ID: 1147027132

View in Genome Browser
Species Human (GRCh38)
Location 17:37596587-37596609
Sequence ATGCATATTAAAAAACAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 591}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147027132 Original CRISPR ATGCATATTAAAAAACAGTA TGG Intronic
904083822 1:27889268-27889290 AAGAATATTAAAAATCAATATGG - Intergenic
907607942 1:55838292-55838314 AGCCATTTTAGAAAACAGTATGG - Intergenic
907693745 1:56699575-56699597 ATTAATTTTAAAAAACAATAAGG - Intronic
907990307 1:59575667-59575689 AGGCATTTTGTAAAACAGTATGG - Intronic
908164323 1:61443037-61443059 CTCAATATTAAAAAACATTAAGG - Intronic
908650379 1:66326466-66326488 ATGTATATGAAAAAATAGTATGG - Intronic
909270328 1:73616155-73616177 ATGGATCTTAAAGAACAGAAAGG - Intergenic
909372352 1:74898564-74898586 ATGCATAGGAAAAAACAAAATGG + Intergenic
909570028 1:77099083-77099105 CTACATAATAAAAAACAGGAAGG + Intronic
909989349 1:82203546-82203568 ATGCAAAATAAAAAACAGAGGGG + Intergenic
910236233 1:85039187-85039209 AATCATCTTAGAAAACAGTAGGG + Intronic
910719702 1:90272515-90272537 ACGCTTATTAAAGAACAGTAAGG - Intergenic
910745055 1:90564599-90564621 TTCCATACTAAAAAACTGTAGGG - Intergenic
910999678 1:93149853-93149875 ATGCATAGGAAAAAACAGGCCGG + Exonic
911285162 1:95982710-95982732 AAGCATATTAAAAACTAGTTTGG + Intergenic
911594300 1:99783030-99783052 CTGCATTTTAAAAAATAGTGGGG - Intergenic
911635851 1:100235282-100235304 ATGCATTTTTAAAAGCAATAAGG - Intronic
911828182 1:102514912-102514934 ATCCACTATAAAAAACAGTATGG + Intergenic
912275303 1:108251562-108251584 AAGCATGTTATAAAACAGTTTGG - Intergenic
912292920 1:108442787-108442809 AAGCATGTTATAAAACAGTTTGG + Intronic
912567121 1:110595742-110595764 AGTCATAATAAAAAACAGAATGG + Intronic
912942902 1:114060881-114060903 ATGCATATTAAAAATTACAAAGG + Intergenic
913106052 1:115615036-115615058 TTGCATTTTAAAAGATAGTATGG + Intergenic
913302993 1:117392962-117392984 ATTCATATTGAGAAACAGTTGGG + Intronic
913471064 1:119187011-119187033 ATCATTATGAAAAAACAGTATGG - Intergenic
913472426 1:119202698-119202720 ATCCCTATGGAAAAACAGTACGG - Intergenic
914232610 1:145777830-145777852 ATTCAAAATAAAAAACAGGATGG + Intronic
916255140 1:162779558-162779580 ATGCATATTAAAAATAAGAGAGG + Intronic
916356837 1:163919455-163919477 ATCCAAATTAAAAAAAAGAAAGG + Intergenic
916668819 1:166992975-166992997 ATGCTTATTGAAAAACTGTTAGG + Intronic
916913225 1:169374944-169374966 ATGCAAATAAATAAATAGTAAGG + Intronic
917182313 1:172312845-172312867 ATCCATATGGAAAAATAGTAGGG - Intronic
917955696 1:180095387-180095409 AAGCAGAATAAAAAACAATATGG - Intronic
918021437 1:180696291-180696313 AAGCATACAAAAAATCAGTAGGG - Intronic
918274600 1:182941764-182941786 AAGCATATTAAATGGCAGTATGG - Intronic
919374400 1:196775687-196775709 TTGCATATTAAAGAACTATATGG + Intronic
919420900 1:197369177-197369199 ATGCTTAATAAAAAACATTTTGG - Intronic
920245455 1:204584515-204584537 AAGCATATTAAAAAGCAATGTGG + Intergenic
920646729 1:207809192-207809214 TTGCATATAAAAAAAGAGAAAGG - Intergenic
921626426 1:217382011-217382033 ATGCAAAGCAAAAAACAGCAGGG + Intergenic
922376904 1:224978080-224978102 AACCATATGGAAAAACAGTACGG + Intronic
922673644 1:227534775-227534797 CTGCATAGTAAAAAAAAGGAAGG - Intergenic
923205238 1:231752864-231752886 ATGCAAATTGAAATGCAGTAGGG + Intronic
923206694 1:231765986-231766008 ACGCACATTAAAAAAGATTAAGG + Intronic
923214510 1:231835940-231835962 ATGCATATTAATACACAGAGTGG - Intronic
923242911 1:232102962-232102984 ATGGAACTTAAAAAGCAGTAAGG + Intergenic
923389008 1:233495255-233495277 ATGCATATTAAAAACCTTAAAGG + Intergenic
923811157 1:237317980-237318002 AGGCATATGAAAAAACAACATGG - Intronic
923968030 1:239165792-239165814 ATGCAAATAATAAAACAGTGGGG + Intergenic
924003253 1:239577353-239577375 ATTCATTTTGAAAAACAATAAGG + Intronic
924675356 1:246170913-246170935 TTGCATATAAAAAAACTGAAAGG - Intronic
1063752611 10:8968235-8968257 ATGGATATTAAAAAATTGGAAGG + Intergenic
1063865456 10:10360443-10360465 ATGCATGTGAAAAAAGAGGAAGG + Intergenic
1064498582 10:15942837-15942859 ATTCCTTTTTAAAAACAGTAAGG + Intergenic
1064818466 10:19294944-19294966 AACCATAGTCAAAAACAGTATGG - Intronic
1065263112 10:23946557-23946579 AGAGAAATTAAAAAACAGTATGG + Intronic
1065312010 10:24425507-24425529 AAGCATATCATAAAACAGAAAGG - Intronic
1065986362 10:30956964-30956986 AGCCATAATAAAAAACAGCATGG - Intronic
