ID: 1147024512

View in Genome Browser
Species Human (GRCh38)
Location 17:37568602-37568624
Sequence CTGAAGTTTAAGATGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 349}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147024512 Original CRISPR CTGAAGTTTAAGATGGACAA AGG Intronic
902483657 1:16726982-16727004 CAGCAGTTTGAGATTGACAATGG + Intergenic
904695694 1:32329789-32329811 CTGATGTTTAAGCTGGACTTTGG + Intronic
905806831 1:40883557-40883579 CTAAAGTTTAAGACGGGCATGGG - Intergenic
909148738 1:71972534-71972556 ATAAAGTTTAAGATGTAAAAGGG - Intronic
909860873 1:80604012-80604034 CTTGAGTTGAAGATGGAGAAAGG - Intergenic
910395319 1:86787640-86787662 TTCAATCTTAAGATGGACAAAGG + Intergenic
910487057 1:87726480-87726502 CTGGAGTTTATGAGGGATAATGG + Intergenic
912515512 1:110214192-110214214 TTGAAGTTTATGATGGAGCAAGG + Intronic
915640659 1:157222328-157222350 TTCAATTTTAAAATGGACAAAGG - Intergenic
916498142 1:165363967-165363989 CTGAACTTTAAGGTTGAAAAAGG - Intergenic
916819185 1:168381564-168381586 CTGAAGTTGAAGAAGGATGAAGG + Intergenic
917571924 1:176275712-176275734 CTTAACTTTAAAATGGGCAAAGG - Intergenic
917705304 1:177627018-177627040 CTCAATTTTAAAATGGGCAAAGG + Intergenic
918421622 1:184370027-184370049 CCCAACTTTAAAATGGACAAAGG - Intergenic
918442054 1:184577292-184577314 CTGGCGTTGAAGATGGAGAAAGG + Intronic
919834569 1:201564864-201564886 CTGACTTTGAAGATGGAAAAAGG - Intergenic
921115891 1:212091120-212091142 CCTAATTTTAAAATGGACAAAGG + Intronic
921290988 1:213657307-213657329 CTGAAGGTTAAGATAAATAATGG + Intergenic
1062889320 10:1046139-1046161 CTGAAGTTTCAGATATAAAATGG + Intronic
1064986998 10:21220818-21220840 CCTAATTTTAAAATGGACAAAGG + Intergenic
1065638836 10:27759788-27759810 CTGAAGCTTAGGATGCATAACGG + Intergenic
1067921599 10:50464315-50464337 CTGACTTTAAAGATGGAAAAGGG + Intronic
1069098399 10:64288038-64288060 CAGAAGTTTAAGCAGGAGAATGG - Intergenic
1071429758 10:85597627-85597649 CAGAAGTTTACAATGGCCAATGG - Intergenic
1073194034 10:101673439-101673461 CCGAAGTATAAGATGGAAAAGGG + Intronic
1073479584 10:103778026-103778048 CTGAAGTTAAAAAGGGAAAATGG + Intronic
1074641608 10:115390019-115390041 CACAATTTTAAAATGGACAAAGG - Intronic
1075493827 10:122900731-122900753 CTGAAGCATAAGATGCACATTGG + Intergenic
1080135674 11:28851379-28851401 ATGAAGTTTAAGGGGGAAAAAGG - Intergenic
1080426728 11:32161754-32161776 CTGATGATTAAGAAGGAAAATGG - Intergenic
1081011474 11:37818040-37818062 GTGAAGTTTAACATGAACAGTGG + Intergenic
1084269869 11:68023034-68023056 CCGATGTGTAAGAAGGACAAAGG - Intronic
1085999637 11:81966442-81966464 CTGAACTTGAAGATGGAAGAAGG + Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087122837 11:94592795-94592817 CTTAAGTTTAGGATGGTAAAGGG + Intronic
1087231455 11:95670387-95670409 CACAATTTTAAAATGGACAAAGG - Intergenic
1088470829 11:110186521-110186543 GTGAGCTTTAAGATGGAAAATGG + Intronic
1089274792 11:117327634-117327656 GTGTAGTTTAAGATAGATAATGG - Intronic
1089274796 11:117327679-117327701 GTGTAGTTTAAGATAGATAATGG - Intronic
1092519983 12:9260657-9260679 CTGAATTTGAAGATAGAGAAAGG + Intergenic
1093531322 12:20167970-20167992 TTGAAGTACAAAATGGACAATGG - Intergenic
1094732087 12:33188611-33188633 CTGGATTTTAAGATGGAGGAGGG + Intergenic
1095119583 12:38401029-38401051 CTGAAGTTCTAGATGAACAGAGG + Intergenic
1096289763 12:50332007-50332029 CTTAAGCTTAAGTAGGACAAAGG - Intronic
