ID: 1147026306

View in Genome Browser
Species Human (GRCh38)
Location 17:37587684-37587706
Sequence CGTTACCAAGAGCAGTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147026306_1147026311 -3 Left 1147026306 17:37587684-37587706 CCCCCAAACTGCTCTTGGTAACG 0: 1
1: 0
2: 2
3: 13
4: 139
Right 1147026311 17:37587704-37587726 ACGTCAACAATCACCCACATGGG 0: 1
1: 0
2: 0
3: 0
4: 66
1147026306_1147026314 19 Left 1147026306 17:37587684-37587706 CCCCCAAACTGCTCTTGGTAACG 0: 1
1: 0
2: 2
3: 13
4: 139
Right 1147026314 17:37587726-37587748 GTAACTCACCTAACACTGTGTGG 0: 1
1: 0
2: 1
3: 5
4: 99
1147026306_1147026316 28 Left 1147026306 17:37587684-37587706 CCCCCAAACTGCTCTTGGTAACG 0: 1
1: 0
2: 2
3: 13
4: 139
Right 1147026316 17:37587735-37587757 CTAACACTGTGTGGTCTTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 137
1147026306_1147026310 -4 Left 1147026306 17:37587684-37587706 CCCCCAAACTGCTCTTGGTAACG 0: 1
1: 0
2: 2
3: 13
4: 139
Right 1147026310 17:37587703-37587725 AACGTCAACAATCACCCACATGG 0: 1
1: 0
2: 0
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147026306 Original CRISPR CGTTACCAAGAGCAGTTTGG GGG (reversed) Intronic
903439551 1:23377320-23377342 CCTTGCCAAGAGCAGTAGGGGGG + Intergenic
905563784 1:38947366-38947388 AATGACCAAGAGCAGTTTGGAGG - Intergenic
907213271 1:52841267-52841289 CGTTAACAAAAGCATATTGGCGG + Intergenic
909406243 1:75292700-75292722 AGTATCCAAGAACAGTTTGGGGG - Intronic
910304098 1:85741853-85741875 CTTCATCAAGAGCAGTTTAGAGG - Intronic
910644383 1:89497629-89497651 TGCTACAAAGAACAGTTTGGAGG + Intergenic
911950128 1:104162836-104162858 CGCTATGAAGAACAGTTTGGAGG + Intergenic
916231347 1:162544281-162544303 AATGACCAAGGGCAGTTTGGAGG + Intergenic
917569099 1:176245867-176245889 CACTATCAAGAACAGTTTGGAGG - Intergenic
1068187229 10:53600561-53600583 AATAACCAAGAGCAATTTGGAGG + Intergenic
1070047377 10:72851895-72851917 AATGACCAAGGGCAGTTTGGAGG + Intronic
1072535672 10:96360775-96360797 CCTTGACAAGAGCAGTTTAGTGG + Intergenic
1074659057 10:115630092-115630114 CTTTACCAAGACCAGTGTCGAGG + Intronic
1075283334 10:121160507-121160529 CCTTGGCAAGAGCATTTTGGTGG - Intergenic
1077472467 11:2770450-2770472 CCTTGCCAAGAGCAGTATGCGGG + Intronic
1080775430 11:35381698-35381720 GGCAAACAAGAGCAGTTTGGGGG - Intronic
1080836734 11:35946398-35946420 ACATTCCAAGAGCAGTTTGGAGG + Intronic
1080949149 11:37008616-37008638 AATAACCAAGGGCAGTTTGGAGG + Intergenic
1084360016 11:68663214-68663236 AATGACCAAGGGCAGTTTGGAGG + Intergenic
1085622134 11:78045621-78045643 AGTGACCAAAGGCAGTTTGGAGG + Intronic
1087031393 11:93708722-93708744 CACTATGAAGAGCAGTTTGGAGG - Intronic
1087095222 11:94311680-94311702 CCTTACCAAGTGCAGTTAGTAGG + Intergenic
1087630221 11:100641485-100641507 GGTTACCAGGGGCAGTGTGGCGG - Intergenic
1087720355 11:101657837-101657859 CATTATGAAGAACAGTTTGGAGG - Intronic
1091097693 11:132839618-132839640 CGTCAACAACAGCAGTGTGGTGG - Intronic
1094798334 12:34001647-34001669 CACTACCAAGAACAGTATGGAGG + Intergenic