1066682857 10:37951875-37951897 ATGCAAATTGTAAAACAGGAAGG - Exonic
1068041930 10:51835809-51835831 ATCCATCATAGAAAACAGTATGG - Intronic
1068182858 10:53545190-53545212 ATGCATATTAAAAGACAAAATGG - Intergenic
1068334701 10:55618938-55618960 ATGCACTTTACAAAACAGAAAGG + Intronic
1069199084 10:65590917-65590939 ATGGAAAATAAAAAAAAGTAGGG - Intergenic
1069973444 10:72193052-72193074 ATGCATTCTGAAAAACAGTTTGG + Intronic
1070435921 10:76393255-76393277 ATGTAAGTTAAAAAACAGTATGG - Intronic
1070612727 10:77944904-77944926 ATGCATTTCAGAAAACAGTTAGG - Intergenic
1071021512 10:81062566-81062588 CTGTATAATGAAAAACAGTATGG - Intergenic
1071085524 10:81864402-81864424 ATGCATTTTAACAAACAGGAAGG - Intergenic
1071183226 10:83011059-83011081 CTGTATATTTAAAAAGAGTAAGG + Intergenic
1072886318 10:99278194-99278216 ATGCATGTGAAAAAAAAGTTTGG + Intergenic
1073530756 10:104230162-104230184 ATGTATATTAAAAAAAAAAATGG + Intronic
1073959253 10:108907292-108907314 ATGCATATCAAATAACAGTTTGG - Intergenic
1074104519 10:110378528-110378550 ATATATATAAAAAAACAGTATGG - Intergenic
1075502444 10:122987980-122988002 ATACAAATTCAAAAACAGTATGG - Intronic
1075793737 10:125104099-125104121 ATCCCTATTAAAAGACAGCACGG + Intronic
1077652761 11:3988820-3988842 ATGCATATTAAATGACAATATGG - Intronic
1077970700 11:7186859-7186881 AGGCATTTTGGAAAACAGTATGG - Intergenic
1078991087 11:16647348-16647370 AAGTATATTAAACAACATTAAGG - Intronic
1079024087 11:16932199-16932221 ATGAAGATTAAATAACAGAATGG + Intronic
1079155657 11:17945587-17945609 ATGCATAGTATAAAATTGTATGG - Intronic
1079271292 11:18988433-18988455 ATGCATATGGAAACATAGTACGG + Intergenic
1079319084 11:19435646-19435668 AGGCATTTTGGAAAACAGTATGG - Intronic
1079787754 11:24696867-24696889 ATGTATTTTAGATAACAGTATGG - Intronic
1079918635 11:26402858-26402880 ATAAAAATTAAAAAACAGTGAGG + Intronic
1080301128 11:30785967-30785989 ATGCATTTTGAACAACAGTGTGG + Intergenic
1080604886 11:33857138-33857160 AGGCATATTAAAACACAGGTGGG + Intergenic
1081153976 11:39666309-39666331 ATGAATATTAACAAATATTAAGG - Intergenic
1081211038 11:40334117-40334139 ATACATACTAAAACACAGCAAGG - Intronic
1081390899 11:42527536-42527558 ATGCAGATTAGAACTCAGTATGG - Intergenic
1081548979 11:44095112-44095134 ATGCATATGCAAAAACAAGAGGG - Intergenic
1082593855 11:55049783-55049805 TTGCAGATTAAAAAACAACAGGG + Intergenic
1084001319 11:66296635-66296657 ATGCAGATTAAATAAAGGTATGG + Exonic
1085238910 11:75035781-75035803 ATATATATTAACAAGCAGTAAGG + Intergenic
1086012970 11:82127561-82127583 ATGTATTTTAAAAAACATAAAGG + Intergenic
1086749110 11:90468070-90468092 ATGCAAATAAAAAATCATTAAGG + Intergenic
1086834917 11:91608959-91608981 TGGCATGTTGAAAAACAGTAGGG + Intergenic
1087402235 11:97682827-97682849 ATGCATATTCAAGTACAGGAAGG - Intergenic
1087417038 11:97870649-97870671 ATGCATATGCAAAAACAAAAAGG - Intergenic
1087510963 11:99092729-99092751 AAGCATATTACAAAACATCATGG + Intronic
1087606086 11:100380114-100380136 ATGCATATATATAAACATTATGG + Intergenic
1087674533 11:101144389-101144411 AAGCATATTAAAAAATACAATGG - Intergenic
1087848407 11:102999741-102999763 ATGCATAACAAAAAAGAATACGG - Intergenic
1088256290 11:107906818-107906840 GTGCAAATTAAAAAATAGTGGGG - Intronic
1088427583 11:109721555-109721577 AAGCATGTTAAACAACAGGATGG - Intergenic
1088965140 11:114712689-114712711 ATACATACCGAAAAACAGTACGG + Intergenic
1090445619 11:126762384-126762406 ATGCATTTTAAAGAACAGCTAGG - Intronic
1090542602 11:127725289-127725311 ATGCACATAAAACAACAGAATGG - Intergenic
1091008000 11:131971136-131971158 ATCCATATTGAAAAGCAATATGG - Intronic
1091245180 11:134087238-134087260 TTGCATATTAGGAAAAAGTAGGG + Intronic
1092770299 12:11890723-11890745 ATGCTTATTTAAAAAGACTAGGG - Intronic
1093026520 12:14250221-14250243 TTCCATATTAAAAAAAAGAAAGG - Intergenic
1093156812 12:15696257-15696279 AAGCAAAATAAAAGACAGTAGGG + Intronic
1093316802 12:17662451-17662473 ATGCATATCCAAAAATAGGAAGG - Intergenic
1093388030 12:18583076-18583098 ATCCATATGAAAAAGCAGTCTGG - Intronic
1093391064 12:18622628-18622650 AACCATTTTTAAAAACAGTATGG - Intronic
1093528478 12:20133351-20133373 AGGCATATTAAAAAGCAGTAAGG - Intergenic
1093565524 12:20598477-20598499 ATGTATTTTAAAAGTCAGTAGGG - Intronic
1093678187 12:21968352-21968374 ATAGTAATTAAAAAACAGTATGG + Intergenic