1097652429 12:62318112-62318134 CTGAAGTTGAGAATGGTCAAAGG - Intronic
1098325333 12:69296431-69296453 CTTAAGTTAAAAATGGGCAAAGG + Intergenic
1098969396 12:76834084-76834106 ATGAAGTTTAAAATGCACAAAGG + Intronic
1099066561 12:77987792-77987814 CTGAAGTTTAGGATTGAGATTGG + Intronic
1099098138 12:78401527-78401549 CTGAAGTGTAAAATGCACATTGG - Intergenic
1099259665 12:80361800-80361822 CTGATTTTTAAAATGGGCAAAGG - Intronic
1100593584 12:96052421-96052443 GTGAATTTTGAGAGGGACAAAGG + Intergenic
1103015693 12:117492841-117492863 CTGACTTTGAAGATGGAGAAGGG + Intronic
1103472994 12:121196856-121196878 GTGAAGCTTGGGATGGACAAGGG - Intergenic
1103629385 12:122247333-122247355 CTGAAGTTCAGGATGGGGAATGG - Intronic
1103976093 12:124703712-124703734 TTGATGATTAAGATGGAAAAAGG + Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104482634 12:129121562-129121584 CTGGATTTGAAGATGGAGAATGG + Intronic
1104710559 12:130982806-130982828 CTGAAGTGGAAGCTGGAGAAGGG + Intronic
1106082925 13:26515464-26515486 CTGAAGTTAAAGAGGCACGAGGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107085983 13:36428699-36428721 CTGAATTGTAATTTGGACAAGGG + Intergenic
1107416784 13:40208529-40208551 CTGAAGTTTAACATAGACCCCGG + Intergenic
1107460150 13:40594250-40594272 CTGGAGTTTAAGGGGGCCAATGG + Intronic
1109015530 13:57007712-57007734 CTGATTTTTAAAATGGGCAAAGG + Intergenic
1109643186 13:65218718-65218740 ATGAAGTTGAAGATGGACAATGG + Intergenic
1109880767 13:68471736-68471758 CAGAAGGCAAAGATGGACAAAGG - Intergenic
1110157066 13:72330165-72330187 CTGATTTTTAACATGGGCAAAGG + Intergenic
1110479750 13:75960501-75960523 CTGAATTTTAAGACAGATAAAGG - Intergenic
1111077169 13:83252187-83252209 TAGAAGTTTAAGATAGTCAAGGG + Intergenic
1113144038 13:107187021-107187043 CTGGATTTTAAGATGGAGGAAGG - Intronic
1113785297 13:112999267-112999289 CTGAAGTTTCTGGTGGGCAAAGG - Intronic
1115024204 14:28721364-28721386 GTGAACTTTAAGATGAACTACGG + Intergenic
1116002046 14:39254311-39254333 CTGAAGTTGAAGAAGTACAGAGG + Intronic
1116043117 14:39710046-39710068 CTGGAGTTAAAAATGGAGAAAGG - Intergenic
1116646820 14:47539388-47539410 CTTAATTTTAAGATGTACAAAGG + Intronic
1116869391 14:50057026-50057048 CTTGAGTTTGGGATGGACAATGG + Intergenic
1120061496 14:79988719-79988741 CTGAGCTTGAAGATGGAGAAAGG - Intergenic
1120127932 14:80769078-80769100 CTGAAATGAAATATGGACAAGGG + Intronic
1120335478 14:83149103-83149125 GTGAAGTTTCTGATGGACATTGG - Intergenic
1124654711 15:31498947-31498969 CTGAACTTGAAGATGGTCAGTGG + Intronic
1126378368 15:48019640-48019662 CCAAATTTTAAAATGGACAAAGG + Intergenic
1126422909 15:48493730-48493752 CTGGAGTTTCAGATAGACATAGG - Intronic
1126958531 15:53962904-53962926 CTGAATTTTATCATGTACAAAGG - Intergenic
1127309001 15:57735329-57735351 CTGAAGTATAATATGGACAAAGG - Intronic
1128526811 15:68417971-68417993 CTGGAGTTTAAGTTCCACAAAGG + Intronic
1130680114 15:85989295-85989317 CAGATGTTTAAGATGGAAATTGG - Intergenic
1131010601 15:89014993-89015015 CCGAATTTTAAAATGGGCAAAGG + Intergenic
1135839815 16:25865483-25865505 CTGATTTTTAAAATGGGCAAAGG - Intronic
1137078289 16:36005575-36005597 TTGAAGCTTATGATGGAAAAGGG + Intergenic
1138309351 16:56009929-56009951 CTGAAGTTGGAGCTGGAGAAGGG + Intergenic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1138468933 16:57216320-57216342 ATGAAGTATAACAGGGACAAAGG + Intronic
1140577755 16:76192032-76192054 TTGAAGTTAAAGATGGCAAAAGG - Intergenic
