intronic
1076116949 10:127907395-127907417 GGCCGCTGCCGCGGGAGGGAGGG + Intronic
1076157198 10:128213051-128213073 GGCTGCTGCCTTGGGAGTGACGG + Intergenic
1076726726 10:132417330-132417352 TGCTGCTGCCTCGCGCGCTGGGG + Exonic
1076831530 10:132996725-132996747 GGCTGCTGTGGCGGGAGCTGTGG + Intergenic
1076848992 10:133083834-133083856 GGCTGCTGCCTCCGTAGGGAAGG - Intronic
1076851780 10:133096816-133096838 GGGGGCTGCCTGGGGAGGTACGG - Intronic
1079460257 11:20671999-20672021 GGCTGTTGCCTAGGGAGCTTGGG + Intronic
1083747618 11:64744582-64744604 GGCAGCGGCCACGAGAGCTAAGG - Intronic
1084104989 11:66975344-66975366 GCCTGCAGCCTCCGGAGCCATGG + Exonic
1084307821 11:68298366-68298388 GGCGGCGGCCTCGGGAGCAGTGG - Intergenic
1085624856 11:78064099-78064121 GGCTGCTGCCGCGGGAGGAGTGG + Exonic
1089947074 11:122487112-122487134 TGCTGGTGCCTCAGGAGCTTGGG - Intergenic
1090332648 11:125943763-125943785 CCCTGCTGCCTCGGGAGGTGAGG - Intergenic
1091615462 12:2047809-2047831 GGCTGCTGCCTCTGCATCTGAGG + Intronic
1092100682 12:5881384-5881406 AGCTGCTGCCCCTGGAGCCAAGG + Intronic
1092656479 12:10690098-10690120 GGCTGCTGCTTCTGGAGTTGAGG + Intergenic
1092778369 12:11963707-11963729 GGCTAGTGCCTCTGGAGATAAGG - Intergenic
1093980375 12:25469292-25469314 GGCTGCTGCCTCCTGATCAACGG - Intronic
1103542955 12:121679015-121679037 GGCTGCTGGCTAGGTACCTAAGG - Intergenic
1103565245 12:121812054-121812076 GGCTGAGGCCCCGGGAGCGAGGG + Intronic
1104602451 12:130162675-130162697 GGCCGCTGCGCCGGGAGCTCCGG + Exonic
1105246328 13:18654332-18654354 GGCTGCTTCCTCCAGAGGTAAGG + Intergenic
1107418779 13:40225885-40225907 TGCTGCTGCCTTGTCAGCTAAGG + Intergenic
1107592180 13:41920013-41920035 GTCTACTGCCTCGGGAGGTGGGG - Intronic
1112643727 13:101306167-101306189 GTCTGCAGCCTCGGGAGCTCTGG - Intronic
1114056919 14:18978252-18978274 GGCTGCTGCTTTGGGAACAATGG - Intronic
1114105627 14:19423494-19423516 GGCTGCTGCTTTGGGAACAATGG + Intronic
1114533587 14:23409868-23409890 GGCAGCGTCCTAGGGAGCTAGGG - Intergenic
1121413603 14:93763890-93763912 GGCTGGTGCCTCTGGAGTTGAGG - Intronic
1122233906 14:100321432-100321454 GGCTTCTGGCTCAGGTGCTATGG + Intergenic
1124594472 15:31081658-31081680 GGCTGCTGCCTCTGTGGCTTTGG - Intronic
1125479148 15:40068901-40068923 GGCGGCTGTCTGGGGAGTTAAGG + Intergenic
1128480827 15:68036475-68036497 GGCTGCTGCCACCGGGGCTGAGG + Intergenic
1128514170 15:68331876-68331898 GGATGCTGCCTCGGAAGCCGTGG + Exonic
1129738625 15:77979156-77979178 GGCTGCAGACTGGGGAGCTAGGG - Intergenic
1129847447 15:78774458-78774480 GGCTGCAGACTGGGGAGCTAGGG + Intronic