1094022464 12:25928819-25928841 ATAAATATTTAAAGACAGTAGGG + Intergenic
1094139935 12:27171092-27171114 AGGAAAATTAAAAAACAGAAAGG - Intergenic
1094417134 12:30229060-30229082 AGCCATTTTAAAAAACAGCATGG + Intergenic
1094480205 12:30875430-30875452 ATACATATTTAAAAACAGATGGG - Intergenic
1095209319 12:39474840-39474862 AGGAAAATTAAAAAACAGAAAGG - Intergenic
1095274901 12:40269685-40269707 ATAAATATTAAAAAACAATGAGG + Intronic
1095575199 12:43729345-43729367 ATGAAATTTAAAAAGCAGTATGG - Exonic
1095726172 12:45455413-45455435 ATACATCTTAAATAAAAGTATGG - Intergenic
1096418491 12:51434788-51434810 CTGGATATTAAAAACCAGTAGGG + Intronic
1097929935 12:65171634-65171656 ATGAATATAAAAAAGCAGCAAGG + Intronic
1098466808 12:70796698-70796720 ATGTATATTAAAAAAAAATCCGG + Intronic
1098565234 12:71927545-71927567 GTGGATATTAAAAAAGAGTGTGG - Intergenic
1098650411 12:72959750-72959772 ATGCATAATCAGATACAGTAAGG - Intergenic
1098665316 12:73154189-73154211 ATTCTTATGACAAAACAGTAGGG - Intergenic
1099323886 12:81186776-81186798 AGCCATTTTAGAAAACAGTATGG + Intronic
1099987933 12:89689718-89689740 ATACATATTAGAAACTAGTAAGG + Intronic
1101030642 12:100655086-100655108 ACACACATTAAAAATCAGTAGGG + Intergenic
1102558372 12:113744210-113744232 GTGTATAGGAAAAAACAGTACGG - Intergenic
1103292201 12:119855637-119855659 ATGCATAGAAAAGAAAAGTAGGG - Intronic
1104483849 12:129132071-129132093 TTGCAAATAAAAAAACAGTGAGG - Intronic
1104501212 12:129287326-129287348 ATGTAAATTAATAAACAGGAAGG + Intronic
1105606916 13:21933514-21933536 ATACATATTAAAAATCCCTAAGG - Intergenic
1106495909 13:30274642-30274664 ATCCATTATAAAGAACAGTATGG + Intronic
1106650025 13:31680141-31680163 AGGCATATTACAAAAGACTATGG - Intergenic
1107009030 13:35649301-35649323 ATGCAGCTTAAAAATCAGTTTGG - Intronic
1107177593 13:37417719-37417741 ATTGAACTTAAAAAACAGTAAGG + Intergenic
1107301704 13:38972956-38972978 ATGCATATTAAAAGATGTTAAGG + Intronic
1107372169 13:39764903-39764925 ATGCAGATTAAAAATCAGAAAGG - Intronic
1107564063 13:41583884-41583906 TTGGATATTATAAGACAGTATGG + Intronic
1108228391 13:48314071-48314093 AAACATACTACAAAACAGTATGG - Intronic
1109064934 13:57674856-57674878 AGCCATATTACAAAACATTATGG + Intronic
1109320547 13:60805064-60805086 AGGCAAATTAACAAACAGAAAGG - Intergenic
1109560866 13:64048271-64048293 ATGCATTTTAATAAATAGTAAGG - Intergenic
1109845801 13:67989142-67989164 ATGCATATTGAAAAAATATATGG - Intergenic
1109917996 13:69017024-69017046 TTGGATATTAAAATACAGCAGGG + Intergenic
1110044387 13:70810431-70810453 ATTCATATTAAAACAAAGTTAGG + Intergenic
1110326856 13:74226379-74226401 ATGAATCTTGAAAGACAGTAAGG + Intergenic
1110365191 13:74675071-74675093 ATGCATTTTAAAGAAAATTAAGG - Intergenic
1110445104 13:75571407-75571429 ATGCATTCTAAAATACAGTGAGG - Intronic
1110759218 13:79212072-79212094 ATCCATTATGAAAAACAGTATGG - Intergenic
1111011600 13:82322553-82322575 ATGTGTATTAAAAGACTGTAGGG + Intergenic
1111076753 13:83247498-83247520 AAGAATATTAAAAAACACTTTGG + Intergenic
1111137477 13:84067168-84067190 ATGTATGATAAAAAAGAGTAAGG - Intergenic
1111203510 13:84972167-84972189 AGTCATTTTTAAAAACAGTATGG - Intergenic
1111622181 13:90738524-90738546 ACGCATATTTCAAAACATTATGG + Intergenic
1111663587 13:91240945-91240967 TTGCAAATGAAAATACAGTAGGG + Intergenic
1111923480 13:94437725-94437747 ATGCATTTTAACAAATATTAAGG - Intronic
1112095943 13:96132372-96132394 AGCCATTTTAGAAAACAGTATGG - Intronic
1112602006 13:100865732-100865754 ATGGTAATTAAAACACAGTAGGG - Intergenic
1112790096 13:102993938-102993960 AGCCATTATAAAAAACAGTATGG - Intergenic
1112810577 13:103213736-103213758 ATGTATATTAAAAAACTCAATGG + Intergenic
1113068809 13:106398254-106398276 ATGACTATCAAAAGACAGTAGGG + Intergenic
1113226812 13:108168575-108168597 ATCCATTTTAAAAAGCAGTCTGG - Intergenic
1113394138 13:109929357-109929379 ATGTATATTAAAAATTAGAAAGG + Intergenic
1113673583 13:112193124-112193146 ATACATATTAAAAAATTCTAGGG + Intergenic
1113722019 13:112565460-112565482 ACAAATATTAATAAACAGTAAGG + Intronic
1114426640 14:22629394-22629416 ATGCATATTAAGAGACAAAATGG + Intergenic
1114967608 14:27982669-27982691 CTGCATATAATAAAGCAGTATGG - Intergenic
1115037651 14:28879551-28879573 ATGGATATTATTAAACAGCATGG + Intergenic
1115127996 14:30019117-30019139 ATGGATTTTAAAAAATAATAAGG - Intronic
1115942573 14:38626109-38626131 AGCCATTATAAAAAACAGTAGGG + Intergenic