1140619299 16:76708506-76708528 CTGACGTTGAAGATGGAGGAAGG + Intergenic
1141120120 16:81347352-81347374 TTGATGTTAAAGATGTACAAGGG + Intronic
1142687520 17:1586213-1586235 CTGAAGTTGAGGATGGAGCACGG + Intronic
1144158150 17:12528426-12528448 CTGAAGTTAATCATGGACTAGGG - Intergenic
1144242843 17:13330927-13330949 CTTAAATTTAAGACTGACAAAGG - Intergenic
1144372686 17:14607050-14607072 GTGAAGTTTAGGTTGGCCAATGG + Intergenic
1147024512 17:37568602-37568624 CTGAAGTTTAAGATGGACAAAGG + Intronic
1147297344 17:39494673-39494695 CTGGATTTCAAGAAGGACAAAGG + Exonic
1151597334 17:75086618-75086640 CTGAGGTCTGAGCTGGACAACGG + Intergenic
1152517632 17:80835233-80835255 TAAAAGTTTAAGATGAACAAAGG - Intronic
1153059645 18:982054-982076 ATGAAGTCTAAGCTGGACAAAGG - Intergenic
1153595694 18:6722967-6722989 CAAAACTTTAACATGGACAAAGG - Intergenic
1154998119 18:21660706-21660728 ATGAAGTTTTAGATGGAAAGTGG + Intronic
1155057695 18:22199391-22199413 CTGAACTTTTAGAAGGAAAAAGG + Intronic
1155291227 18:24344618-24344640 GTGAAGTTTCAGATGCCCAAGGG + Intronic
1156074552 18:33257869-33257891 CTGAAATTTAATATGGCCTAAGG + Intronic
1156695582 18:39762241-39762263 CTGACTTTGAAGATGGAGAAGGG - Intergenic
1157226001 18:45865391-45865413 CTGACCTTTAAGCTGGACAATGG - Intronic
1158765905 18:60449112-60449134 CTGAAGTCTCAGATGGAAATTGG - Intergenic
1159578941 18:70213101-70213123 CTCAATTTTAAAATGGGCAAAGG + Intergenic
1159583948 18:70265074-70265096 CTGAATTCTAAGAAGGAGAAAGG - Intergenic
1163015441 19:14451470-14451492 CTGAGGTCTAAGATGGGCTAGGG - Intronic
1164519946 19:28971418-28971440 CTGAAGTAAAAGATTGGCAAAGG + Intergenic
1164786472 19:30935132-30935154 CTGAAGTTTGAGATAAAGAACGG + Intergenic
1165507304 19:36242079-36242101 CTGAAGTTCAACATGCAGAATGG + Intronic
1165753966 19:38280877-38280899 CTGAAGTTTATTGTGGAAAAAGG + Intronic
1166212122 19:41313477-41313499 CTGAAGACTGAGCTGGACAAGGG - Intronic
1166773754 19:45300039-45300061 CTGAAGTTTAAGATGATCAAGGG - Intronic
1167724970 19:51205074-51205096 CCCAACTTTAAAATGGACAAAGG + Intergenic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168368359 19:55809543-55809565 CTGAAGCGGCAGATGGACAAGGG - Exonic
929621208 2:43356046-43356068 CTGAAATTTAAGACAGAAAACGG + Intronic
930946183 2:57078963-57078985 CTGATGTTTAAGATGCTCTAAGG - Intergenic
931519105 2:63075581-63075603 CTGACTTTTAAAATGGACACAGG - Intergenic
931941372 2:67255239-67255261 CTGACGTCTAAGGTGGCCAAGGG - Intergenic
932285552 2:70528910-70528932 CTGAAGTGTAAGAAGGAACAGGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933819995 2:86102446-86102468 TTCAATTTTAAAATGGACAAAGG - Intronic
935186435 2:100738083-100738105 CTGAAGTGTAACAGGGACATGGG + Intergenic
935258805 2:101336757-101336779 GTGAATTTTAAAATGTACAAGGG - Intergenic
936550980 2:113439329-113439351 GTGTAGCTAAAGATGGACAAAGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938955814 2:136297135-136297157 CTGATTTTTAAAATGGGCAAAGG - Intergenic
939304513 2:140393580-140393602 CTGAAATAGAAGATGGAAAATGG - Intronic
941618415 2:167750024-167750046 CTAAAATTTAAAATGGCCAAAGG - Intergenic
945369633 2:209001046-209001068 CTGTAGTTTAATATCTACAAAGG + Intergenic
945680440 2:212906953-212906975 ATTTAATTTAAGATGGACAATGG - Intergenic
946512043 2:220368481-220368503 CTGATTTTTAAAATGGGCAAAGG + Intergenic
946611027 2:221458108-221458130 CTGAAGAGTAAAATGGTCAAGGG - Intronic