1094863412 12:34498205-34498227 CTTTTCATAGAGCAGTTTGGAGG - Intergenic
1095111099 12:38295738-38295760 CACTACCAAGAACAGTATGGAGG + Intergenic
1098938211 12:76504617-76504639 AATGACCAAGGGCAGTTTGGAGG - Intronic
1099763705 12:86954763-86954785 CACTATGAAGAGCAGTTTGGAGG - Intergenic
1100512225 12:95286874-95286896 CATGACCCAGAGCAGCTTGGAGG - Intronic
1102361820 12:112294674-112294696 CGCTAACAAGAGCTGTTTTGAGG - Intronic
1105115526 13:16690204-16690226 CGTTTCAAAGAGCAGCTTTGAGG + Intergenic
1105119108 13:16748688-16748710 CGTTTCAAAGAGCAGCTTTGAGG + Intergenic
1105122531 13:16804658-16804680 CGTTTCAGAGAGCAGTTTTGAGG + Intergenic
1105132202 13:16962743-16962765 CGTTTCAGAGAGCAGTTTTGAGG + Intergenic
1105134870 13:17006055-17006077 CGTTTCAAAGAGCAGCTTTGAGG + Intergenic
1105140598 13:17100199-17100221 CGTTTCAAAGAGCAGCTTTGAGG + Intergenic
1105141169 13:17109575-17109597 CGTTTCAAAGAGCAGCTTTGAGG + Intergenic
1105148637 13:17230829-17230851 CGTTTCCAAGAGCAGCTTTGAGG + Intergenic
1105150137 13:17255423-17255445 CGTTTCAAAGAGCAGCTTTGAGG + Intergenic
1105156743 13:17363237-17363259 CGTTACAGAGAGCAGCTTTGAGG + Intergenic
1105555531 13:21444715-21444737 ACCTATCAAGAGCAGTTTGGAGG - Intronic
1106822732 13:33484137-33484159 AATGACCAAGGGCAGTTTGGAGG - Intergenic
1106928024 13:34633405-34633427 AATGACCAAGGGCAGTTTGGAGG - Intergenic
1110680440 13:78305470-78305492 CCTTGCCAAGAACAGTTTGTTGG - Intergenic
1118578380 14:67267777-67267799 TATTACAAAAAGCAGTTTGGTGG - Intronic
1119106011 14:71924554-71924576 GGTTACCAAGGGCAGGTGGGGGG - Intergenic
1121358461 14:93233913-93233935 TGTTTGGAAGAGCAGTTTGGCGG - Intergenic
1121749948 14:96343678-96343700 TGTTACCAAGAGATGTTTTGTGG - Intronic
1126814699 15:52443091-52443113 TGATACCAAGAACAATTTGGGGG - Intronic
1127222413 15:56893566-56893588 AGGTACCAACAGAAGTTTGGAGG - Intronic
1128902498 15:71437312-71437334 CGTTTCCAAATGCAATTTGGAGG + Intronic
1129315057 15:74737458-74737480 CACTACAAAGAACAGTTTGGAGG + Intergenic
1132288364 15:100682259-100682281 AATGACCAAGGGCAGTTTGGAGG + Intergenic
1134217135 16:12324857-12324879 CATTACCTAGTGGAGTTTGGGGG - Intronic
1134382134 16:13737695-13737717 TGTTAGCAAGAGCAGTTTCATGG - Intergenic
1136573422 16:31109767-31109789 CCTTACCACGTGCAGTATGGTGG - Exonic
1145985074 17:29040379-29040401 AGTTGCCAAGATCAGTCTGGGGG + Intronic
1147026306 17:37587684-37587706 CGTTACCAAGAGCAGTTTGGGGG - Intronic
1147285670 17:39401360-39401382 AGTGACCAAGAGCAGGTTTGAGG - Exonic
1149679693 17:58496947-58496969 GGTTATCAAGAGCAGTGTTGAGG - Intronic
1153228626 18:2916329-2916351 CTTTACCCAGAGCAGCTTTGAGG - Intergenic
1156475825 18:37404727-37404749 TGTGACCAAGACCAGTGTGGAGG + Intronic
1166592709 19:44015015-44015037 TACTACCAAGGGCAGTTTGGTGG + Intergenic
925680562 2:6416711-6416733 GGTTCCCAAGAACAGCTTGGTGG - Intergenic
930832944 2:55764648-55764670 GGCTACCAAGAGAAGTTTTGTGG - Intergenic
932892090 2:75606234-75606256 CGTTACCAAGAGGAGCTTCTAGG + Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