1116205117 14:41855381-41855403 TTCCAAATTACAAAACAGTAAGG - Intronic
1116244445 14:42391747-42391769 AGGCATTTCAAAAAATAGTATGG + Intergenic
1116302766 14:43206835-43206857 ATGCAAATTAAAAAATAGAAAGG - Intergenic
1116316647 14:43404911-43404933 AGGCATTTTGGAAAACAGTATGG + Intergenic
1116454611 14:45105326-45105348 ATGAATATTAAAACTCAGAATGG - Intronic
1116743219 14:48783309-48783331 ATCAATATCAAAAAAGAGTAAGG + Intergenic
1118145719 14:63133595-63133617 ATGTAAATTGGAAAACAGTATGG + Intergenic
1118573940 14:67222800-67222822 ATGCACATAAAAGAACACTATGG + Intronic
1119028929 14:71176305-71176327 AAGTCTATTAAAAAACAGTGGGG - Intergenic
1119441695 14:74632657-74632679 TTGTACATTAAAAAAGAGTAAGG - Intergenic
1119687992 14:76648276-76648298 ATTCGTATTAAAAACCAGCAGGG + Intergenic
1119829426 14:77688007-77688029 AGGCATTTCAAAAAACAGTATGG + Intronic
1120499615 14:85278795-85278817 ATGCATATGATAAAACTGCATGG + Intergenic
1120748122 14:88170743-88170765 ATGAAAAACAAAAAACAGTAGGG + Intergenic
1120849194 14:89154070-89154092 ATTCACATTATAAAACAGGAAGG - Intronic
1121334279 14:93067764-93067786 ATCATTATTAAAAAACACTATGG + Intronic
1122258344 14:100497275-100497297 AAGTAGATTAAAAAACAGCAAGG - Intronic
1124654310 15:31496131-31496153 ATGCCTATTACAAGACATTACGG - Intronic
1125399864 15:39290466-39290488 AGGCATTTTTAAAAATAGTATGG + Intergenic
1125637992 15:41205421-41205443 AAGCATGTGAAAAAACTGTATGG + Intronic
1126147751 15:45492969-45492991 AAGTACATTTAAAAACAGTAAGG + Intronic
1126358900 15:47825047-47825069 ATGAATATTAAAAACCTGTTAGG - Intergenic
1126561500 15:50048913-50048935 ATGCACATTAACCAACAGTAAGG + Intronic
1126717379 15:51533377-51533399 ATGCATATTATAAAACCTTGAGG + Intronic
1126923167 15:53550525-53550547 ATGCATAATAAATAAAAGGATGG - Intronic
1127271395 15:57405005-57405027 ATTCACATAAAAAGACAGTATGG - Intronic
1127591601 15:60430785-60430807 ATTCATATAACAAAACAGTTTGG + Intronic
1127636137 15:60871740-60871762 ATGCATAATTAAAAACTTTAAGG + Intronic
1127786659 15:62361688-62361710 AAGCATATTAAATGACAATATGG - Intergenic
1127990738 15:64114350-64114372 ATGGATATCAAAAAAAAGTGGGG + Intronic
1128890495 15:71327473-71327495 ATACATATTAAAACATAATAAGG - Intronic
1130138868 15:81205835-81205857 ATGCAAATTAAAAGAAAGTGAGG + Intronic
1130241421 15:82196572-82196594 TTGCATATTAAAAAACTGAAAGG - Intronic
1130459008 15:84144570-84144592 TTGCATATTAAAAAACTGAAAGG + Intergenic
1132225619 15:100138914-100138936 ATACATTTTAAAAAACAAGAAGG + Intronic
1132325506 15:100965986-100966008 ATTCATATTAAAAAATAAAATGG - Intronic
1132389948 15:101431238-101431260 ATGCAAGTTTAAAAACAGTAAGG - Intronic
1133422368 16:5657350-5657372 ATCCACATTATAAGACAGTATGG + Intergenic
1133514947 16:6499606-6499628 ATTCAGCTTAAAAATCAGTAGGG + Intronic
1136010610 16:27361141-27361163 CTGTATATTAAAAAAAAGGAGGG - Intronic
1136170281 16:28485241-28485263 ATGCATATTACAAAACACTTTGG - Intronic
1137459064 16:48641651-48641673 ATGTATAGCAGAAAACAGTATGG - Intergenic
1137574717 16:49591421-49591443 ATAAATATGCAAAAACAGTATGG + Intronic
1137885713 16:52101438-52101460 ACTCACATTAAAAAACATTAAGG - Intergenic
1138112282 16:54333658-54333680 ATGCATAATAAATAACACGATGG - Intergenic
1138479056 16:57289765-57289787 AGGCAGATTCTAAAACAGTAGGG + Intergenic
1138870021 16:60871293-60871315 ACTGATATTAAAAAACAGCAGGG + Intergenic
1138968371 16:62113947-62113969 ACACATATTAATAAATAGTAGGG + Intergenic
1139227491 16:65247234-65247256 ATACATATTAGAAAACCGTGGGG - Intergenic
1139738999 16:69018583-69018605 ATGCATAGGAAAAAAGAGAAAGG - Intronic
1140975097 16:80052501-80052523 ATGGAGATTAAAAAAAAATAGGG - Intergenic
1141022721 16:80512870-80512892 ATGTATCTTAAAAAAAAATAGGG - Intergenic
1141686959 16:85575921-85575943 AGACACATTAAAAAACAGGAAGG - Intergenic
1143690786 17:8563314-8563336 ATGGATATTAGAAATCACTAGGG + Intronic
1144031302 17:11325545-11325567 ATGCCTATTCCAAAACAATAGGG + Intronic
1144523876 17:15973348-15973370 AAACATAATAATAAACAGTATGG - Intronic
1145354386 17:22127371-22127393 ATGCATATTAAAAAATAAAAAGG - Intergenic
1145815395 17:27791693-27791715 ATACTTGTTAAAGAACAGTATGG - Intronic
1145875476 17:28315864-28315886 ATGTATAGGAAAAAACAATATGG - Intergenic
1146513415 17:33470012-33470034 ATGCATAATACAAAGCAGAATGG + Intronic
1147027132 17:37596587-37596609 ATGCATATTAAAAAACAGTATGG + Intronic