946754515 2:222930732-222930754 TTGAAGATGAAAATGGACAAAGG + Exonic
947311133 2:228803747-228803769 CTCAAGTTAAAAATGGGCAAAGG - Intergenic
948084004 2:235231281-235231303 CTAAAGATTCAGATGGCCAAGGG - Intergenic
948785552 2:240350609-240350631 CTGACGTTGAAGATGGAGGAGGG + Intergenic
1168804791 20:666006-666028 CTGGAGTTTGGGATGGACACAGG + Intronic
1169459124 20:5779340-5779362 CTGAAACTTAAGGTGGAAAATGG - Intronic
1169553719 20:6727521-6727543 CTGAATTATAAAATGTACAATGG - Intergenic
1170699498 20:18690933-18690955 CAGAATTTTAACATGGGCAAAGG + Intronic
1171339700 20:24417830-24417852 CTCTAATTTAGGATGGACAAGGG - Intergenic
1172674415 20:36657748-36657770 CAGAAGTTTGAGATTAACAAGGG + Intronic
1177201652 21:17963454-17963476 CTGAAGGTGAAGAGGGGCAAAGG + Intronic
1177682385 21:24389333-24389355 CTGAAATGGAAGATGGAGAAAGG - Intergenic
1178740208 21:35192951-35192973 GTGGAAGTTAAGATGGACAAAGG - Intronic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1182408896 22:30164621-30164643 CCTGAGTTTAAGATGGGCAAAGG - Intronic
950343892 3:12274271-12274293 CTGAAATTTAAGATGCATCAGGG - Intergenic
951703220 3:25517311-25517333 CTCAATTTTAAAATGGGCAATGG + Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
956843715 3:73163138-73163160 CTGAATTTTAAAATGGACCAAGG - Intergenic
958872276 3:99574621-99574643 CTGTAGTAGAAAATGGACAAAGG + Intergenic
959907932 3:111731180-111731202 CAGAAGTTTAAAATGGTCAGTGG + Intronic
960261983 3:115578624-115578646 TTGAAGTTGAAGGTGGAAAAAGG + Intergenic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
963844022 3:150136705-150136727 CTGAAGTCAAAAATGGAGAAGGG + Intergenic
964347833 3:155771993-155772015 CAGAAGTTCAAGAAGGGCAAGGG + Intronic
964702015 3:159578686-159578708 CTGACTTTGAAGATGGAAAAAGG - Intronic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
965900162 3:173629969-173629991 CTGAAGGTTAAAGAGGACAAGGG + Intronic
966467290 3:180244626-180244648 CTGATTTTTAAAATGGGCAAAGG - Intergenic
967962099 3:194933658-194933680 CTGAAGTTGAATCAGGACAACGG + Intergenic
970038911 4:11773617-11773639 CTGAAGTTCAACATGTTCAAAGG + Intergenic
970713656 4:18894544-18894566 ATGCACTTTAAGATGGAGAAAGG + Intergenic
970738219 4:19198991-19199013 CTGAAGTATGAGAAGGAAAAGGG + Intergenic
970791384 4:19861819-19861841 AAGAAGTTTCAGATGGACATAGG - Intergenic
971118198 4:23673055-23673077 CTGATGTTGAAGATGGAGGAAGG + Intergenic
971842700 4:31874662-31874684 CTGATTTTGAAGATGGAAAAAGG - Intergenic
975344108 4:73274561-73274583 CTCAAGTTTAAGTTAGAGAAGGG + Intergenic
975608184 4:76177177-76177199 CTCAATTTTAAAATGGGCAAAGG + Intronic
976851771 4:89555784-89555806 CTGGATTTTAAAATGGGCAAAGG - Intergenic
977585054 4:98765782-98765804 CTCAATTTTAAAATGGGCAAGGG - Intergenic
979509942 4:121541115-121541137 CTGATTTTTAAAATGGACTAAGG + Intergenic
979578412 4:122323875-122323897 TTGGAGTCTAAGATGGATAATGG - Intronic
980394830 4:132198079-132198101 CTGGAGTTTGAGAAGCACAATGG - Intergenic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
984051144 4:174866752-174866774 CTCAAGTCTAAGAGAGACAAAGG - Intronic
984180633 4:176478608-176478630 CTCAAATTAAAGATAGACAATGG + Intergenic
984680581 4:182604468-182604490 CTGAAGTATAAAATAAACAAAGG - Intronic
986345238 5:6828719-6828741 CTGAAATTTTAGAGGGACAAAGG + Intergenic
987483778 5:18495986-18496008 CTGAAGGTTAGTATGGCCAATGG + Intergenic
988058029 5:26125929-26125951 CTGAAGTTAAAGTTTGTCAAAGG + Intergenic
