ID: 1147021947

View in Genome Browser
Species Human (GRCh38)
Location 17:37541791-37541813
Sequence CTGATTTTGACTCCCGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147021944_1147021947 3 Left 1147021944 17:37541765-37541787 CCCATAAAGCAGTTATCTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1147021947 17:37541791-37541813 CTGATTTTGACTCCCGTCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 116
1147021942_1147021947 27 Left 1147021942 17:37541741-37541763 CCTGCATGCTGTGCTTGTTTTTA 0: 1
1: 0
2: 0
3: 32
4: 540
Right 1147021947 17:37541791-37541813 CTGATTTTGACTCCCGTCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 116
1147021946_1147021947 2 Left 1147021946 17:37541766-37541788 CCATAAAGCAGTTATCTGAGGGA 0: 1
1: 0
2: 0
3: 6
4: 150
Right 1147021947 17:37541791-37541813 CTGATTTTGACTCCCGTCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147021947 Original CRISPR CTGATTTTGACTCCCGTCTC AGG Intronic
904049569 1:27631133-27631155 CTGACTTTGAATCCCTTGTCTGG - Intronic
907981612 1:59487176-59487198 CTGATTTACACTCCATTCTCGGG + Intronic
912034936 1:105301044-105301066 AAGATTTTTACTCCAGTCTCTGG - Intergenic
912796148 1:112694758-112694780 CTGGGTTTGACTCCAGACTCCGG - Exonic
913315811 1:117550311-117550333 CTGCTGTTGCCTCCCTTCTCAGG + Intergenic
919941561 1:202290508-202290530 CTGAGTTTGAGTCCTGGCTCTGG + Intronic
923203910 1:231739605-231739627 ATGATTTTGACCCCAGTCCCAGG + Intronic
1065441206 10:25755438-25755460 CTGAGTTTGAATCCCAACTCAGG - Intergenic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1065733942 10:28734398-28734420 CTGAGTTTGAATCCCATTTCTGG - Intergenic
1067209898 10:44251321-44251343 CTGAGTTTGAATCCTGGCTCTGG + Intergenic
1074525676 10:114261135-114261157 ATGTTTTTGACTCCAGTCTCGGG + Intronic
1075941534 10:126394481-126394503 CTGATCTGGACTGCCGTTTCCGG + Intergenic
1079089488 11:17470754-17470776 CTGATTTTGTCTCCTCTCTCGGG + Intronic
1091107098 11:132932938-132932960 CTCATTTTGAATCCCAACTCTGG - Intronic
1091366848 11:135029490-135029512 CTGAGTTTAAATCCCGGCTCTGG - Intergenic
1093785639 12:23189023-23189045 CTGATTTTGTCACCTTTCTCAGG - Intergenic
1096518124 12:52169491-52169513 CTGTTTTTATCTCCCCTCTCAGG - Exonic
1096954912 12:55516404-55516426 AGGATTTTGACTCCAGTCCCTGG + Intergenic
1100734422 12:97511585-97511607 CTGATTTTGAATCCTGGCCCTGG + Intergenic
1102563407 12:113778895-113778917 CTCAGTTTGAATCCCGTCCCAGG - Intergenic
1103873414 12:124107517-124107539 CTGATGTTAGCTCCCGCCTCTGG - Intronic
1104672815 12:130692151-130692173 CTGGGTTTGACTCCTGCCTCTGG + Intronic
1104841489 12:131828123-131828145 CTGACCCTGACTCCCCTCTCCGG - Intergenic
1106572395 13:30938730-30938752 CAGTGTTTGACTCCCTTCTCTGG + Intronic
1107218999 13:37957912-37957934 GTGATTTTCAATACCGTCTCTGG - Intergenic
1111848866 13:93546822-93546844 GTGATTTTGACTTGTGTCTCTGG + Intronic
1114648243 14:24267579-24267601 CTGACTTTGCCCCCAGTCTCAGG - Intronic
1118968023 14:70606379-70606401 CTGCTTTTCACTCTCCTCTCTGG + Intergenic
1119870246 14:78011009-78011031 CTTTTTTTAACTCCCTTCTCTGG - Intergenic
1121308881 14:92924041-92924063 CTGATTTTGTTTCCCTTCCCTGG - Intronic
