ID: 1147017551

View in Genome Browser
Species Human (GRCh38)
Location 17:37504493-37504515
Sequence CTTCTACTTACTTTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147017551_1147017556 17 Left 1147017551 17:37504493-37504515 CCCTCCTCCAAAGTAAGTAGAAG 0: 1
1: 0
2: 1
3: 15
4: 185
Right 1147017556 17:37504533-37504555 CACAATTGCTAAAGCTTTCCAGG 0: 1
1: 0
2: 1
3: 14
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147017551 Original CRISPR CTTCTACTTACTTTGGAGGA GGG (reversed) Intronic
900751237 1:4399150-4399172 CTTTTGCTTACCTTGGAGAATGG - Intergenic
901372254 1:8809318-8809340 GTTCTACTTCCTATGGAGTAGGG - Intronic
901845933 1:11982103-11982125 CTACTACTTACTTTTTTGGATGG - Exonic
902257316 1:15198356-15198378 CATCAGCTTACTATGGAGGAAGG + Intronic
905600965 1:39250807-39250829 CTTCTACTTGCTTTGAGGGATGG + Intronic
905615968 1:39399145-39399167 CTTCGAATTGCTTTGGGGGAAGG - Intronic
906642776 1:47451332-47451354 CTTCTGGTGACATTGGAGGAGGG - Intergenic
907376026 1:54041163-54041185 CTTCTAATTATTTTGGTGGGTGG - Intronic
910256706 1:85255620-85255642 CTTCCAGTTACTTTAGAGGAAGG - Intronic
910524328 1:88160442-88160464 TTCCAACTTACTTTGGAAGAGGG + Intergenic
910535296 1:88290766-88290788 CTTCTCCTTAAATTGGGGGATGG - Intergenic
914672657 1:149883397-149883419 CTTACACTTACTTAGCAGGATGG - Intronic
916025621 1:160830925-160830947 CTTCCTCTTGCTTTGGAAGATGG + Intronic
916627834 1:166578279-166578301 CTTATATCTACTTTGCAGGATGG + Intergenic
916752313 1:167734313-167734335 CCTCGGCTTACTATGGAGGAAGG - Intronic
916894411 1:169147234-169147256 ATTCTAATTACTTTTGAGGGAGG + Intronic
917006407 1:170420135-170420157 CTTCTTCTTTCTTTGGCAGATGG - Intergenic
918590605 1:186236962-186236984 CATCTACCTACTTTTGAGCAGGG + Intergenic
921334657 1:214074163-214074185 CTTCTAATGACTTTGCAGAAAGG - Intergenic
922761578 1:228135361-228135383 CTTCGCCATACTCTGGAGGAAGG - Intergenic
922909216 1:229201473-229201495 CTTTTACTTTCTTTACAGGAAGG + Intergenic
923118720 1:230969987-230970009 CTTGTATCTACCTTGGAGGATGG - Intronic
923566444 1:235079996-235080018 TTTCTCCTTCCTCTGGAGGAAGG + Intergenic
924013135 1:239689558-239689580 ATTCAACTTATGTTGGAGGAGGG + Intronic
924796569 1:247296963-247296985 CTTCTTCTTTCTTTTGGGGAGGG + Intergenic
1063226003 10:4015687-4015709 CTTCTACTTAATTTGAAAGAAGG - Intergenic
1063791781 10:9457619-9457641 ATTCTACTTAATTTAGAGGCTGG + Intergenic
1063796448 10:9518309-9518331 CATCTACTTAATTTGGGGAATGG - Intergenic
1064943507 10:20761309-20761331 CTTTATCTTACTCTGGAGGAAGG + Intergenic
1067350331 10:45469895-45469917 CTACTTCTTACTTTGGATCATGG + Intronic
1071254067 10:83851719-83851741 CTTCTACTTGCTTTATATGATGG + Intergenic
1071978396 10:90978184-90978206 CCTCTACTTACTCCAGAGGAGGG - Intergenic
1072476088 10:95761142-95761164 CTTTTAAGTACTTCGGAGGAAGG + Intronic
1082016943 11:47496569-47496591 ATTTTACTTTATTTGGAGGAGGG + Intronic
1084135042 11:67171994-67172016 CTTCTTTTTTCTTTGGAGGCAGG + Intronic