989897551 5:47112227-47112249 TTGAGGTCTAAGATGGAAAAGGG + Intergenic
989897773 5:47116315-47116337 TTGAGGTCTAAGATGGAAAAGGG + Intergenic
989898294 5:47126029-47126051 TTGAGGTCTAAGATGGAAAAGGG + Intergenic
989898949 5:47138297-47138319 TTGAGGTCTAAGATGGAAAAGGG + Intergenic
989899394 5:47146303-47146325 TTGAGGTCTAAGATGGAAAAGGG + Intergenic
990242274 5:53827343-53827365 CTGAAGATTGAGAAGGTCAAGGG + Intergenic
990585340 5:57206065-57206087 CTCAATTTTAAAATGTACAAAGG - Intronic
991085164 5:62642221-62642243 CTGACATTGAAGATGGATAAAGG + Intergenic
991763810 5:69952316-69952338 CAGAATTTCAAGATGGAGAAAGG + Intergenic
991783515 5:70165823-70165845 CAGAATTTCAAGATGGAGAAAGG - Intergenic
991843041 5:70827384-70827406 CAGAATTTCAAGATGGAGAAAGG + Intergenic
991875960 5:71166153-71166175 CAGAATTTCAAGATGGAGAAAGG - Intergenic
992428703 5:76686131-76686153 CCTAATTTTAAAATGGACAAAGG - Intronic
993935350 5:93993704-93993726 CTCAAATTTAAAATGTACAATGG + Intronic
994780839 5:104088062-104088084 CTGAATTTAAAGATGGAAGAAGG - Intergenic
995143699 5:108762660-108762682 CTGTAGTTTAAAATGGGCCACGG + Intronic
996799096 5:127382766-127382788 CTGAACTTTAAAATAGGCAAAGG + Intronic
997326115 5:133022915-133022937 ATGAAATTTAACAAGGACAAAGG + Intronic
998589572 5:143463372-143463394 CTGAAGGCTAAGATGTTCAAGGG + Intergenic
998980194 5:147693982-147694004 GTGAAGTTTACGATGGACACTGG + Intronic
998980311 5:147695382-147695404 ATGAGGTTTATGATGGACACTGG + Intronic
1002172119 5:177381070-177381092 CTAAAGTTGAAGATGGTCAAGGG - Intronic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1004587566 6:17016627-17016649 CTGAAGTTTTAGAAGTAAAATGG - Intergenic
1004956966 6:20738261-20738283 TTTAATTTTAAGATGGGCAAAGG + Intronic
1005056963 6:21738443-21738465 CTGGAGATGAGGATGGACAAGGG + Intergenic
1006773250 6:36571523-36571545 CTGACTTTTAAGATGGAGGAAGG - Intergenic
1006972465 6:38060657-38060679 CTGAAGTTTGAGACGAACATGGG - Intronic
1009356707 6:62756938-62756960 CTGAATTTTAAAATTGAGAAAGG - Intergenic
1009868761 6:69430687-69430709 CTGAAATTTCGGATGGAAAAGGG + Intergenic
1011045363 6:83076154-83076176 CTGAATTTTAAAATGGGCCAAGG + Intronic
1011048268 6:83111691-83111713 CTAATTTTTAAGATGGACAAAGG - Intronic
1012256081 6:97033847-97033869 CTGAATTTTAAAATGGTCACAGG - Intronic
1015085320 6:129283689-129283711 CTGAAATTTAAGATACAAAAAGG - Intronic
1016124419 6:140382815-140382837 TTGACGTTTAAGATGGTTAAAGG - Intergenic
1016581807 6:145636529-145636551 CTGAAGTTTTAGAAAGACAGTGG + Intronic
1016770321 6:147842321-147842343 CTGAGGGTTGTGATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017016326 6:150103271-150103293 CTCAATTTTAAAATGGGCAAAGG + Intergenic
1017201599 6:151760422-151760444 CTGAAGTCTGAATTGGACAATGG - Intronic
1017368179 6:153669808-153669830 CTGAAGTTTTATAGGCACAACGG + Intergenic
1019885686 7:3902947-3902969 CCTAATTTTAAAATGGACAAAGG + Intronic
1021078652 7:16336115-16336137 AGGAAGTTTAAGTTGGAAAAAGG + Intronic
1021183931 7:17540883-17540905 GTTAAATTTAAGATGGTCAAAGG + Intergenic
1021697797 7:23290855-23290877 CTGATTTTTAAAATGGGCAAAGG - Intergenic
1022202974 7:28136007-28136029 CTGAAGTGAAACATGGAGAATGG - Intronic
1022605400 7:31808761-31808783 ATGATGTTTAAGATGAAAAATGG + Intronic
1022916349 7:34958199-34958221 TTGAAGTGTGAGATGGAGAATGG - Intronic
1024896238 7:54265462-54265484 CTGAGGGTTAAGAAGGAAAAGGG + Intergenic
