ID: 1147015920

View in Genome Browser
Species Human (GRCh38)
Location 17:37490972-37490994
Sequence CTGTAGAATGTCAGGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 279}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147015920_1147015924 -2 Left 1147015920 17:37490972-37490994 CCGTCCTCCCTGACATTCTACAG 0: 1
1: 0
2: 3
3: 26
4: 279
Right 1147015924 17:37490993-37491015 AGATCACTTAAGAGTCAGAGAGG 0: 1
1: 0
2: 1
3: 17
4: 172
1147015920_1147015925 4 Left 1147015920 17:37490972-37490994 CCGTCCTCCCTGACATTCTACAG 0: 1
1: 0
2: 3
3: 26
4: 279
Right 1147015925 17:37490999-37491021 CTTAAGAGTCAGAGAGGCCGAGG 0: 1
1: 0
2: 2
3: 13
4: 246
1147015920_1147015926 12 Left 1147015920 17:37490972-37490994 CCGTCCTCCCTGACATTCTACAG 0: 1
1: 0
2: 3
3: 26
4: 279
Right 1147015926 17:37491007-37491029 TCAGAGAGGCCGAGGCCAGCCGG 0: 1
1: 0
2: 3
3: 39
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147015920 Original CRISPR CTGTAGAATGTCAGGGAGGA CGG (reversed) Intronic
900524177 1:3120408-3120430 CTGCAGAGTGGCTGGGAGGACGG + Intronic
901186834 1:7379028-7379050 CTCAAGAAAGCCAGGGAGGAGGG - Intronic
901190162 1:7405124-7405146 CTGCAGGAAGTGAGGGAGGAGGG - Intronic
901813122 1:11778939-11778961 CTGGAGAGTGTCCGGGAGGGTGG - Exonic
902602527 1:17550030-17550052 CTGTAGAGAGCCAGGGTGGAGGG + Intronic
905140597 1:35840856-35840878 CTTTAGAAGGCCAAGGAGGAAGG - Intronic
905314982 1:37076623-37076645 CTGTGGACTGACAGGGAGTAAGG + Intergenic
905657232 1:39692523-39692545 CTGTCGAAAGTCGGGGCGGACGG + Intronic
905898309 1:41563439-41563461 CAGGAAAAAGTCAGGGAGGAGGG - Intronic
908835638 1:68226920-68226942 TTGTAAAATGTCATGTAGGAAGG + Intronic
909286829 1:73830185-73830207 CTTTAGCATGTCAAGGAGGCAGG + Intergenic
909968401 1:81947973-81947995 CTTTGGGATGTCAGGGAGGGCGG + Intronic
910328571 1:86040681-86040703 CTGTAGTATGACAGGGTGTATGG - Intronic
910609535 1:89126895-89126917 CTGTAGAATGCAAGGGGGAAGGG - Intronic
910620760 1:89251135-89251157 CTATAGAAAGACAGGAAGGAAGG + Intergenic
912320707 1:108710133-108710155 ATGGAGAATGGCAGGAAGGAGGG - Intergenic
912631505 1:111250164-111250186 GTGTGGAATGTGAGGGTGGAGGG + Intergenic
913474226 1:119221413-119221435 CTGTAGGGTGTGGGGGAGGAGGG - Intergenic
914415579 1:147478451-147478473 CTGTAGAAGCTCCGGGAGGAGGG - Intergenic
915861011 1:159444563-159444585 CTGTAGATTGCTGGGGAGGAGGG - Intergenic
916126216 1:161573752-161573774 CTCTAGAATGTGAAGGTGGAAGG - Intergenic
916136134 1:161655592-161655614 CTCTAGAATGTGAAGGTGGAAGG - Intronic
920213144 1:204343390-204343412 CTGTAAAATGTGAGTGATGATGG - Intronic
922089182 1:222379375-222379397 GAGTAAAATGTCAGGAAGGAGGG + Intergenic
923979776 1:239309211-239309233 GTGTATTATGTCAGGCAGGAAGG - Intergenic
924160094 1:241222240-241222262 CTTTAGAATGTCAGCGATAAAGG - Intronic