1148883661 17:50754950-50754972 ATGCATTTTTAAAAACAGAATGG - Exonic
1149051178 17:52307168-52307190 ATGCAAATTAAACAACAATGAGG + Intergenic
1149254839 17:54814289-54814311 ATGCTTATTAAGGAACAGTAAGG + Intergenic
1149788436 17:59456123-59456145 ATGTATATAAAGAAACAATATGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1154330098 18:13422394-13422416 ATGCTTGTTAAAAACCAGTAAGG + Intronic
1154929853 18:20981750-20981772 ATGCAAATGAAAAAAGAATAAGG + Intronic
1155810197 18:30223413-30223435 ATGCATTTTAAAGAAAACTAAGG + Intergenic
1156171306 18:34489892-34489914 GTTCATATTAAAAAACACCAAGG - Intergenic
1156307796 18:35895068-35895090 ATGCAAATGAAAACACACTATGG + Intergenic
1156567538 18:38211426-38211448 ATACACATTAAAAAAGAATATGG + Intergenic
1156783582 18:40881717-40881739 ATGCATATTTAAACAAAATATGG - Intergenic
1157777614 18:50408174-50408196 ATTCATATTAAAACAAGGTAAGG - Intergenic
1158254989 18:55536325-55536347 ATTCATATTTAACAACAGTAAGG + Intronic
1158381521 18:56935394-56935416 AGCCATATTAAAAGACTGTAAGG - Intronic
1158433188 18:57410587-57410609 ATACATATATCAAAACAGTATGG - Intergenic
1158596213 18:58818110-58818132 ATGCACATTAGAAATCACTAGGG - Intergenic
1158725962 18:59972320-59972342 AGCCATATAAACAAACAGTAGGG + Intergenic
1158785623 18:60708410-60708432 ATTCATTTTAAAAAACAGAAAGG + Intergenic
1158806705 18:60982536-60982558 AAGCATCTGAAAGAACAGTATGG - Intergenic
1158816733 18:61107688-61107710 ATTCATTTTAAAAAACAATTGGG - Intergenic
1159380841 18:67656791-67656813 TGGCAAATTAAAAAACAGAAGGG - Intergenic
1159645694 18:70915974-70915996 AGGCAAATTAACAAACAGAAAGG - Intergenic
1159681460 18:71357600-71357622 ATCCATTTTAAAAAACAATTTGG - Intergenic
1159747679 18:72258697-72258719 AAGCATATAAAAAAACACTGTGG + Intergenic
1160574254 18:79841675-79841697 ATGCAAATTAAAAGACAGTGAGG + Intergenic
1161854885 19:6758606-6758628 ATGAAAATTAAAACACAGGAAGG - Intronic
1166884854 19:45954132-45954154 GTGCAGATTATAAAACAGGATGG - Intronic
1168178066 19:54639675-54639697 AGCCATTTTAGAAAACAGTATGG + Intronic
1168638472 19:58014393-58014415 ATTCATATTAAAACAAGGTATGG + Intergenic
925491399 2:4399045-4399067 AAGTATATTAAAAAGAAGTATGG - Intergenic
926504521 2:13696494-13696516 ATGTATATTAAAAAACAATTTGG + Intergenic
927167335 2:20337252-20337274 ATGAGTATTAGATAACAGTAAGG + Intronic
927276314 2:21265289-21265311 ATTCTTATTAAGAAACACTATGG + Intergenic
927286431 2:21361889-21361911 ATTCTTATTAAAAAACCTTATGG + Intergenic
927339921 2:21971797-21971819 ATGCATATTTAGAATCAGAACGG + Intergenic
927363875 2:22271502-22271524 ACGCATATTAAAAATTAGAAAGG + Intergenic
927839013 2:26425495-26425517 AATCATTATAAAAAACAGTATGG - Intronic
928683275 2:33724971-33724993 ATTGATATTAAAAAAAATTATGG + Intergenic
929006825 2:37403099-37403121 ATACACATTTAAAATCAGTAGGG - Intergenic
929347259 2:40899845-40899867 ATGCTTGTTAAAGCACAGTAAGG - Intergenic
930305126 2:49666998-49667020 ATGCATGTGAAAAAGCAGTCTGG + Intergenic
930578936 2:53186259-53186281 ATACATAGTGAAAAACAGAAAGG + Intergenic
930583384 2:53240888-53240910 GAGCATAATAAAAAACAGTGGGG - Intergenic
932227836 2:70057099-70057121 AAGGATATTAAAAAACAAAAAGG + Intergenic
932691186 2:73915015-73915037 ATGTATTTTAAAAAAAATTAGGG + Intronic
933123312 2:78570906-78570928 ATGCATTTGAATAAACAGCAAGG - Intergenic
935092604 2:99910385-99910407 TTGGATATTATAAAACATTAAGG + Intronic
935303183 2:101712152-101712174 ATGTATACTAAAAAACTATAAGG - Intronic
935637506 2:105261093-105261115 CAACATATTAAAAAACAGTTTGG + Intergenic
936391589 2:112079683-112079705 AGCCATTATAAAAAACAGTATGG - Intronic
936604118 2:113931103-113931125 ATACATATATGAAAACAGTATGG - Intronic
936696773 2:114959647-114959669 ATCCAGTTTAAAAAACAGTTTGG - Intronic
936891505 2:117375810-117375832 TTGCATTTTCAAAAACAGTTTGG - Intergenic
937245922 2:120493064-120493086 ATGGATATTAATTAACATTAAGG - Intergenic
937525793 2:122768413-122768435 ATGCATATTCTAAAACAGATTGG + Intergenic
938181115 2:129184972-129184994 ATGCATATTATAAGATATTAAGG - Intergenic
939002061 2:136747853-136747875 AGGCACAATTAAAAACAGTAGGG + Intergenic
939276565 2:140005188-140005210 AGCCATTTTAAAAAACAGCATGG + Intergenic
939311021 2:140476874-140476896 ATGTATATACAAAAACACTAGGG - Intronic
939720143 2:145639132-145639154 ATGTAAATTAGAAAACAGTATGG + Intergenic
940117576 2:150225844-150225866 ATGCATATTAAGAGACAAAATGG - Intergenic