936233357 2:110723771-110723793 TGTTACCAATAGAACTTTGGAGG - Intergenic
936318824 2:111448515-111448537 AGTCACCAAGAACAGTTTCGTGG - Intergenic
936651735 2:114435431-114435453 CCTTGCTAAGAGCAGTTTTGTGG - Intergenic
937463050 2:122105899-122105921 CGTTCCCCTGAGCAGTTTGGCGG - Intergenic
937575106 2:123410568-123410590 CTTGATCCAGAGCAGTTTGGAGG - Intergenic
937667421 2:124502756-124502778 AGATACCAAGAGCAAGTTGGTGG + Intronic
940253831 2:151708364-151708386 CCTGAACAAGAGCAATTTGGTGG - Intronic
940503294 2:154521361-154521383 CGCTATCAAGAACAGCTTGGGGG - Intergenic
941190743 2:162378918-162378940 AGTTACCAAGACCAGAGTGGAGG - Intronic
941244299 2:163078268-163078290 AATGACCAAGGGCAGTTTGGAGG - Intergenic
941244930 2:163084951-163084973 AATGACCAAGGGCAGTTTGGAGG - Intergenic
947795308 2:232890613-232890635 TTTTACCTTGAGCAGTTTGGGGG - Intronic
947950741 2:234145080-234145102 AATGACCAAGGGCAGTTTGGAGG - Intergenic
1169508297 20:6237080-6237102 CATTACCAAAAGCCGCTTGGAGG - Intergenic
1170228563 20:14020037-14020059 AATGACCAAGGGCAGTTTGGAGG + Intronic
1172024530 20:31938922-31938944 TGTTACCAAGAGCAAGTAGGAGG + Intronic
1172285641 20:33738518-33738540 GATTACTAAGGGCAGTTTGGAGG + Intronic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1174102975 20:48141286-48141308 AATGACCAAGGGCAGTTTGGAGG - Intergenic
1176429987 21:6569586-6569608 CTTTACCATGAGCAGTTTTGGGG + Intergenic
1177080241 21:16630712-16630734 CATTACCAAGAGCAGTAGGAGGG + Intergenic
1177510602 21:22081973-22081995 AATGACCAAGGGCAGTTTGGAGG + Intergenic
1179705381 21:43177048-43177070 CTTTACCATGAGCAGTTTTGGGG + Intergenic
1185054932 22:48574755-48574777 CAGTACCAAGACCAGTGTGGTGG - Intronic
950587830 3:13908698-13908720 CATTATGAAGAACAGTTTGGAGG + Intergenic
950992638 3:17456712-17456734 CACTACAAAGAACAGTTTGGAGG + Intronic
952442622 3:33347590-33347612 TGTTATGAAGAACAGTTTGGAGG - Intronic
954463041 3:50638522-50638544 CATTACCCAGAGCAGGCTGGGGG - Intronic
954804652 3:53210194-53210216 AATGACCAAGGGCAGTTTGGAGG + Intergenic
955132094 3:56180207-56180229 CCTCATCTAGAGCAGTTTGGGGG + Intronic
964350537 3:155799191-155799213 CGTTATGGAGAACAGTTTGGAGG + Intronic
964453135 3:156831839-156831861 AATGACCAAGGGCAGTTTGGAGG + Intronic
965174531 3:165314865-165314887 CGTTATGAAGAACAGTTTGGAGG - Intergenic
965414682 3:168378137-168378159 CATTATGAAGAACAGTTTGGAGG - Intergenic
969922405 4:10552677-10552699 GGTTTCCAAAGGCAGTTTGGGGG - Intronic
970027567 4:11639702-11639724 AATAACCAAGGGCAGTTTGGGGG + Intergenic
973533721 4:51859538-51859560 TCTTACCTAGAGTAGTTTGGGGG + Intronic
974433996 4:61833863-61833885 AGTGAACAGGAGCAGTTTGGAGG + Intronic
974559484 4:63498560-63498582 CATTATGAAGAACAGTTTGGAGG + Intergenic
975862704 4:78694348-78694370 AATGACCAAGGGCAGTTTGGAGG + Intergenic
976008834 4:80462405-80462427 CGTTAGCAAGAACAGCTTAGTGG - Intronic
980489234 4:133504393-133504415 AATGACCAACAGCAGTTTGGAGG + Intergenic
980506068 4:133723824-133723846 CATTACAAAAAGCAGTATGGAGG + Intergenic