924412916 1:243825239-243825261 CTGTGGCCTGTCAGGGATGAGGG + Intronic
1063953956 10:11248448-11248470 CTGAAGAATGGAAGGAAGGATGG - Intronic
1064063552 10:12160924-12160946 CTGTAGGATGTCAGTGGGGGAGG + Exonic
1064714745 10:18165257-18165279 CTGTGGAAGGGCAGAGAGGAGGG + Intronic
1065260626 10:23919879-23919901 CTGGAGAAGGTCAGGAAGGAAGG - Intronic
1065423004 10:25567912-25567934 CTGTATAGTGGCAGTGAGGATGG + Intronic
1066519291 10:36197643-36197665 CTGGGGACTGTCAGGGAGCAGGG + Intergenic
1067909542 10:50332174-50332196 CTGGAGAATGATAGGGAGGGTGG - Intronic
1068159031 10:53239822-53239844 CTGCAGAGTTTCAGAGAGGAAGG - Intergenic
1069249361 10:66247824-66247846 CTGTAGAATTTCTTGCAGGATGG - Intronic
1069608033 10:69752553-69752575 CAGGAGAGAGTCAGGGAGGATGG + Intergenic
1069800059 10:71076428-71076450 CCTGAGAATGTCAGGGAGGCTGG - Intergenic
1070433079 10:76360769-76360791 CTGTAGCAGGTGAGGGAGGGAGG - Intronic
1071588239 10:86846290-86846312 CTGTGGAGTGACAGAGAGGAAGG - Intronic
1072600145 10:96918239-96918261 CTCTATAATGACAGGGGGGATGG + Intronic
1072703927 10:97666321-97666343 CTGTTGTATGTCAGGGAAGAGGG + Intronic
1072912971 10:99520283-99520305 CTGTAAAATGTCCTGGAGGTAGG + Intergenic
1077497166 11:2891954-2891976 GTGGAGAATGGGAGGGAGGAAGG - Intronic
1077613107 11:3656809-3656831 CTGTAGCATGTCAGGCATTAAGG - Intronic
1080454311 11:32404364-32404386 CTGCTGAATGACAGGGAGAAGGG + Intronic
1080554530 11:33404116-33404138 TTGCAGAATCTCAGGGAGGGTGG + Intergenic
1080748687 11:35132293-35132315 CTGGAGAAGATCTGGGAGGATGG + Intergenic
1080892447 11:36421171-36421193 CTTTTAAATGTCAAGGAGGAAGG - Intronic
1081035295 11:38136822-38136844 CTGTAGACTGGCAGAGTGGAGGG - Intergenic
1081575775 11:44317813-44317835 TTGCAGAATGAAAGGGAGGAGGG - Intergenic
1082131640 11:48497010-48497032 CTGAAGAATCTTAGTGAGGAAGG + Intergenic
1084682640 11:70675784-70675806 CTGGGTAATGCCAGGGAGGAAGG + Intronic
1084786871 11:71447856-71447878 CAGCCGCATGTCAGGGAGGACGG + Intronic
1085024676 11:73229566-73229588 CTGTAGAATGAGAGGGCGGGAGG + Intronic
1085129816 11:74028654-74028676 CTCTAGGATGTGAGGAAGGAGGG - Intronic
1085400559 11:76233265-76233287 CTCAAGAATGTCAGGGAGGCAGG - Intergenic
1086278059 11:85155624-85155646 CTTTAGAAGGCCAAGGAGGATGG + Intronic
1087530032 11:99368912-99368934 CTGGAGAATGTCAGGGAAGAGGG + Intronic
1087569850 11:99912118-99912140 CTGAAGAATGTCAAGAAGGAAGG + Intronic
1089272955 11:117314734-117314756 TTGGAGATTGTCAGGAAGGATGG + Intronic
1090187778 11:124749533-124749555 CTGCAGAAAGACAGGCAGGAGGG + Intronic
1090552010 11:127830115-127830137 CTGTGGTAAGTCAGGCAGGATGG - Intergenic
1092196463 12:6552429-6552451 CATGAGAATGCCAGGGAGGAGGG - Intronic
1093467282 12:19462695-19462717 ATGTAGATGGTCAGCGAGGAGGG + Exonic
1093908478 12:24719468-24719490 CTGGAGACTGTGAGGGAAGAGGG - Intergenic