940586354 2:155656856-155656878 AGGCATATTAAAAAAATTTAAGG + Intergenic
941207888 2:162597115-162597137 ATCCATTTTAGAAAACAGTGTGG + Intronic
941474802 2:165937607-165937629 CTGTCTATTAAAAAACAGTTTGG + Intronic
941501368 2:166281682-166281704 AAGCATATTAACAAACACTGTGG - Exonic
941584722 2:167343305-167343327 ATGTTTATTATAAAGCAGTAAGG + Intergenic
942083417 2:172423119-172423141 AGACAAATAAAAAAACAGTATGG + Intergenic
942350284 2:175045606-175045628 AGCCATTATAAAAAACAGTATGG - Intergenic
942372048 2:175295592-175295614 ATGCAGATTAACAAAAAGTTGGG - Intergenic
942471262 2:176263007-176263029 ATGTATATAAAAAAACTGGATGG - Intergenic
942588562 2:177514387-177514409 AAGCATATGAAAAAACTGTTAGG + Intronic
942627520 2:177917852-177917874 CTGGAAATTAAAAAATAGTATGG - Intronic
943377243 2:187092636-187092658 ATGGCTATTAACAAACAGTATGG - Intergenic
943403906 2:187455101-187455123 AGCCATGATAAAAAACAGTATGG + Intergenic
943981977 2:194564912-194564934 ATACAGACTAAAAAACATTAAGG - Intergenic
944014964 2:195025000-195025022 ATGCATTATGGAAAACAGTATGG + Intergenic
944179379 2:196871560-196871582 ATGCAAATTAAAAACTACTATGG + Intronic
944180611 2:196888524-196888546 ATACATACTAAAAGACACTATGG + Intronic
944377643 2:199065894-199065916 AATCATATTTAAAAACAGAATGG + Intergenic
944872135 2:203923404-203923426 CTGGATATTGAAAAACAATAGGG + Intergenic
945368503 2:208986702-208986724 ATGCAAATTACACAACAATAAGG - Intergenic
945643253 2:212458069-212458091 AATTATTTTAAAAAACAGTAGGG - Intronic
945647746 2:212521187-212521209 AGGCACTTTAAAAAACAATAAGG + Intronic
946989778 2:225315504-225315526 AGACATATTAAAAAACAAAAAGG + Intergenic
947090941 2:226510863-226510885 ATCGATATTAAAAAATAATATGG + Intergenic
1170688473 20:18589846-18589868 CTGCATATTAAAAAAGATAAGGG + Intronic
1171277255 20:23868395-23868417 ATTCATATTAAAACAAGGTAAGG - Intergenic
1173377608 20:42501793-42501815 ATGCATATTAAAACATATCATGG - Intronic
1174029152 20:47607418-47607440 AAGCATGGTAAACAACAGTAAGG - Intronic
1174567567 20:51477178-51477200 AAGCACTTTAAAAAATAGTAAGG + Intronic
1174676366 20:52360793-52360815 ATGCATACCAAAAAATAGGATGG - Intergenic
1174888302 20:54360030-54360052 TTGCATTTTAAAAAACATTAAGG + Intergenic
1177032443 21:15998454-15998476 ATGCATAACAGAAAACAGCAGGG - Intergenic
1177628585 21:23698459-23698481 ATATATATAAAAAAACAGAATGG + Intergenic
1177707852 21:24732317-24732339 ATGGATATTAAAAAATTATAAGG - Intergenic
1177707882 21:24733089-24733111 ATGCATACTAAAAAATTATAAGG - Intergenic
1178087173 21:29123487-29123509 AAGCATATTAAAAAACATTATGG + Intronic
1178197091 21:30358144-30358166 ATGGATACAAAAAAACATTAAGG + Intronic
1179505975 21:41840786-41840808 ACACATATTAAAAAAAAGCAAGG + Intronic
1182170848 22:28227785-28227807 AACCATTGTAAAAAACAGTACGG + Intronic
949184881 3:1178607-1178629 AAGCATATGAGAAAACAGTGGGG - Intronic
949368986 3:3314218-3314240 AGGCATTTTGGAAAACAGTATGG - Intergenic
950344605 3:12281240-12281262 ATTAATATTAAAACACAGTTTGG - Intergenic
950661973 3:14472271-14472293 AAGCATAATAAAAAAAAGAATGG - Exonic
950783264 3:15410700-15410722 ATGCTCATTAAAAAAAATTAAGG + Intronic
951065018 3:18254115-18254137 ATGCATATTCAATAAAAATATGG - Intronic
951073188 3:18357073-18357095 ATACATCTGAAAAAACAGAATGG + Intronic
951378516 3:21953709-21953731 ATGAATATTAAAAAAATGGATGG - Intronic
951735997 3:25865093-25865115 AGGCATTATGAAAAACAGTATGG + Intronic
952516974 3:34114313-34114335 AAGCAAATTAAAAAAGAGTGTGG - Intergenic
952731723 3:36643720-36643742 ATGCATAATAAACAAAATTATGG - Intergenic
952955280 3:38553391-38553413 AGCCATATTGAAAAACAGTTTGG + Intronic
953013979 3:39054879-39054901 ATGCATTTTAAAAGTCAGGAAGG + Intronic
953506512 3:43490993-43491015 ATGCATATTAAGAGGCAGAATGG + Intronic
953990850 3:47482092-47482114 ATTCATATTAAAACAAGGTAAGG + Intergenic
954041705 3:47892794-47892816 CTGCAATTTAAAACACAGTATGG + Intronic
954056100 3:48027209-48027231 ATGTAAAATAAAAAAGAGTAAGG + Intronic
954978393 3:54720230-54720252 ATACATATAATAAAAAAGTAAGG - Intronic
955664291 3:61333791-61333813 ATGCATATCTAGAAACAGTTTGG + Intergenic
957288121 3:78243154-78243176 AAGCACAGTAAACAACAGTAAGG - Intergenic
957322511 3:78650519-78650541 ATGCATAGACCAAAACAGTATGG - Intronic
957621625 3:82600545-82600567 ATCCTGATTAACAAACAGTAAGG + Intergenic
957655247 3:83065759-83065781 ATGCATATTAAGTAACAAAAAGG + Intergenic