1086836625 11:91632109-91632131 CTTCAATTCACTTTGGAGGACGG + Intergenic
1093216401 12:16367132-16367154 ATTCTATTTACTCTGGAGGCAGG + Intronic
1093216749 12:16370799-16370821 ATTCTATTTACTCTGGAGGCAGG + Intronic
1094260207 12:28487566-28487588 CTACTTCTTCCTTTGGAAGATGG + Intronic
1097728405 12:63100142-63100164 CTTCTACTGACTTCTCAGGAGGG + Intergenic
1098169127 12:67728464-67728486 ATAGTACTTACTTTGCAGGATGG - Intergenic
1099281929 12:80660573-80660595 CTTATAATTAATTTTGAGGAAGG + Intronic
1100616907 12:96237854-96237876 CTTGTTCTAACTTTGGAGAAAGG + Intronic
1100660295 12:96689826-96689848 GTTCTATTTACTTTGAAGGATGG + Intronic
1102988261 12:117296238-117296260 CTTCAAATAAATTTGGAGGAAGG - Intronic
1103439863 12:120955095-120955117 CTGATAGTGACTTTGGAGGAAGG - Intergenic
1106011524 13:25828684-25828706 CTTCCAGCTACTGTGGAGGATGG + Intronic
1107232542 13:38127757-38127779 CTTCTACTGACTAATGAGGAGGG + Intergenic
1107435754 13:40379504-40379526 CTTCTACCAGCTTTGGGGGAAGG + Intergenic
1107616054 13:42169529-42169551 CTTCTACTGACATTGGGGGTTGG - Intronic
1109114880 13:58369576-58369598 CTTCTACTTCCTTTGTAGAAAGG + Intergenic
1109674791 13:65661824-65661846 CTTCTACTTCTTGTAGAGGATGG + Intergenic
1109966634 13:69707555-69707577 CATTTACTTTCTGTGGAGGAGGG - Intronic
1114643063 14:24237502-24237524 GTGCTCCTTACTTTGCAGGATGG + Exonic
1115074984 14:29377883-29377905 CATCTAATTTTTTTGGAGGAGGG - Intergenic
1116308330 14:43288074-43288096 CTTCTCATTGTTTTGGAGGATGG + Intergenic
1116754133 14:48924725-48924747 TTTCTACTCTCTTTGGAGAAAGG - Intergenic
1116774466 14:49164432-49164454 CTCCTTCATACTTTGGAGCAAGG - Intergenic
1118904055 14:70010665-70010687 TTGCTACTTACTTTGGATGCTGG + Intronic
1120546084 14:85813164-85813186 CTTCTACTGACCTTGGTGGCAGG - Intergenic
1123819375 15:24012341-24012363 TTTATTCTTACTTTGGTGGAAGG + Intergenic
1124937063 15:34183366-34183388 TTTCTACTTACTATGCAGGTAGG + Intronic
1126567114 15:50112373-50112395 CTTCTACTTCCTTTGGGTGTGGG + Intronic
1126844897 15:52749821-52749843 CATCGAGTTTCTTTGGAGGAAGG - Intergenic
1129751587 15:78069009-78069031 CTTTTTCTTTCTTTAGAGGAAGG + Intronic
1131446770 15:92504638-92504660 CTGCTACTTACTTTTGCCGAAGG - Intergenic
1131484688 15:92809868-92809890 TTTCTCCTTCGTTTGGAGGAAGG - Intronic
1133015643 16:2938247-2938269 CTTCTCCTTCCTGTAGAGGAAGG - Exonic
1133066960 16:3214875-3214897 CTTCTACTTACTGTGGGAGTTGG - Intergenic
1135126656 16:19816087-19816109 TTTCTAATTGCTCTGGAGGAAGG - Intronic
1135379287 16:21980814-21980836 CATCTACTTAATGTGGAGGCAGG + Intronic
1135941871 16:26828800-26828822 CTCCTAGTTACTTGGGAGGCTGG + Intergenic
1137944586 16:52721649-52721671 CTTCTACTTAATTGAGAAGAAGG + Intergenic
1138536252 16:57661954-57661976 CTTCTCCTTACCTTGGAAGGAGG - Exonic
1142898616 17:2998365-2998387 GTTCTCCTTACCTTGTAGGATGG - Exonic
1147017551 17:37504493-37504515 CTTCTACTTACTTTGGAGGAGGG - Intronic