1025111339 7:56218840-56218862 CTGAAATTTGAGAAGGACACTGG - Intergenic
1025490854 7:61120099-61120121 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025491018 7:61122833-61122855 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025491340 7:61128301-61128323 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025491496 7:61131035-61131057 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025491813 7:61136503-61136525 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025491952 7:61138895-61138917 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025492125 7:61141799-61141821 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025492283 7:61144533-61144555 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025492446 7:61147267-61147289 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025492608 7:61150001-61150023 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025492770 7:61152734-61152756 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025492925 7:61155468-61155490 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025493086 7:61158202-61158224 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025493246 7:61160936-61160958 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025493411 7:61163670-61163692 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025493572 7:61166404-61166426 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025493730 7:61169138-61169160 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025493887 7:61171872-61171894 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025493935 7:61172728-61172750 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025494094 7:61175462-61175484 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025494250 7:61178196-61178218 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025494412 7:61180930-61180952 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025494552 7:61183323-61183345 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025494714 7:61186057-61186079 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025494873 7:61188792-61188814 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025495030 7:61191523-61191545 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025495362 7:61197163-61197185 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025495524 7:61199897-61199919 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025495686 7:61202631-61202653 TTGAAGTTTATGATGGAAAAGGG + Intergenic
1025495847 7:61205364-61205386 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025496005 7:61208098-61208120 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025496168 7:61210832-61210854 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025496330 7:61213566-61213588 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025496656 7:61219034-61219056 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025496813 7:61221767-61221789 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025496975 7:61224501-61224523 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025497135 7:61227235-61227257 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025497312 7:61230310-61230332 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025497469 7:61233044-61233066 