1094586286 12:31780680-31780702 CTTTATAAAGGCAGGGAGGAAGG - Intergenic
1095992235 12:48043290-48043312 CTGTACAAAGTCTGTGAGGAAGG + Exonic
1096064705 12:48730342-48730364 CTGTGGAATGTAAGGTTGGAGGG + Intergenic
1098507471 12:71270768-71270790 CTGTTGAAGAGCAGGGAGGAGGG - Intronic
1099355232 12:81626549-81626571 CTGCAGTATGTCTGGTAGGATGG + Intronic
1099393033 12:82103167-82103189 ATGTAGGATGTCAGGGATGTGGG - Intergenic
1100401029 12:94230092-94230114 ATGGAGAATGGGAGGGAGGAGGG - Intronic
1100497731 12:95141611-95141633 CTGTATCATTTTAGGGAGGAGGG - Intronic
1100596720 12:96078334-96078356 CTGGAAAATGTGATGGAGGAGGG + Intergenic
1101455563 12:104826898-104826920 ATGTAAAGTGTCAGGGAAGAGGG + Intronic
1105623487 13:22091024-22091046 TGGTAGGATGACAGGGAGGATGG + Intergenic
1106050503 13:26185880-26185902 ATATTGAATGTGAGGGAGGAAGG - Intronic
1108095319 13:46894522-46894544 CTAGAGAATGTGAAGGAGGAAGG - Intronic
1108305443 13:49127557-49127579 GTGAAGCATGTCAAGGAGGAAGG - Intronic
1108728363 13:53205312-53205334 ATGGAGAGTGACAGGGAGGAGGG - Intergenic
1110620172 13:77586010-77586032 ATGGAGAGTTTCAGGGAGGAGGG - Intronic
1111025968 13:82524860-82524882 CTGTAGAATGACTGTGAGGACGG + Intergenic
1111127840 13:83935342-83935364 CTGAAGAAGGGCATGGAGGAAGG + Intergenic
1115299226 14:31865528-31865550 ATGTAGGTTGTCAGGGAGGTAGG - Intergenic
1116989619 14:51261795-51261817 CTGAAGTAAGCCAGGGAGGAAGG + Intergenic
1118073286 14:62269690-62269712 CTGTGGATTGTCTGGGATGAGGG + Intergenic
1118293894 14:64550660-64550682 CAGTAGAACGGCAGGAAGGAGGG - Intronic
1120344413 14:83266701-83266723 CTGTTCTATGTCAGGGAGGAGGG + Intergenic
1120691159 14:87594665-87594687 CTGTAGAAGGGTTGGGAGGAAGG - Intergenic
1121119703 14:91368970-91368992 CGCATGAATGTCAGGGAGGAAGG - Intronic
1124138968 15:27060708-27060730 CTGTAGGGTGTAAGGAAGGAGGG + Intronic
1124925446 15:34066050-34066072 TAGTAGAATCTCAGGCAGGACGG + Exonic
1127334341 15:57968776-57968798 CTGATGAATATCAGGGAGTAGGG - Intronic
1128544503 15:68558067-68558089 CAGTGGAATGGCAGGGAGGGTGG + Intergenic
1128744770 15:70105876-70105898 CTGAAAGATGTCAGGGTGGAAGG + Intergenic
1129057596 15:72832274-72832296 TTGTAGAATGTAAGGGGGGAGGG + Intergenic
1129298698 15:74613481-74613503 GGGTAGAATCTCAGGCAGGATGG + Intronic
1131326862 15:91456275-91456297 ATGTAGGTTGTCAGGGAGGTCGG + Intergenic
1131987074 15:98053213-98053235 CAGTAGAAAGTCAAGGACGAGGG + Intergenic
1135818892 16:25661603-25661625 CTGTATATATTCAGGGAGGAAGG - Intergenic
1136067513 16:27768828-27768850 CTGCAGAAAGGAAGGGAGGAAGG - Intronic
1136165012 16:28447970-28447992 CTGTGGAAAGTGAGAGAGGAAGG - Intergenic
1136214300 16:28781187-28781209 CTGTGGAAAGTGAGAGAGGAAGG + Intergenic
1137342177 16:47619216-47619238 CTGAAGAATGAAAGGAAGGAGGG + Intronic
1137691906 16:50434315-50434337 CTGGAGAATGGCAGGAAAGAGGG + Intergenic