1130254456 15:82319454-82319476 GGCTGCAGACTGGGGAGCTAGGG - Intergenic
1130600509 15:85270516-85270538 GGCTGCAGACTGGGGAGCTAGGG + Intergenic
1132608895 16:805349-805371 TGCTGCTGCTTCCGGGGCTAGGG + Intergenic
1132847034 16:2005429-2005451 GCCTGCTGCTTCGGGAGCTGTGG - Intronic
1133284875 16:4686018-4686040 GGCTGCGGCAGCGGGAGGTATGG + Intronic
1134290829 16:12901972-12901994 GGCAGCAGCCTCGGCAGCTTCGG + Exonic
1135620690 16:23952853-23952875 GGAAGCTGGCTCAGGAGCTATGG + Intronic
1136251471 16:29008400-29008422 GGCTGCTGGCTCTGGGGCTGTGG + Intergenic
1137268067 16:46884763-46884785 GGCTGCGGCCCCAGGAGCTGGGG - Exonic
1137590225 16:49688978-49689000 GTATGCTGTCTCGGGAGCCAGGG - Intronic
1137744681 16:50812145-50812167 GGCTGCTGCCTAGGGAGGCAGGG + Intergenic
1139357157 16:66373259-66373281 GGCTGCAGCCTCTGGAGATGTGG - Intronic
1142438980 16:90082215-90082237 GGCTGCGGCCTCGGGAGACATGG + Intronic
1145272304 17:21411239-21411261 GGCAGCTGCCACGTGACCTAAGG - Intronic
1145310509 17:21698704-21698726 GGCAGCTGCCACGTGACCTAAGG - Intronic
1145854084 17:28135366-28135388 GGCTGGAGACTCGGCAGCTAAGG - Intronic
1145856186 17:28160480-28160502 GGCTGGAGCCTGGGGAGCCATGG - Intronic
1147015631 17:37489677-37489699 GGCTGCTGCCTCGGGAGCTAGGG + Intergenic
1147427127 17:40351254-40351276 GGCTGCTGACGCGGGAGGAAGGG - Intronic
1148741824 17:49897422-49897444 GGCTCCTGCCTCAGGCCCTAAGG + Intergenic
1150338910 17:64349952-64349974 GGCTGCTGCCATGGGAGCTAAGG - Intronic
1151167727 17:72219518-72219540 GTCTGCTGCCCTGGGAGCAAGGG - Intergenic
1152174062 17:78775091-78775113 GTGTGATGCCTCGGGAGCTGGGG - Intronic
1152687343 17:81701096-81701118 GGCTGCTGCCCCGCGATGTAGGG - Exonic
1152795312 17:82303593-82303615 GGCTGTTGCCCCAGAAGCTAGGG + Intergenic
1152929860 17:83103985-83104007 GGCCTCTGCCTGGGGCGCTATGG + Intergenic
1154442533 18:14404793-14404815 GGCTGCTTCCTCCAGAGGTAAGG - Intergenic
1155002947 18:21704454-21704476 GGCTGCTGGGCCAGGAGCTAGGG - Intronic
1155297362 18:24397675-24397697 GGCCACCGCCTCGGGAGCTCTGG - Exonic
1158878161 18:61752402-61752424 GGATGCTGCCTCAGGAGGTGAGG - Intergenic
1158976474 18:62715638-62715660 GCCCGCTGCCTCCGGAGCTGGGG + Exonic
1160046967 18:75395363-75395385 GGCTGCTGCCACGTGACCTGGGG + Intergenic
1160957612 19:1700612-1700634 GGCTGCTGCCGAGGGAGATGAGG + Intergenic
1161619034 19:5288854-5288876 GGCTTCTGCCGTGGGAGCCAGGG - Intronic
1163223791 19:15940406-15940428 GACTGCAGCCTCGAGAGCTGTGG + Intergenic
1163586951 19:18169347-18169369 GGCTGCGGCGGCGGGAGCCACGG + Exonic