1122687313 14:103515568-103515590 CTGATTTTCACACCCTTTTCAGG - Intergenic
1123796519 15:23777144-23777166 CTGATTCTGATTCCCTTCACTGG + Intergenic
1124107546 15:26754151-26754173 CTGATTCTGCCTCCCATCTTAGG - Intronic
1126773136 15:52077371-52077393 CTGACTGTGCCTCCTGTCTCTGG - Intergenic
1130979077 15:88800515-88800537 ATGAGTTTGACTCCCTTCTGAGG - Intergenic
1133570323 16:7034172-7034194 CTGGGTTTGACTCCTGGCTCTGG + Intronic
1135568628 16:23531111-23531133 CTGATCTCGACTCCTGACTCAGG + Intronic
1138292640 16:55861092-55861114 CTGATTTTGACTTCAGCTTCTGG + Intronic
1142542619 17:672211-672233 CTGAGCTTTACTCCCGTCTTTGG + Intronic
1147021947 17:37541791-37541813 CTGATTTTGACTCCCGTCTCAGG + Intronic
1147757618 17:42779434-42779456 CTGCTGTTGCCTCCCTTCTCAGG + Exonic
1147797682 17:43056807-43056829 GTAATTTGGATTCCCGTCTCGGG - Intronic
1148196097 17:45714374-45714396 CTGATTTTGGGTCTGGTCTCTGG + Intergenic
1149605585 17:57922805-57922827 CTGATTTAGACCCCTGTCTTTGG - Intronic
1150188319 17:63210388-63210410 CTGATTATCCCTCCCTTCTCTGG + Intronic
1152094303 17:78264048-78264070 CTGGGTTTGAATCCCATCTCTGG - Intergenic
1153110495 18:1580617-1580639 CTGTTTATGACTCACTTCTCTGG - Intergenic
1153191385 18:2543589-2543611 GTGATTTTGAATCCTGGCTCTGG - Intronic
1159953300 18:74501371-74501393 CTGATTTCGCCTCTCTTCTCCGG - Exonic
1160374869 18:78404031-78404053 CTGAGTGTGACTCCAGTATCTGG - Intergenic
1167755097 19:51407805-51407827 CTGAGTTTGAATCCCAGCTCTGG + Intergenic
926935122 2:18079456-18079478 CCTATTTTCACTCCCATCTCTGG - Intronic
927449932 2:23199855-23199877 TTGGTATTGACTCCCATCTCTGG - Intergenic
934864382 2:97792891-97792913 CTGCTTATGACTCCCGGCACTGG + Exonic
934935608 2:98463192-98463214 CTGCTTTTGACCCCAGTTTCAGG + Intronic
940503715 2:154527017-154527039 AGGATTTTGACTCTAGTCTCTGG - Intergenic
941275992 2:163491423-163491445 CTGTGTTTGACTTCCTTCTCCGG + Intergenic
947425598 2:229980490-229980512 AGGCTTTTGACTCCCATCTCTGG - Intronic
1169406588 20:5326442-5326464 CTGCTTGTGTCTCCCCTCTCTGG + Intergenic
1172731549 20:37093098-37093120 CTGATTTTGACTACAGTTTAGGG + Intronic
1174191625 20:48744641-48744663 CTGGGTTTGAGTCCCGGCTCAGG - Intronic
1174547255 20:51334729-51334751 CTGGTTTTGCCTCTCGTCTCTGG - Intergenic
1174558736 20:51414890-51414912 CTCATTTTCACTCCAGCCTCTGG + Intronic
1177223266 21:18221350-18221372 ATGATTTTGAATTCCTTCTCAGG + Intronic
1180787879 22:18557110-18557132 CTGAGTTTGACCCCCGCCTGTGG - Intergenic
1181244790 22:21496635-21496657 CTGAGTTTGACCCCCGCCTGTGG - Intergenic
1184549082 22:45194853-45194875 CTGGGTTTGACTCCCATCGCCGG + Intronic
952161012 3:30693058-30693080 ATGATTTTGACTACCTTATCTGG + Exonic
952218986 3:31305171-31305193 CTGAGTGTGCCTCCTGTCTCTGG - Intergenic
956021562 3:64938604-64938626 TGGATTTTGAGTCCCATCTCTGG + Intergenic
956665029 3:71633879-71633901 CTGACTTTGACTCATGTATCAGG - Intergenic
960322913 3:116259301-116259323 GTGTTTTTAACTCCTGTCTCTGG - Intronic
964358833 3:155873135-155873157 CTGGTTTTGATTCCTGTTTCTGG + Intronic
964553049 3:157906378-157906400 TTCATTTTGACTCTGGTCTCTGG - Intergenic
965162767 3:165155939-165155961 CTGATTTTGAATCCTAACTCTGG + Intergenic