957900460 3:86482194-86482216 ATAAATATTTAAAAACAGCAGGG - Intergenic
958189605 3:90168287-90168309 ATACAGATTAAAAAACATTATGG + Intergenic
958730777 3:97958033-97958055 AAGCATAAAAAAAACCAGTAAGG + Intronic
958939446 3:100294158-100294180 ATGCAACTTAAAACACAGTTGGG + Intronic
959230385 3:103642162-103642184 ATACATAATTGAAAACAGTATGG - Intergenic
959384936 3:105692347-105692369 ATTAAAATTAGAAAACAGTATGG + Intronic
959759031 3:109936019-109936041 AGCCATATTGAAAAACAGTACGG - Intergenic
960346659 3:116540901-116540923 ATGCAAAATAGAAAAAAGTAGGG + Intronic
960464891 3:117985596-117985618 ATACATATTAAAAAAAAATAAGG + Intergenic
960590506 3:119361270-119361292 ATGCATATTGCAATTCAGTAGGG - Intronic
960650836 3:119947763-119947785 CTGCATCTTAGAAAACAATAAGG - Intronic
960771806 3:121201337-121201359 ATGGAAAGCAAAAAACAGTAGGG - Intronic
962026776 3:131556071-131556093 ATGGATATTAAAAAGCAATGGGG + Intronic
962378743 3:134879816-134879838 AATCAAATTAAAAAAAAGTAGGG + Intronic
963343314 3:144063795-144063817 ATACTTGTTAAAGAACAGTAAGG - Intergenic
963550695 3:146718464-146718486 AGCCATTTTAGAAAACAGTATGG - Intergenic
963555017 3:146776213-146776235 ATTCACATTATAACACAGTAGGG + Intergenic
964186795 3:153955245-153955267 ATGCATTTCCAAAAAAAGTAAGG - Intergenic
964366679 3:155958070-155958092 ATGCATATGAAAAAATTTTAAGG + Intergenic
965970737 3:174552886-174552908 AAGCATGTTAAAAAACACTCAGG - Intronic
966102696 3:176292550-176292572 AGGCACATTAGAAAACAGTGTGG + Intergenic
966302867 3:178498257-178498279 ATGAATATGAAAGAACAGTGTGG + Intronic
966686465 3:182701135-182701157 ATGCAAATTAAAACTCAGTGAGG - Intergenic
966832219 3:184019294-184019316 ATACATATGAAAAAACAATCAGG + Intergenic
967717781 3:192783062-192783084 ATTCAAATTGAAAACCAGTATGG + Intergenic
969147972 4:5140964-5140986 AAGTACATTAAAATACAGTAAGG + Intronic
969266321 4:6066444-6066466 ATGCATATTAAAAAGCAAGGAGG - Intronic
969504018 4:7572272-7572294 ATGTAAATAAAGAAACAGTAGGG - Intronic
970014388 4:11497096-11497118 AAGGAAATAAAAAAACAGTAAGG - Intergenic
970379741 4:15494866-15494888 ATGTAAATTTAAAAACAGAATGG + Intronic
970734598 4:19151288-19151310 ATGCCTTTTAAAATACAGTTTGG - Intergenic
970858707 4:20677567-20677589 ATGCATTTCTAAAACCAGTATGG + Intergenic
970936154 4:21572495-21572517 ATGCATATATTAATACAGTAAGG - Intronic
971024561 4:22575896-22575918 ATTCATTTTAAAAAACATTTTGG - Intergenic
971787594 4:31124568-31124590 ATGTATATGAAAAGACAGTGAGG - Intronic
971822379 4:31574768-31574790 AGGGATATTAAAAAAGAGAAAGG + Intergenic
971867147 4:32188006-32188028 ATGCACTTTAAATAAAAGTAGGG - Intergenic
972036677 4:34531535-34531557 ATAAATATTAAAGACCAGTATGG - Intergenic
972285675 4:37645581-37645603 CTGCATATTAGAAGACAGGAGGG + Intronic
972434392 4:39018174-39018196 ATGCATGTTAAAAATTACTATGG - Intronic
972533551 4:39980942-39980964 ATGTATATGAAAATAAAGTAGGG + Intergenic
972799247 4:42456136-42456158 ATGCATATTACATAATATTAAGG - Intronic
972799344 4:42457827-42457849 ATGCATTTTAAAATACACTTTGG - Intronic
973654987 4:53037388-53037410 TTGCATATTAAAATAATGTATGG + Intronic
974463166 4:62216639-62216661 TTGTATATTCAAAAACATTACGG - Intergenic
974831833 4:67199285-67199307 ATTCATTTTATAAAACAGCAAGG - Intergenic
974868684 4:67611584-67611606 ACGTATATTAAAAATCAGTAAGG + Intergenic
974909710 4:68102392-68102414 AGACATTTTTAAAAACAGTATGG - Intronic
975218700 4:71788304-71788326 ATTCATATTTTAAAACAATAGGG + Intronic
975449245 4:74505274-74505296 AGCCATTTTGAAAAACAGTATGG + Intergenic
975677836 4:76845019-76845041 ATGCAGGTTATAAAACAGTATGG - Intergenic
976471970 4:85439389-85439411 AGCCATTATAAAAAACAGTATGG - Intergenic
976579384 4:86717676-86717698 ATGAATATAAAATAACAGGAAGG + Intronic
977333954 4:95672547-95672569 ATGCAGTTGAAAAAAAAGTAGGG + Intergenic
977504108 4:97879738-97879760 ATGCATATTAAAACACAATAGGG + Intronic
977713236 4:100151030-100151052 ATGCTTACAAAAAAACAGAAAGG - Intergenic
979403435 4:120280097-120280119 ATGTATATAAAGAAAAAGTATGG + Intergenic
979444252 4:120792485-120792507 ATCCATTGTAGAAAACAGTATGG + Intronic
979530959 4:121768845-121768867 AAGCATTTTAAAAAGCAGAAAGG + Intergenic
980088771 4:128419475-128419497 ATGCTAATTAATAAAAAGTAAGG - Intergenic
980267915 4:130543694-130543716 ATACATATTTAATAACAGAAGGG - Intergenic
980283693 4:130755496-130755518 AGCCATTATAAAAAACAGTATGG - Intergenic