1164207677 19:23071422-23071444 GGCAGCTGCCGCTGGAGCTCCGG + Intergenic
1164562637 19:29303452-29303474 GGCTCCTGTCCCAGGAGCTATGG - Intergenic
1164582445 19:29442823-29442845 GGCTGCTCGCTCAGGAGCCAGGG - Intergenic
1165419230 19:35714877-35714899 AGCTGCAGCCTGGAGAGCTAAGG + Exonic
1165447155 19:35862616-35862638 GGCTGGGGCCTCGGGAGCCGGGG - Intronic
1165455319 19:35907456-35907478 GGCTGGTCCCTCGGGGGCGAGGG - Exonic
925176009 2:1784401-1784423 GGCTGCTGGCCTGGGAGCTGGGG - Intergenic
926112477 2:10192111-10192133 GGCTGCGGCTCCGGGAGCTCTGG - Intronic
933822139 2:86122841-86122863 GCCTGCTGCCTCAAGAGCTGGGG - Intronic
936981862 2:118272172-118272194 GGCTGCAGCCCCAGGAGCTCAGG - Intergenic
937857367 2:126682330-126682352 GACTGCAGTCTCAGGAGCTATGG + Intronic
938012700 2:127841562-127841584 GGCTGCTGCCTGGGGACATCGGG + Intergenic
938066017 2:128282497-128282519 GGCTGCGGCCTGAGGAGCTGAGG + Intronic
938291074 2:130150822-130150844 GGCTTCTCCCTGGGGAGCGAGGG - Intergenic
938465478 2:131522137-131522159 GGCTTCTGCCTGGGGAGCAAGGG + Intergenic
942347445 2:175018094-175018116 GGCTTCTGCCTGGGCACCTAGGG - Intergenic
946996590 2:225399673-225399695 GGCTGCTGCTTGGGGAGAGAGGG - Intergenic
947118370 2:226795268-226795290 GGCTGAGGCCTGGGGAGCTTGGG - Exonic
1172132859 20:32667304-32667326 GGCTGCTGCCTGGAGGGCTTCGG + Intergenic
1173229841 20:41185496-41185518 GGCGGAAGCCTGGGGAGCTAGGG - Intronic
1175442437 20:59001339-59001361 GGCTGGTGGCTGGGGAGCTGCGG - Intronic
1175790736 20:61738484-61738506 GCCTGCTGCCTTGGGCCCTAGGG - Intronic
1176157010 20:63626993-63627015 GGCGGCGGCGTCGGGAGCTGCGG + Intronic
1176409726 21:6442084-6442106 GTCTCCTGCCTCCGGTGCTAAGG + Intergenic
1176453547 21:6886399-6886421 GGCTGCTTCCTCCAGAGGTAAGG + Intergenic
1176511834 21:7754620-7754642 GGCTGCTGCCTCAGAAGCAAGGG + Intronic
1176546679 21:8205373-8205395 GGCTCGGGCCTCGGGAGCTACGG - Intergenic
1176554574 21:8249563-8249585 GGCTCGGGCCTCGGGAGCTACGG - Intergenic
1176565630 21:8388420-8388442 GGCTCGGGCCTCGGGAGCTACGG - Intergenic
1176573495 21:8432588-8432610 GGCTCGGGCCTCGGGAGCTACGG - Intergenic
1176831722 21:13751447-13751469 GGCTGCTTCCTCCAGAGGTAAGG + Intergenic
1178645947 21:34385146-34385168 GGCTGCTGCCTCAGAAGCAAGGG + Intronic
1179685219 21:43050406-43050428 GTCTCCTGCCTCCGGTGCTAAGG + Intergenic
1179878966 21:44285671-44285693 GGCAGCTGCCTTGGGGGCTGGGG - Intergenic
1180475406 22:15700864-15700886 GGCTGCTGCTTTGGGAACAATGG - Intronic
1180979421 22:19871727-19871749 GGCTGCTGCCTAGGGCTCCATGG + Intergenic