1138238037 16:55402176-55402198 CTGTAGGATGGAAGGAAGGAAGG - Intronic
1138434283 16:56988684-56988706 CTGTGGGATGTCTGGGAGGTGGG + Intergenic
1139268942 16:65664140-65664162 CTGTAGGATATCAGGGATGGAGG - Intergenic
1140456754 16:75110148-75110170 CTGCAGCATGCCAGGTAGGACGG - Exonic
1141057520 16:80832344-80832366 CTATAGAATGGCAGGGAAGAGGG + Intergenic
1143092221 17:4455636-4455658 CTGTAGGATGTCGGGAAGGGAGG + Intronic
1144866787 17:18340814-18340836 CTGTGGAATGTCAGGGAGGCAGG + Intronic
1145412317 17:22679337-22679359 TTGTAGAATTTAAGAGAGGATGG - Intergenic
1145788735 17:27611062-27611084 CAGTTAAAGGTCAGGGAGGAAGG - Intronic
1145910012 17:28537035-28537057 GTGAAGATTGACAGGGAGGAGGG + Intronic
1145930413 17:28681371-28681393 CTGAAGCGTGTCAGGGAAGAGGG + Exonic
1147015920 17:37490972-37490994 CTGTAGAATGTCAGGGAGGACGG - Intronic
1150101806 17:62430612-62430634 ATCTAGAATGTGAGGAAGGAAGG - Intronic
1150504981 17:65689688-65689710 CTTTATAAAGTCAGAGAGGATGG + Intronic
1151268210 17:72972926-72972948 CTGTGGTAGGTCAGGCAGGAAGG + Intronic
1151594052 17:75066058-75066080 CAGTAAAATGAAAGGGAGGAGGG - Intergenic
1152300404 17:79492164-79492186 CCCTGGAATGTCGGGGAGGAGGG + Intronic
1153514904 18:5894236-5894258 CGGTAGAATGTAAGGAAGGTTGG + Intronic
1153899982 18:9609691-9609713 CTGGAGAATGATAGAGAGGATGG - Intronic
1156626202 18:38912284-38912306 CTGTTGGATGTCAGGTATGAGGG + Intergenic
1157226150 18:45866500-45866522 CAGCAGAATAGCAGGGAGGAAGG - Intronic
1157521924 18:48351431-48351453 CTGTAGAAAGTCCGTGAGGGAGG - Intronic
1159122512 18:64187248-64187270 CTGTGGAAACTCAGGGAGAATGG + Intergenic
1159283455 18:66317468-66317490 CTATAAAATATCAGGGTGGAAGG + Intergenic
1159961529 18:74559080-74559102 GTATAGAAGGTCAGGCAGGACGG - Intronic
1160108297 18:76001110-76001132 TTGTAGAATGTCAGGGTTAAAGG + Intergenic
1161206161 19:3042270-3042292 CTGTGGAGGGGCAGGGAGGAAGG + Intronic
1162285590 19:9736315-9736337 TGGTAGAAGGGCAGGGAGGAAGG + Intergenic
1162986352 19:14272671-14272693 CTGTAGCAGGTCAGGGTGGTGGG - Intergenic
1163002753 19:14379024-14379046 CTGCAGAATCTCAGGGAGGCAGG - Intergenic
1163563115 19:18032697-18032719 GTGTAGAAAGTCTGGGAGGGGGG - Intergenic
1163798170 19:19349035-19349057 CTGCAGACTGTCTGTGAGGAGGG - Intronic
1164442663 19:28291294-28291316 CTGTTGACTGGCAGGGAGGGAGG - Intergenic
1165881272 19:39045727-39045749 TTGTGGAATGTGAGGGAGGATGG - Intergenic
1167596887 19:50432651-50432673 CTCCAGAATCTCAGGGAGGAGGG - Intergenic
1167600454 19:50451604-50451626 CTGTAGGGTGTGAGGGAGGAGGG + Intronic
1167600482 19:50451678-50451700 CTGTAGGGTCTGAGGGAGGAGGG + Intronic
1168095905 19:54114785-54114807 TTCTAGGATCTCAGGGAGGAGGG - Intronic
926796276 2:16621691-16621713 CTGGAGAAAGTGAGGGAGCAAGG - Intronic
927140173 2:20124824-20124846 CTGGAGAGTGTCAGGGCGGGAGG + Intergenic