1147715111 17:42501179-42501201 CTTCTTCTTACTCTGCAGAAAGG + Exonic
1147791887 17:43018883-43018905 CTGCTACTTCATTTGGAAGAAGG - Intronic
1148578642 17:48728336-48728358 CTTATGGTTACTTTGGAGGCGGG - Exonic
1150235438 17:63589226-63589248 TTTCTTCTTACTTTGGGGGTGGG - Exonic
1150496036 17:65608452-65608474 CTTCTACTAACTTAGGGAGAGGG - Intronic
1151236445 17:72723413-72723435 CTACTACTTACTCTGAAAGATGG - Intronic
1154417022 18:14182863-14182885 ATTATACCTACTTTGCAGGATGG - Intergenic
1156749889 18:40439432-40439454 CTTCTAAGGACTTTGAAGGAAGG - Intergenic
1158052699 18:53242442-53242464 CTTCAACTTACTTGGGAAAATGG - Intronic
1159213840 18:65364518-65364540 CTGCTACATAATTTGGAGCAGGG - Intergenic
1159432913 18:68379011-68379033 CTTCTGCATACTGTGGAGGAGGG - Intergenic
1159862644 18:73667088-73667110 CTTATACTTATTTGTGAGGAGGG + Intergenic
1160129897 18:76215728-76215750 CTTCTAGGGACTTTGGTGGATGG - Intergenic
1160896767 19:1406690-1406712 CTTCTGCTGACATTGGAGGACGG + Intergenic
1162270105 19:9607283-9607305 GTTCTAGCTACTTGGGAGGATGG - Intronic
1166321215 19:42020217-42020239 GTTCTACTTAGTTAGGAGAAGGG + Intronic
1167838591 19:52095564-52095586 CTCCTACTTACTTGGGACGAAGG + Intronic
927010550 2:18899300-18899322 TTTATACATACTTTGGTGGAGGG + Intergenic
927062307 2:19435265-19435287 TCTCTGCATACTTTGGAGGAGGG - Intergenic
929308937 2:40399844-40399866 CTTTTTCTTTCTTTGGAGGCAGG - Intronic
929835924 2:45399276-45399298 CATTTATTTACTGTGGAGGAAGG + Intronic
932544963 2:72699138-72699160 CTTCTATTAACTTTGGAGAAGGG - Intronic
933486323 2:82929015-82929037 GTTCTAATTACTTTTCAGGAAGG - Intergenic
934918769 2:98323896-98323918 AATCTGCTTACTTTGGTGGAGGG - Intergenic
939076010 2:137603417-137603439 CTTTAACTTTCTTTGTAGGATGG + Intronic
941252572 2:163184625-163184647 AATTTACTAACTTTGGAGGAAGG + Intergenic
941261305 2:163301362-163301384 CCTCCACTTAGTTTGGAGGTAGG - Intergenic
941433555 2:165440115-165440137 CTCCAACCTACTTTGGAGGTAGG + Intergenic
941980536 2:171451236-171451258 CTTCTACTTACTTTTTATCATGG + Intronic
942636722 2:178015711-178015733 CTTCAACTCACTTTCAAGGAAGG + Intronic
942923970 2:181410917-181410939 CTTCTACTCAATTTTGATGAGGG - Intergenic
946133313 2:217624548-217624570 CTTCCACCTGCTTTGGAGGCTGG - Intronic
946916191 2:224524686-224524708 ATTAAATTTACTTTGGAGGAAGG + Intronic
947176451 2:227372318-227372340 CTTCTACTTTCTTGGTAGAAGGG + Intronic
947463868 2:230324679-230324701 CTTCTACGTCCCTTGGAGGCTGG + Intergenic
947472696 2:230413125-230413147 CTTCTACGTCCCTTGGAGGGTGG + Intergenic
1170285604 20:14704907-14704929 CTGTTACTTCCTATGGAGGAAGG + Intronic
1171891443 20:30721090-30721112 ATTATACCTACTTTGCAGGATGG + Intronic
1175304701 20:57967879-57967901 ATTCCACTTGCTTGGGAGGAGGG + Intergenic
1178255573 21:31049229-31049251 CTTCTCTTAACTTTGCAGGATGG - Intergenic
1178519478 21:33276512-33276534 CTGGTACTTAATTTGGAGGGGGG - Intronic
951400510 3:22227397-22227419 CTACTCCATACTATGGAGGAAGG + Intronic