1181592843 22:23895462-23895484 GGCTGCAGACTCGGGATCTAAGG + Exonic
1182951647 22:34381749-34381771 TGCTGGTGCCTCGGGAGCTCAGG + Intergenic
1183406166 22:37631702-37631724 GGCTGCTGCCTGGAGTGCTGGGG - Intronic
1183605867 22:38866479-38866501 GGCTGCCGACTCGGGAGGGAGGG + Exonic
1184090371 22:42290089-42290111 GGCTGCTGCTTGGGGAGCGGGGG + Intronic
1184351552 22:43947409-43947431 GGCTCCTGCCTGGGGGGCTGAGG - Exonic
1184687288 22:46102367-46102389 GGCTGCTGCCTCCTCAGCTCTGG + Intronic
1184924085 22:47625275-47625297 GTCTGCACCCTCGGGAGCTCTGG - Intergenic
1185009200 22:48303758-48303780 GCCAGCTGCCTGGGGAGCTGAGG - Intergenic
1185412742 22:50694554-50694576 GGCTTCTACCTCTGAAGCTAGGG + Intergenic
1203251544 22_KI270733v1_random:121639-121661 GGCTCGGGCCTCGGGAGCTACGG - Intergenic
1203259594 22_KI270733v1_random:166721-166743 GGCTCGGGCCTCGGGAGCTACGG - Intergenic
949970629 3:9399928-9399950 AGCTGCTGGCTCTGGAGCTCTGG + Intronic
950604303 3:14064773-14064795 GGCTGCTGCTACGGGGGCTGGGG - Exonic
950967392 3:17155716-17155738 GGCTGCTGCCCCGGCGTCTATGG - Intergenic
953383935 3:42494006-42494028 GGCTGCTGCCTGGTGAGGTGAGG - Intronic
954316233 3:49803242-49803264 GGCGGCGGCGGCGGGAGCTACGG + Exonic
955985356 3:64568170-64568192 GGCTCCAGCCTCTGGAGCTTTGG - Intronic
957113156 3:75992378-75992400 GGCTCCACCCTCGGGAGCAATGG - Intronic
958078915 3:88720015-88720037 GGCAGCAGCCTAGGGAGCCATGG + Intergenic
961545424 3:127629575-127629597 GGCTGCTGCCTCGCGGGCCGGGG + Intronic
967991066 3:195131136-195131158 GGCTGCTTCCTCAGCAGCTTGGG - Intronic
969595569 4:8147704-8147726 GGCAGCTCCCTCGGGGGCTCAGG - Intronic
973230670 4:47836803-47836825 GGCGCCTGCCACGGGAGCTCAGG + Intronic
974076118 4:57170124-57170146 AGCTGCAGCCTCAGCAGCTAAGG - Intergenic
978406388 4:108383399-108383421 GGCTCCTGCCTTGGGGGCAAAGG - Intergenic
978742104 4:112148027-112148049 GTCAGGTGCCTCTGGAGCTATGG - Intronic
980503121 4:133682476-133682498 GGCTGCTGCCCCTGGAGCTGAGG - Intergenic
984256703 4:177398205-177398227 GGGAGCTGCCTCTGGAGCAAAGG - Intergenic
985801101 5:2005704-2005726 GGCTGCTCCCTAGGGGGCCAGGG + Intergenic
986714299 5:10511621-10511643 GCCTGTTGCCTCTGGAGCCAAGG - Intronic
998095827 5:139395029-139395051 GGCAGCTGCCTCGGGATCCCAGG + Exonic
999722329 5:154407956-154407978 GGCTGCTGACTCTGGAGTAATGG - Intronic
1000084738 5:157879413-157879435 AGCTGCTGGCCCGGGTGCTAAGG - Intergenic
1000487744 5:161869425-161869447 GTCAGATGCCTTGGGAGCTATGG - Intronic
1001600248 5:172923779-172923801 GGCAGCCCCCTCGGAAGCTATGG + Intronic