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025497633 7:61235778-61235800 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025497791 7:61238512-61238534 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025497940 7:61241246-61241268 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025498103 7:61243980-61244002 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025498263 7:61246714-61246736 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025498425 7:61249448-61249470 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025498578 7:61252181-61252203 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025503408 7:61386968-61386990 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025503562 7:61389702-61389724 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025503723 7:61392436-61392458 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025503881 7:61395170-61395192 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025504042 7:61397904-61397926 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025504200 7:61400638-61400660 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025504364 7:61403372-61403394 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025504689 7:61408840-61408862 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025505663 7:61425241-61425263 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025506164 7:61433614-61433636 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025506326 7:61436348-61436370 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025506483 7:61439082-61439104 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025507123 7:61450031-61450053 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025507947 7:61463709-61463731 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025508108 7:61466443-61466465 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025508746 7:61477379-61477401 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025509073 7:61482855-61482877 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025509873 7:61496524-61496546 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025510035 7:61499259-61499281 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025510359 7:61504728-61504750 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025510521 7:61507463-61507485 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025510849 7:61512929-61512951 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025511005 7:61515664-61515686 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1025511500 7:61523868-61523890 TTGAAGGTTATGATGGAAAAGGG + Intergenic
1026306568 7:69147621-69147643 CTGAAATTTAAGAAGGACACTGG + Intergenic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1027724053 7:81780867-81780889 CTGATTTTGAAGATGGAGAAAGG + Intergenic
1028420601 7:90628473-90628495 CTGAAGTTTGAGAAGGACTGTGG - Intronic
1029883443 7:103841440-103841462 CTGAAGTATAATGTGGATAAAGG - Intronic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1033633928 7:143190626-143190648 CTGAAGTTAAAAATTGGCAAAGG + Intergenic
1034784254 7:153910739-153910761 CTGAATATTAGGATGAACAATGG - Intronic
1035888223 8:3316469-3316491 GTGAAGGTTGAGAGGGACAAAGG + Intronic
1037358112 8:18044299-18044321 CTGACTTTGAAGATGGAAAAAGG - Intergenic