951415805 3:22420072-22420094 CTTCCCCATACTCTGGAGGAAGG + Intergenic
951853390 3:27168364-27168386 CTTCTAAATATTTTGCAGGATGG + Intronic
952969273 3:38640814-38640836 CTTCTACCTGCTTTGGGGGTGGG + Intronic
953583745 3:44180926-44180948 GTTCTACCTACTTGGGAGGCTGG + Intergenic
957460947 3:80519848-80519870 CTTCTCCTTACTTGGGAAAAAGG + Intergenic
957509596 3:81170081-81170103 CTACAACCTACTTTAGAGGAAGG + Intergenic
963843164 3:150128757-150128779 CTTTGACATACTTAGGAGGATGG + Intergenic
964787029 3:160408140-160408162 CTTGTAATTACTATGAAGGAGGG - Intronic
966327815 3:178776751-178776773 CATCTAATTACTTCTGAGGATGG - Intronic
966516640 3:180828256-180828278 CTTCTCCTTCCTGTAGAGGAAGG + Intronic
967506568 3:190259360-190259382 CTTTTATGTACTCTGGAGGAAGG + Intergenic
968855604 4:3118773-3118795 CATTTATTTACTTTGGAGAAAGG - Intronic
971916526 4:32876672-32876694 CTCCTATTTTCTCTGGAGGATGG + Intergenic
973254258 4:48093038-48093060 TTTCTTTTTTCTTTGGAGGAAGG + Intronic
977342718 4:95779579-95779601 TTTCTACCTACTTTAGAGGCAGG + Intergenic
980102873 4:128559155-128559177 CTTCTTCTTACTTTGGCACACGG - Intergenic
981230112 4:142343096-142343118 CTTATACTGAAATTGGAGGATGG - Intronic
981707071 4:147670951-147670973 CTTCTCCTTGGTTTGGAAGATGG + Intronic
982741871 4:159065742-159065764 CTTCTCTCTACTTTGAAGGAAGG - Intergenic
985519338 5:364465-364487 CTTGTGTTAACTTTGGAGGATGG + Intronic
986612975 5:9588532-9588554 TTTCAACTTGCTTGGGAGGACGG - Intergenic
986927878 5:12781014-12781036 TTTCTACTTACTATGAGGGAGGG - Intergenic
987149607 5:15025486-15025508 ATTCTACTGACTTTGGAGAAAGG + Intergenic
987491417 5:18584411-18584433 CTTCTAATGTCTGTGGAGGAAGG + Intergenic
988677712 5:33450520-33450542 TTTTTACTTCCTTTGGAGTAAGG - Intronic
990354523 5:54953078-54953100 CTTACATTTACTTAGGAGGATGG - Intergenic
992136527 5:73751654-73751676 CTCCTCCTTCCTTAGGAGGAAGG + Intronic
993033815 5:82734708-82734730 CTTATTCTTCCTTTTGAGGAAGG - Intergenic
994496358 5:100517934-100517956 CTTCTACTTACTGGGGAAGAGGG + Intergenic
996231920 5:121075179-121075201 CTTTTATTTCCTATGGAGGATGG - Intergenic
997120770 5:131170847-131170869 CTCCTCCGTCCTTTGGAGGAGGG + Exonic
999200516 5:149813012-149813034 CCTCTACTTACCTTCTAGGAAGG - Intronic
1003245680 6:4380047-4380069 CATCTCTTTACTTTGGAGGCAGG + Intergenic
1003357239 6:5385295-5385317 ATTCAAATCACTTTGGAGGAAGG - Intronic
1004170905 6:13294894-13294916 CTTCTGCTTCCCTTGCAGGAAGG - Intronic
1007191669 6:40023912-40023934 CTTTTACATACTTTTGAGGAGGG + Intergenic
1008084230 6:47227286-47227308 TTTCTACTTACTTTCAAGAAAGG + Intergenic
1008385349 6:50883036-50883058 CTGCTAGGGACTTTGGAGGAGGG + Intergenic
1010135969 6:72553346-72553368 CATCTACTTACTGTGGCAGAGGG - Intergenic
1010176531 6:73033905-73033927 CTTCTCCTTACTTTTTGGGAAGG - Intronic
1011077882 6:83457421-83457443 CTTGTACTCACTTTGGATGGTGG - Intergenic
1013714760 6:112945444-112945466 CTTCCTAATACTTTGGAGGATGG + Intergenic