927515257 2:23668536-23668558 CTGCAGAAGTCCAGGGAGGAGGG + Intronic
929847063 2:45541382-45541404 CTGCAGCATGGCAGGCAGGAGGG + Intronic
931454591 2:62398630-62398652 CTGCAGAATGGCAGGGAAGGGGG - Intergenic
931892764 2:66693125-66693147 CTGCATCATGTCAAGGAGGATGG - Intergenic
932796409 2:74699748-74699770 CCATAGAAACTCAGGGAGGAGGG + Intergenic
935186858 2:100742553-100742575 CTGTAGAAACTCAGTCAGGATGG - Intergenic
937892378 2:126948466-126948488 ATGTAGAATGTCAGGGTGGAAGG - Intergenic
938100376 2:128493933-128493955 CTGAAGACTGTCAGGGGCGATGG - Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938765381 2:134457717-134457739 ATGAAGACTGTCAGAGAGGAAGG + Intronic
938823072 2:134978052-134978074 CTGGAGAAGGGAAGGGAGGAAGG - Intronic
939608233 2:144278406-144278428 CTGTAGTATGAAAGGAAGGAAGG + Intronic
940280050 2:151979284-151979306 ATCAAGAATGGCAGGGAGGAGGG - Intronic
941019655 2:160394361-160394383 CTGTAATAAGTCAGGCAGGAAGG + Intronic
942139863 2:172967169-172967191 ATGCAGAGTGTCAGGCAGGAGGG - Intronic
942661512 2:178269979-178270001 CTGCAGAATGTCAGGCAGGGCGG + Intronic
944658060 2:201896782-201896804 GTGCAGAAAATCAGGGAGGATGG - Intergenic
945728075 2:213498012-213498034 ATGCAGAATGTCAGAGAAGATGG + Intronic
946642435 2:221799193-221799215 ATGTACACTTTCAGGGAGGAGGG - Intergenic
947286756 2:228525326-228525348 CTTAAGAATGAGAGGGAGGAGGG + Intergenic
948078267 2:235183924-235183946 CTGTGGAGAGACAGGGAGGAAGG - Intergenic
948093281 2:235313918-235313940 CTGAATAATGTCCGGGAGAATGG + Intergenic
1170342387 20:15343894-15343916 ATGTAGACTGTAAGGGAAGAAGG - Intronic
1171139678 20:22729919-22729941 GTGTGGAAAGTCATGGAGGAGGG + Intergenic
1171154955 20:22863389-22863411 ATGAAGAATGTGAGGGTGGAAGG - Intergenic
1171156656 20:22880650-22880672 CTGGGGAATGTCAGGGCTGATGG + Intergenic
1173410912 20:42808744-42808766 CTGGGGAATGTCAGTGGGGAAGG + Intronic
1173540606 20:43848210-43848232 CTGTGGAATGTAAGGGAGGCAGG + Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1175151203 20:56935873-56935895 CTCTAGAATATCAGGGATAAAGG + Intergenic
1175242045 20:57556904-57556926 CTGTAGAATGCCATGCAGGATGG - Intergenic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179589241 21:42395160-42395182 CTGCAGAATCTCAGGGAGAAGGG - Intronic
1181537066 22:23551895-23551917 ATGGAGAATGGCTGGGAGGATGG - Intergenic
1182268800 22:29139822-29139844 CCATAGAAGGTCAGGGAGAAGGG + Intronic
1183081679 22:35460740-35460762 CTGCAGAAGGTTAGGAAGGAAGG + Intergenic
1183952891 22:41361762-41361784 TTCCAGAATGTCAGGGCGGAAGG - Intergenic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184480909 22:44746341-44746363 ATGGAGAATTTCAAGGAGGAGGG - Intronic
1184811123 22:46832875-46832897 CTGTGGAATGTGAGGAAGAAGGG + Intronic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