965238602 3:166161496-166161518 CTGCTTTTGACTACCTTCTGTGG + Intergenic
965614830 3:170584027-170584049 CTGATTTTGAATCCAATCTCTGG + Intronic
968995042 4:3940092-3940114 CTGATTTTCACTCCCCTCGGGGG + Intergenic
970290976 4:14572025-14572047 CTGATTTTTCCTCCACTCTCTGG - Intergenic
975024997 4:69536600-69536622 CTGATTCTTTCTCCCATCTCTGG - Intergenic
976082755 4:81375015-81375037 GGGTTTTTGACTCCAGTCTCTGG - Intergenic
978688270 4:111475660-111475682 CTGCTTCTGACTCTCCTCTCAGG - Intergenic
981596507 4:146429618-146429640 CTGATCTTCTCTCCCATCTCTGG - Intronic
982703245 4:158679314-158679336 TCAATTTTGACTCCCTTCTCAGG - Intronic
988581577 5:32473327-32473349 GTGACTTTTACTCCAGTCTCAGG + Intergenic
996314201 5:122142958-122142980 CTGTTTTTGACTTCCTTCCCAGG + Intronic
996715805 5:126587152-126587174 CTCATTTTCCCTCCCATCTCTGG - Intronic
1007407972 6:41645631-41645653 CTGCGTCTCACTCCCGTCTCAGG + Intronic
1008644240 6:53496923-53496945 CTGTTTTCGACTCCTGTCTTTGG - Intergenic
1010406204 6:75508787-75508809 CTGATTTTCAGTCCCCTCTTTGG - Intergenic
1013376704 6:109523669-109523691 CTGGTTTTGGCTCCTTTCTCTGG - Intronic
1014536876 6:122624731-122624753 CTGAATTTGAATCCCAGCTCTGG + Intronic
1019761206 7:2814101-2814123 CTGAGTTTGAATCACGCCTCGGG + Intronic
1020870107 7:13618334-13618356 CTGATTTTTATTCAAGTCTCAGG - Intergenic
1021100363 7:16582044-16582066 CTATTTTTGACTCTCATCTCTGG + Intergenic
1028160993 7:87484255-87484277 AGGATTCTGACTCCAGTCTCTGG + Intergenic
1032237832 7:130140508-130140530 CAGACTTGGACTCCCTTCTCTGG - Intergenic
1032615761 7:133468767-133468789 CTGAATTTGATTCCCCTCTAGGG + Intronic
1042216909 8:66436794-66436816 ATGATTTTGACTCCTGACCCTGG - Intronic
1046550640 8:115711735-115711757 CTGAGTTTGACTCACATGTCAGG - Intronic
1048390036 8:133954006-133954028 TTGATTTTCACTACAGTCTCTGG - Intergenic
1058672286 9:107369902-107369924 CTCATTTGGACTTCCATCTCTGG + Intergenic
1059946604 9:119414968-119414990 CTGATGTTGACTATAGTCTCAGG - Intergenic
1059988916 9:119846246-119846268 CTGAATTTGAATCCTGGCTCTGG - Intergenic
1187414011 X:19076375-19076397 GTGATTTAGAGTCCCCTCTCTGG - Intronic
1190015190 X:46820372-46820394 AGGTTTTTGACTCCAGTCTCTGG + Intergenic
1193266691 X:79480438-79480460 CTCATTTTGATACCAGTCTCTGG - Intergenic
1200683927 Y:6244120-6244142 CTTTTTCTGCCTCCCGTCTCTGG - Intergenic
1200992093 Y:9355686-9355708 CTTTTTCTGCCTCCCGTCTCTGG - Intergenic
1200994746 Y:9375964-9375986 CTTTTTCTGCCTCCCGTCTCTGG - Intronic
1200997409 Y:9396310-9396332 CTTTTTCTGCCTCCCGTCTCTGG - Intergenic
1200999922 Y:9464846-9464868 CTTTTTCTGCCTCCCGTCTCTGG - Intergenic
1201002582 Y:9485156-9485178 CTTTTTCTGCCTCCCGTCTCTGG - Intronic
1201005238 Y:9505440-9505462 CTTTTTCTGCCTCCCGTCTCTGG - Intergenic
1201007899 Y:9525769-9525791 CTTTTTCTGCCTCCCGTCTCTGG - Intergenic
1201010515 Y:9545960-9545982 CTTTTTCTGCCTCCCGTCTCTGG - Intergenic
1201048708 Y:9910266-9910288 CTTTTTCTGCCTCCCGTCTCTGG + Intergenic
1201617211 Y:15913860-15913882 CTAATATTGACTCCAGACTCTGG - Intergenic
1202336261 Y:23813923-23813945 CAGACTCTGACTCCAGTCTCTGG + Intergenic
1202534505 Y:25856144-25856166 CAGACTCTGACTCCAGTCTCTGG - Intergenic