986871176 5:12048686-12048708 CACTACCAAGAACAGTGTGGGGG - Intergenic
988285658 5:29212922-29212944 GGTGACCAAGGGTAGTTTGGAGG + Intergenic
989071922 5:37519845-37519867 CATTATGAAGAACAGTTTGGAGG - Intronic
992731364 5:79672876-79672898 CATTATGAAGAACAGTTTGGAGG - Intronic
995322158 5:110847809-110847831 CATTATGAAGAACAGTTTGGAGG - Intergenic
995588468 5:113673759-113673781 AGTGACCAAAAGCAATTTGGAGG - Intergenic
996259031 5:121442797-121442819 CATTACGGAGAACAGTTTGGAGG + Intergenic
998546521 5:143032567-143032589 CGTTAGCAAACGCAGCTTGGTGG + Intronic
1003158541 6:3616800-3616822 CGGAACCAAGGGCAGCTTGGGGG - Intergenic
1005192258 6:23238370-23238392 CTTTACCTTGAGCAGTTTGTGGG + Intergenic
1011256893 6:85431784-85431806 AATGACCAAGAGCAGTTTGGAGG - Intergenic
1013487864 6:110615604-110615626 AATGACCAAGAACAGTTTGGAGG - Intronic
1014138808 6:117917845-117917867 GGGTACCAAGAACAATTTGGGGG + Intronic
1015959942 6:138637797-138637819 CACTATGAAGAGCAGTTTGGAGG + Intronic
1020737729 7:11972624-11972646 AATGACCAAGAGCAGTTTGAAGG - Intergenic
1021312216 7:19108925-19108947 TGATACCAAGAGCAGTTTGGTGG - Intronic
1033640957 7:143263165-143263187 AATGACCAAGGGCAGTTTGGAGG + Intronic
1033965690 7:146972691-146972713 AGTTATAAAGAGAAGTTTGGAGG + Intronic
1034915583 7:155035845-155035867 AATGACCAAGGGCAGTTTGGAGG + Intergenic
1037408348 8:18567784-18567806 CCTTAGCAAGAACATTTTGGTGG - Intronic
1039730472 8:40270229-40270251 AATGACCAAGAGCAGTTTGGGGG + Intergenic
1039986985 8:42455902-42455924 AATTACCAAGAGTAGTTGGGAGG + Intronic
1044681981 8:94788870-94788892 CTTATCCAAGATCAGTTTGGAGG + Intronic
1044827694 8:96214107-96214129 CGTTGTCAACAGCAGATTGGTGG - Intergenic
1049449544 8:142653106-142653128 AGTGATCAAGGGCAGTTTGGAGG - Intergenic
1050759379 9:9048223-9048245 CATTACAGAGAGCAGTTTGGAGG + Intronic
1051507884 9:17845353-17845375 AATGACCAAGGGCAGTTTGGAGG + Intergenic
1052788046 9:32848163-32848185 CCTTAACAAGAGCAGTTTCCAGG - Intergenic
1055348763 9:75363408-75363430 AATGACCAAAAGCAGTTTGGAGG - Intergenic
1055395747 9:75873239-75873261 CACTATGAAGAGCAGTTTGGAGG + Intergenic
1055833101 9:80406107-80406129 AATGACCAAGAGCAGTTTAGAGG + Intergenic
1059891080 9:118805099-118805121 CATTTCCAGGAGCATTTTGGTGG - Intergenic
1188180780 X:27052869-27052891 TGTGACCAAGAGCAGATTGGTGG - Intergenic
1188475667 X:30588950-30588972 TGTTACGAAGAGCAGTTTAGAGG - Intergenic
1189419316 X:40842500-40842522 AGTGACCAAGGGCAGTTTGGAGG - Intergenic
1190408395 X:50110483-50110505 AATAACCAAGGGCAGTTTGGAGG + Intergenic
1191737066 X:64398211-64398233 CTTTGACAAGAACAGTTTGGTGG - Intergenic
1193111693 X:77736638-77736660 CACTACGAAGAACAGTTTGGAGG + Intronic
1194051277 X:89071962-89071984 AATGACCAAGAGCAGGTTGGAGG + Intergenic
1194758237 X:97763095-97763117 AGTGACCAAGGGCAGTTTGGAGG + Intergenic
1197165385 X:123371453-123371475 CGCTATGAAGAACAGTTTGGAGG - Intronic
1197245782 X:124164798-124164820 AATGACCAAGGGCAGTTTGGAGG + Intronic
1200000680 X:153058344-153058366 CTTTACCAAGAGCAGGTTGGAGG - Exonic