1037382980 8:18308044-18308066 CTCAATTTTAAAATGGTCAAAGG + Intergenic
1039177019 8:34820249-34820271 TTGAAATGTAAGATGGAAAATGG - Intergenic
1040044646 8:42950334-42950356 TTCAAGTTAAAGATGGTCAAGGG - Intronic
1040274754 8:46003744-46003766 TTGAAGTTTATGATGAAAAACGG + Intergenic
1040892719 8:52334622-52334644 TTGAGGTTTAAGAGGGACTATGG + Intronic
1041800537 8:61793007-61793029 CTGGAATTTGAGATGGAGAAAGG + Intergenic
1041957362 8:63570745-63570767 CTGACTTTGAAGATGGAGAAGGG + Intergenic
1042708713 8:71691050-71691072 CTGACTTTGAAGATGGAGAAAGG - Intergenic
1045442934 8:102232836-102232858 CAGAAGGCTAAGATGAACAAAGG - Intronic
1045677365 8:104622550-104622572 CTAAAGAATAAGATGGAAAAAGG - Intronic
1045865794 8:106864035-106864057 TTGAAAGTTATGATGGACAAAGG - Intergenic
1046603125 8:116340884-116340906 ATGAAGCTAAAGATGGACATGGG - Intergenic
1047407180 8:124595483-124595505 CTGGCTTTGAAGATGGACAAAGG - Intronic
1047487646 8:125346331-125346353 CTCAAGATAAAGATGGAGAATGG + Intronic
1047602649 8:126441820-126441842 CTAATTTTTAAAATGGACAAAGG + Intergenic
1047711645 8:127558715-127558737 CTGAACTTGAAAAAGGACAAAGG + Intergenic
1049901954 9:177489-177511 GTGTAGCTAAAGATGGACAAAGG + Intronic
1052604081 9:30676246-30676268 CTGAAATCTATGATGGTCAAAGG - Intergenic
1052921339 9:33972510-33972532 CTGAAGTTAGAGAGAGACAAAGG + Intronic
1053027720 9:34744207-34744229 CTGAAGATAACGATGGACCATGG + Intergenic
1053744987 9:41187776-41187798 GTGTAGCTAAAGATGGACAAAGG + Intronic
1054482283 9:65677437-65677459 GTGTAGCTAAAGATGGACAAAGG - Intronic
1054683360 9:68243492-68243514 GTGTAGCTAAAGATGGACAAAGG - Intronic
1056438074 9:86592344-86592366 CTGAAGTTTCAGATAGACAGAGG - Intergenic
1056811303 9:89766258-89766280 CTGACTCTTAAGTTGGACAAAGG - Intergenic
1057740551 9:97707723-97707745 ATCAATTTTAAAATGGACAAAGG - Intergenic
1058166171 9:101621768-101621790 CTGAAGATAAAGGTGGAAAATGG + Intronic
1059167640 9:112094188-112094210 CTAAAGTTTAAGATGCACAAAGG + Intronic
1060004789 9:119990296-119990318 TTGAAGGTTAAGGTGGGCAAAGG + Intergenic
1062701810 9:137910214-137910236 CTCAATTTTAAAATGGGCAACGG - Intronic
1186767532 X:12786395-12786417 CCGAATTTTAAAATGGGCAAAGG - Intergenic
1186880152 X:13857008-13857030 CTGACTTTGAAGATGGAGAAAGG - Intronic
1187333896 X:18365121-18365143 CTGGCTTTGAAGATGGACAAAGG - Intergenic
1189162418 X:38823361-38823383 CTGAAGATAAAGATGTAAAAGGG + Intergenic
1190431240 X:50379527-50379549 CTGAAGTGAAAAATAGACAATGG - Intronic
1192319535 X:70078423-70078445 CCGAAGGTTAAGATGGACCAAGG - Intergenic
1193258738 X:79380246-79380268 TTGGAGTTTCAGCTGGACAATGG + Intergenic
1194187349 X:90790042-90790064 CTGAAGAATAAGATGGGAAAAGG + Intergenic
1194960878 X:100234286-100234308 CTGACTTTGAAGATGGAGAAAGG + Intergenic
1195271816 X:103239313-103239335 CTAAAGAGTAAAATGGACAAGGG - Intergenic
1196476766 X:116096087-116096109 CTTATTTTTAAAATGGACAAAGG - Intergenic
1196716436 X:118815631-118815653 CTTAATTTTAAAATGGACAAAGG - Intergenic
1197450320 X:126605361-126605383 CTGAACTTAAAAATGGGCAAAGG + Intergenic
1197944625 X:131825934-131825956 CTGTAGTTGAACTTGGACAATGG + Intergenic
1198670436 X:139074600-139074622 TGGAAGTGTAAGGTGGACAATGG - Intronic
1199001070 X:142636980-142637002 CTGTATTTTAAGATGCACAATGG - Intergenic
1199211266 X:145214374-145214396 ATGAGGTCTAAGATGGAGAAAGG + Intergenic
1200533943 Y:4371999-4372021 CTGAAGAATAAGATGGGAAAAGG + Intergenic