1006475271 6:34248973-34248995 GGCTGCAGCGGCGGGAGGTAAGG - Exonic
1018735381 6:166683944-166683966 TGCTGCTGCCTGGTGAGCTCTGG - Intronic
1019166193 6:170098974-170098996 GGCAGCTTCCTCAGGAGCAAAGG - Intergenic
1019327374 7:445111-445133 GGCTGCTGCCCCGGAGGCAAGGG - Intergenic
1019349889 7:549752-549774 GGCTCCTGCCTTGGGAGCCAGGG - Exonic
1019863553 7:3683680-3683702 GGCAGCTGCCTGGGGACCTTGGG + Intronic
1023790615 7:43750284-43750306 GGCAGCTGCATCGGGACCCAGGG + Intergenic
1026727436 7:72880294-72880316 TGCTGCTGCCTCAGTTGCTAGGG + Intronic
1027116408 7:75485432-75485454 TGCTGCTGCCTCAGTTGCTAGGG - Intronic
1027250724 7:76397372-76397394 GGATGCTGCCTGGAGAGCTCTGG + Intronic
1030124723 7:106143083-106143105 GGCAGCTTCCTCAGGAACTATGG - Intergenic
1033597100 7:142866023-142866045 GGCGCCTGCCTCGGGAGCTGGGG + Exonic
1038093172 8:24277466-24277488 GGCTGCTTCCTTTGTAGCTACGG + Intergenic
1038406453 8:27326001-27326023 GGCTGCTGCCTCTAAAGCTCAGG + Intronic
1039565873 8:38552372-38552394 GGCTGGAGCCTGGGGAGATAAGG + Intergenic
1040279220 8:46029592-46029614 GGCAGCTGCCACTGGAGCTCCGG + Intergenic
1040467938 8:47712669-47712691 GTCTGCTGCTTCTGGAGCAAAGG + Exonic
1049658768 8:143810428-143810450 GGCCGCTGACCCGGGAGCTGTGG - Intronic
1052968856 9:34364035-34364057 GGCTGCTTCCTTGGGAGCAGGGG + Intergenic
1056787546 9:89603948-89603970 GGCTGCAGCCCCTGGAGCTTAGG - Intergenic
1057481299 9:95447399-95447421 GGCTGCTGTCTCGGGTTCGAGGG + Exonic
1060549531 9:124478391-124478413 GGCTGAGGCCACGGGAGCTGGGG - Exonic
1061207449 9:129173212-129173234 GGGTGCTGCTTAGGGAGGTAGGG - Intergenic
1061896523 9:133651413-133651435 GGCTGCTTCTTTGGGAGCTGGGG + Intronic
1062049393 9:134439274-134439296 GGCTGCTTCCTGGGGACCCAGGG + Intronic
1062361379 9:136189998-136190020 GGGGGCTGCCTGGGGATCTAGGG - Intergenic
1203773998 EBV:62784-62806 CGCTGATGCCTCTGGAGCTGGGG - Intergenic
1203467946 Un_GL000220v1:104790-104812 GGCTCGGGCCTCGGGAGCTACGG - Intergenic
1203475767 Un_GL000220v1:148762-148784 GGCTCGGGCCTCGGGAGCTACGG - Intergenic
1187016660 X:15335526-15335548 GGCTGCAGCCGCGGGAGGTCCGG - Intronic
1187263555 X:17709747-17709769 TGCTGGTGCCTCAGGAGCTCTGG + Intronic
1191717902 X:64205624-64205646 GGCTGCAGCCTCGGCTGCCACGG + Exonic
1192431957 X:71118722-71118744 TGCTGGTGCCTCCGGCGCTACGG + Exonic
1195387093 X:104323764-104323786 GACTGCTGCCTCAGGTGCTGTGG + Intergenic
1200231289 X:154445011-154445033 GGCTCCTGCCTGGGGAACTGGGG + Intronic
1200775757 Y:7168707-7168729 GCCTGTTGCCTTGGGATCTAAGG - Intergenic