949959658 3:9301576-9301598 CTGTAGAATTACAGTGAGCACGG + Intronic
950205455 3:11076804-11076826 CTGAAGCAGATCAGGGAGGAAGG - Intergenic
953897051 3:46810978-46811000 TTTTAGTAAGTCAGGGAGGAGGG - Intronic
955286800 3:57649711-57649733 GTGTAGAATGTCAGGGCCCAGGG - Intronic
955401817 3:58597362-58597384 CTTTGGATTGGCAGGGAGGAGGG + Intronic
957376769 3:79368697-79368719 CAGTAGAATGTGGGAGAGGAAGG - Intronic
961491438 3:127259214-127259236 CTGTGCATTGTCAGTGAGGAAGG + Intergenic
962662814 3:137621442-137621464 CTGTTTAATTTCAGGGAGGGAGG - Intergenic
963742091 3:149090671-149090693 TTCAAGAATGTCAGGCAGGAGGG + Intergenic
963797336 3:149644140-149644162 CTGTATAATGTCAGGGCTGGTGG - Intronic
966914726 3:184578391-184578413 CTGTAGGGTGGCAGGGTGGAGGG - Intronic
970010183 4:11449808-11449830 CAGTAAAATGACAGGGAGAAAGG - Intergenic
970443637 4:16106552-16106574 CTGTAGGATGGCAGGGAGCAAGG - Intergenic
976100029 4:81551398-81551420 CTGTAGATTTTCAGGGAGAAAGG - Intronic
976361013 4:84178116-84178138 CTGTCCAATGTGAGGGAAGAAGG - Intergenic
977148693 4:93480890-93480912 CTGTAGAGATTCAGGGAGGTGGG - Intronic
978000086 4:103547001-103547023 TTGTTGATTGTCAGGGATGAAGG + Intergenic
978413893 4:108455386-108455408 CAGAAGAATGTCATGGAGGAGGG - Intergenic
978923402 4:114214930-114214952 CTGCAAACTGTCAGGGAGTATGG + Intergenic
979838192 4:125401015-125401037 GTGTAGAAAGGCAGAGAGGATGG + Intronic
980220428 4:129906332-129906354 ATGAAGAATGACAGGGAAGAAGG + Intergenic
982195041 4:152903107-152903129 CTGTAGCATATCAGGCAGAATGG + Intronic
982785967 4:159537389-159537411 CTGAAGCAAGTCAGGGAGAAAGG + Intergenic
984123292 4:175772547-175772569 CAGCAGAATGACAGGAAGGAAGG - Intronic
984806808 4:183758646-183758668 CTATGGAATGTTAGGGAGGAAGG - Intergenic
986495173 5:8334123-8334145 CTGCAGAATGTTGGGGAAGAGGG - Intergenic
988999239 5:36743975-36743997 CTGAAGAATAGCAGGGAGGTTGG - Intergenic
990177376 5:53122877-53122899 CTTTAGAATGTCAGATTGGAAGG + Intergenic
990393884 5:55355837-55355859 ATGTAGAGAGTCAGGGAAGAAGG + Intronic
990681619 5:58251009-58251031 CTGTTGCATGTCAAGGAGCAAGG + Intergenic
995819469 5:116212520-116212542 GTGTAGAATGTGAGGGGGGTTGG + Intronic
997452019 5:133991377-133991399 CTGAAGAGTTACAGGGAGGAAGG - Intronic
997949972 5:138234648-138234670 CTGTGGGAGGTCAGTGAGGATGG + Intergenic
999245899 5:150154627-150154649 CTTTAGAATGGCATGGAGAAGGG + Intronic
999372184 5:151062663-151062685 CTGCAGGAAGTCAGGGAGGGAGG - Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1002183921 5:177445260-177445282 CTGTGCACTGTCAGGGAGCAGGG + Intergenic
1004745656 6:18506817-18506839 CTGGAGCCTGTCAGGGAGGCGGG + Intergenic
1006282718 6:33068586-33068608 TTGTAGAATGTAAGGAAGGGAGG - Intronic
1006456449 6:34134676-34134698 ATGAAGAAAGTCAGGGAGGGAGG - Intronic
1006798880 6:36747008-36747030 CTGGCGAGTGACAGGGAGGAGGG - Intronic