1014441100 6:121474796-121474818 CATGTATCTACTTTGGAGGAAGG - Intergenic
1014677262 6:124382641-124382663 CTTCTGCTTACTTTGTATGTGGG - Intronic
1015433448 6:133157234-133157256 CTTATATTTTATTTGGAGGAAGG + Intergenic
1017163294 6:151385940-151385962 TTTCTAATTACTATGGAAGAAGG - Intronic
1023474560 7:40562991-40563013 CTTCTACTTTCTGTGAGGGAGGG + Intronic
1028315694 7:89399665-89399687 CTTCAACTTCCTTTGTAGAATGG + Intergenic
1028318828 7:89436161-89436183 CATTTACTTAGTTTGGAGAAGGG - Intergenic
1028731248 7:94151008-94151030 TGTATACTTTCTTTGGAGGAAGG - Intergenic
1030290293 7:107865421-107865443 CTTCGAGTTACTTAGCAGGATGG + Intergenic
1030964529 7:115973645-115973667 TTTCTACATACTTTAAAGGAGGG + Intronic
1032202611 7:129832944-129832966 CTTCTCATTGCTTTGGGGGAGGG - Exonic
1035045453 7:155962645-155962667 GTACTACTTACTGTGGACGACGG + Exonic
1036724125 8:11203970-11203992 CTTCTACTTTCTTTGGAAGAAGG + Intergenic
1037381368 8:18288405-18288427 CTACTACTTCCCTTGGAAGAAGG + Intergenic
1038249356 8:25888652-25888674 ACTCTACTAACTTTGTAGGAAGG + Intronic
1038459750 8:27705709-27705731 CTACAACTTCCTTTGGAGCAGGG - Intergenic
1041169116 8:55123032-55123054 CTTCCACTTACTGTGGAACAGGG + Intronic
1046577545 8:116049627-116049649 TTTAGACTTACTTTGGAGGAAGG + Intergenic
1048853438 8:138665726-138665748 TTTCCACGAACTTTGGAGGATGG + Intronic
1050007029 9:1142277-1142299 CTTGTACTTTCTGTGGAGGAGGG + Intergenic
1052706380 9:31998231-31998253 CATCTACTTACTTTTAAAGATGG + Intergenic
1052984420 9:34476101-34476123 GTTTTACCTACTTTGCAGGAAGG + Intronic
1054357392 9:64074608-64074630 ATTATACCTACTTTGCAGGATGG - Intergenic
1055197215 9:73611048-73611070 CTTCCTCTGACTTTGGAGGTAGG - Intergenic
1055603557 9:77945106-77945128 TTTCTACTTACATTTGAGTATGG - Intronic
1055769295 9:79700015-79700037 ATTCTACTTACTTTAGAGATTGG - Intronic
1057264579 9:93606089-93606111 CAGCTACTTACTTAGGAGGCTGG - Intronic
1060211056 9:121710649-121710671 GTTCTTCTGACCTTGGAGGAAGG - Intronic
1060443590 9:123666403-123666425 CTCCTACATCCTTTGGAGGTAGG + Intronic
1061931420 9:133834930-133834952 CTTCTGCTCCCTTTGTAGGAGGG - Intronic
1203561063 Un_KI270744v1:58896-58918 ATTATACCTACTTTGCAGGATGG + Intergenic
1187091395 X:16100758-16100780 CTTCTAAGCACTTTTGAGGAAGG - Intergenic
1187295398 X:17994901-17994923 TTTCTACTTACATAGGAGAAAGG - Intergenic
1188376047 X:29429237-29429259 CTGCTACTTACTCTGTAGTATGG - Intronic
1189159309 X:38794374-38794396 ATTCTACTTATTTGAGAGGATGG - Intergenic
1190125023 X:47697104-47697126 GTTCTCCTAACTTTGGTGGAGGG - Intergenic
1190599166 X:52071581-52071603 TTTCTAGTTACTTAGGAGAAAGG - Intergenic
1190609658 X:52182492-52182514 TTTCTAGTTACTTAGGAGAAAGG + Intergenic
1191153871 X:57250272-57250294 CTTCTACTTAATGTGTAGAAAGG - Intergenic
1192760622 X:74092301-74092323 CTTCTACTAACTTTGGACTTAGG - Intergenic
1197328641 X:125125814-125125836 GTTTGACTCACTTTGGAGGAAGG + Intergenic
1199428350 X:147729917-147729939 CTTCCACTTACACTTGAGGATGG - Intergenic