1007910656 6:45510864-45510886 CTGTAAAAGGTGAGGAAGGAGGG - Intronic
1008026325 6:46640218-46640240 CTGTAGATTTTGAGGGAGAAGGG - Intronic
1008160533 6:48069519-48069541 CTGTGGAATCACAGCGAGGAAGG - Intergenic
1010307798 6:74344948-74344970 CTAAAGACTGTCAGAGAGGACGG + Intergenic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1013138258 6:107304130-107304152 CTGTATAATCTCAGTGGGGAAGG - Intronic
1013969592 6:116000994-116001016 CTTTAGGAGGCCAGGGAGGATGG + Intronic
1014397476 6:120943764-120943786 TTGGAGAATGTGGGGGAGGATGG - Intergenic
1015318818 6:131848085-131848107 CTGGAGGAAGTCAGGGAGCATGG - Intronic
1016714551 6:147209782-147209804 ATTCAGAATGACAGGGAGGAAGG + Intronic
1016935552 6:149446862-149446884 CTGTAGAATGTCAGGGGTTGAGG - Intergenic
1018285438 6:162232469-162232491 CAGTTGAATGTCAGGGAAAATGG + Intronic
1018556767 6:165058817-165058839 CTATGGAATGTCAGGGTGAAGGG + Intergenic
1020923394 7:14293851-14293873 CTGTACAAAGTCAGAGAGGAAGG - Intronic
1022313116 7:29216234-29216256 CTGCAGTATATCTGGGAGGAAGG + Intronic
1022430363 7:30313512-30313534 CAGTAGAAAGGCAGGGAGGGAGG - Intronic
1026163815 7:67892472-67892494 CTTTAGAATGAGAGGGGGGAGGG - Intergenic
1026316847 7:69234570-69234592 ATGTAGAATTTCTGGGAGTAGGG + Intergenic
1026925274 7:74187829-74187851 CTGTAAAGTGTAGGGGAGGATGG + Intronic
1028182981 7:87747741-87747763 CTGCAGATTGTCAGGGAAGTGGG + Intronic
1028994618 7:97086116-97086138 GTGGAGAATGACAGGGAGTAGGG + Intergenic
1029051830 7:97697665-97697687 TTGAAGAAAGTCAGGGAGGCAGG - Intergenic
1029894460 7:103967666-103967688 CTGGAGAATGGCAGGGGAGAGGG - Intronic
1030360253 7:108588037-108588059 ATGGAGAGTGTGAGGGAGGAGGG - Intergenic
1031611565 7:123833757-123833779 TTGTATAATGTGAGGGATGAGGG + Intronic
1033375363 7:140756359-140756381 CTGTAGAATGAAAGGCTGGAAGG + Intronic
1033929320 7:146504404-146504426 TTGTTGATTGTCAGGGATGAAGG + Intronic
1034844261 7:154429964-154429986 CTTTAGAATATCAGGAAGGATGG - Intronic
1036198871 8:6749247-6749269 CTGCAGAAAGTTAGGGAGGGAGG + Intronic
1036226233 8:6960126-6960148 CAGGAGAATGGCAGTGAGGAGGG + Intergenic
1036234824 8:7029454-7029476 CAGGAGAATGGCAGCGAGGAGGG + Intergenic
1037107294 8:15124831-15124853 CTTTAAAAAATCAGGGAGGAAGG + Intronic
1037633665 8:20680449-20680471 TTGGAGCATGTGAGGGAGGAAGG - Intergenic
1039960855 8:42246651-42246673 CTGCAGAATCTCAGAGAGAAGGG + Intergenic
1039997149 8:42543244-42543266 CTGTGGCATGCCGGGGAGGAGGG + Intronic
1040066750 8:43151221-43151243 CTGAATAATGTCAGGGAGTGAGG + Intronic
1043095771 8:75970191-75970213 ATGCAGAAACTCAGGGAGGAGGG - Intergenic
1043526281 8:81099946-81099968 CTGTGAAATGTCAGGAAAGAAGG - Intronic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1045113857 8:98960800-98960822 ATGTAGAAAGACAGAGAGGAAGG - Intergenic
1045664486 8:104470230-104470252 TTGTAGAATGTCACCGAGGTGGG + Intergenic
1046695997 8:117340313-117340335 CTGCAGTATGCCAGGGAAGAAGG + Intergenic
1047255558 8:123210949-123210971 CTCCAGAATGTAGGGGAGGAAGG + Intergenic
1047398281 8:124523901-124523923 CTGTAGAATATAAGGGAACATGG + Intronic
1047715533 8:127591636-127591658 CTGGAGGACCTCAGGGAGGAGGG + Intergenic
1048937509 8:139369113-139369135 CTGTAGCATTTCAGGGAAGTTGG - Intergenic
1050106006 9:2167582-2167604 CTGAAGAGTGTCAGGGAGGCAGG - Intronic
1050461299 9:5879782-5879804 CTGCAGAATGTCAGAGATAATGG + Intergenic
1051028940 9:12650436-12650458 AAGTAAAATGCCAGGGAGGAGGG + Intergenic
1051796190 9:20873248-20873270 GTGTAAAATGTCAGGAAGCAAGG + Intronic
1054876772 9:70105911-70105933 CTGTAGCATGTAAAGGAGGTAGG - Intronic
1056146000 9:83729914-83729936 CAGTACAATGCAAGGGAGGAAGG + Intergenic
1057115083 9:92513267-92513289 CTCTAGAATGTCAAAAAGGAAGG + Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057236446 9:93365673-93365695 CAGTAGCATGTCAAGGAGGTGGG - Intergenic
1057873106 9:98732861-98732883 TTCTAGATCGTCAGGGAGGAAGG - Exonic
1057873307 9:98734029-98734051 TTATAGATCGTCAGGGAGGAGGG - Exonic
1059760244 9:117330613-117330635 ATGTAGAATGACACAGAGGAAGG - Intronic
1059906483 9:118992167-118992189 CTGAAGAAGCTCAGGGAGCAGGG + Intergenic
1061436247 9:130564066-130564088 CTGTAGAATTTATGGGAGCAGGG - Intergenic
1061569698 9:131469587-131469609 CTGTAGACTGCCAGGCAGGTTGG + Intronic
1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG + Intronic
1186551355 X:10509088-10509110 CAGTAGAAGGGCAGGCAGGAAGG + Intronic
1186720733 X:12300903-12300925 CTGTAGGATGGCAAGGTGGAAGG - Intronic
1187203133 X:17155220-17155242 CTGTAGAATCTCAAGGTGGCAGG + Intergenic
1187515463 X:19965766-19965788 GTGTAGAATGTCGGGCAGCATGG + Intronic
1187532750 X:20111605-20111627 ATGAAGAATGTCAGTGAGTATGG + Intronic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1187733184 X:22277572-22277594 CTGTAAAACGTGAGGCAGGAAGG - Intergenic
1189312089 X:40026320-40026342 CCAAAGAATGTCAGGGAGCAAGG + Intergenic
1189589632 X:42497248-42497270 CTGTAGCATCTTAGGGAGGGTGG + Intergenic
1189648163 X:43157235-43157257 CTCCAGAATGGCAGGCAGGATGG + Intergenic
1190759659 X:53428774-53428796 CTGAAGGAAGTCAGGGAGGTTGG - Intronic
1192186355 X:68949307-68949329 CAATAGGATGTCAGGGATGAGGG - Intergenic
1192497516 X:71626180-71626202 CAGAAGAATCTCAGGCAGGATGG + Intergenic
1193126188 X:77872713-77872735 CTGTAAAATTTCAGGAAAGAAGG - Intronic
1193437392 X:81492579-81492601 CAGTAGAATGGTAGGGATGAAGG - Intergenic
1194771960 X:97916780-97916802 CTGAATAATGACAGGGAGAATGG + Intergenic
1195430743 X:104786474-104786496 CTGTAGAACCTCTGCGAGGAAGG + Intronic
1197986126 X:132268333-132268355 CTGAAGAATGTGAGGAAGAATGG - Intergenic
1199687465 X:150277218-150277240 GTGTATACTGTAAGGGAGGAAGG - Intergenic