980470748 4:133248672-133248694 ATGCATATGAAAAAAAAATAAGG + Intergenic
980728448 4:136796522-136796544 ATGTATGTTAAATAACAATATGG + Intergenic
981019783 4:140013368-140013390 TTGCATCTTAAAGAACAGTTAGG - Intronic
981667809 4:147249635-147249657 ATGCATATGATATAACATTAGGG - Intergenic
982131785 4:152235265-152235287 ATACATATTAAAATAAAATATGG + Intergenic
982434002 4:155360649-155360671 TAGCATATTAATAAACAGAATGG + Intronic
982908981 4:161116066-161116088 ATGGAAATTAAAAAAAAGCAGGG - Intergenic
982993067 4:162304161-162304183 AAGGATATTAAATTACAGTAAGG - Intergenic
983146526 4:164222687-164222709 AAGACTATTCAAAAACAGTAAGG + Intronic
983459620 4:168011762-168011784 AGGCATACTATAAAACAATAAGG + Intergenic
983465927 4:168089794-168089816 AGCCATTTTTAAAAACAGTATGG + Intergenic
983742921 4:171157743-171157765 ATTCATATTAAAACAAGGTAAGG - Intergenic
984073196 4:175142669-175142691 ATCCATAATGTAAAACAGTATGG - Intergenic
984101061 4:175486674-175486696 ATTCATATATAAAAACATTAAGG - Intergenic
986782859 5:11083417-11083439 ATGTTTTTTAAAAAACATTAAGG + Intronic
986876733 5:12120281-12120303 ATGAAGATTAAAAAAAAATAAGG - Intergenic
986892592 5:12327434-12327456 ATGCACATTAACCAACAGTAAGG + Intergenic
986986792 5:13509429-13509451 ATGATGATTAAAAAACAGCATGG - Intergenic
987100629 5:14588515-14588537 ATACATATTAAAAGTCAGAAGGG + Intronic
987704869 5:21449665-21449687 AACCATTTTAAAAAATAGTAGGG + Intergenic
988161370 5:27521981-27522003 GTAGATATGAAAAAACAGTATGG - Intergenic
988404508 5:30806838-30806860 ATTTATATTATAAAACAGTGTGG - Intergenic
988933193 5:36057177-36057199 TTGCAAATAAATAAACAGTATGG + Intronic
988963204 5:36390272-36390294 CTGCAAATTAAGAAACAGCATGG + Intergenic
989269815 5:39519717-39519739 ATGCATAATAAAACACAGCAAGG - Intergenic
989424067 5:41275336-41275358 ATTCATATTAGAAACCTGTAAGG + Intergenic
989808023 5:45636250-45636272 ATGCTTATTATAAAACACTCTGG + Intronic
990224495 5:53634191-53634213 AGGCATATTAAAAAAGTGTAAGG - Intronic
990783148 5:59389516-59389538 AGCCATAATAGAAAACAGTATGG + Intronic
991929692 5:71741416-71741438 ATGCAGATTAAAACACAATGAGG - Intergenic
992620548 5:78588164-78588186 AAACAAATTAAAAAACAATATGG - Intronic
992653362 5:78883877-78883899 ATTAATGTTAAAAAATAGTAGGG - Intronic
992764065 5:79978610-79978632 ATCCATATTAAAATAAATTAGGG + Intronic
993057715 5:83001516-83001538 TTGCAGATTAAAACAGAGTAAGG + Intergenic
993214548 5:85002748-85002770 AAGCATTGTGAAAAACAGTATGG - Intergenic
993356531 5:86915910-86915932 AATCATATCAAAAAACAGAAGGG - Intergenic
993854043 5:93050379-93050401 GTGCTTATTAAAAAATATTATGG + Intergenic
994455884 5:100007138-100007160 ATTCATTTTGAAAAACAGTATGG - Intergenic
994543930 5:101138609-101138631 ATTCATATGAAAAAAGAGTATGG - Intergenic
994663277 5:102678684-102678706 CTGCATACTAAAAACCAGCAAGG + Intergenic
994920921 5:106042020-106042042 ATTTAAATTAAAAAAAAGTATGG + Intergenic
994985485 5:106927659-106927681 ATACATAATAAAAAAGAATATGG + Intergenic
994997833 5:107086780-107086802 TTCCATATTAAAAGACAGGAGGG + Intergenic
995437542 5:112153682-112153704 AAGCAGATTACAAATCAGTAAGG + Intronic
995671341 5:114607050-114607072 AGCCATAATAGAAAACAGTATGG - Intergenic
996292528 5:121868993-121869015 CAGCATATCAAGAAACAGTATGG + Intergenic
998627141 5:143859073-143859095 ATTCATATGCAAAAACAGCAGGG + Intergenic
998744635 5:145244254-145244276 ATGCATGTTACAAAAAAGTTGGG - Intergenic
998964577 5:147525332-147525354 ATGTATATTATTAATCAGTAAGG - Intergenic
1000323388 5:160153127-160153149 ATGCAAATTAAAAACCACAATGG - Intergenic
1000804623 5:165774553-165774575 AAACATTTTAAAAAGCAGTATGG - Intergenic
1000918373 5:167109147-167109169 CTGTATATTAGAAAATAGTAAGG + Intergenic
1001793409 5:174481291-174481313 AACCATTATAAAAAACAGTATGG + Intergenic
1001965083 5:175904331-175904353 CTGCATAATCAAAAACAGCACGG + Intergenic
1002251872 5:177934857-177934879 CTGCATAATCAAAAACAGCACGG - Intergenic
1002802756 6:541356-541378 GTTCATATTAAAAGACAGAAAGG + Intronic
1003196442 6:3919270-3919292 ATGCACATTAAGAAACAAAATGG - Intergenic
1004500168 6:16202137-16202159 TTGGATATTAAAAAACCCTAAGG + Intergenic
1004638362 6:17490094-17490116 ATGCATATTAATATAGACTATGG - Intronic
1004757444 6:18628071-18628093 AGCCATTTTGAAAAACAGTATGG + Intergenic
1005136614 6:22575906-22575928 ATGCCTAGTAAAAAATGGTAAGG + Intergenic
1005479444 6:26241396-26241418 ATGCCTAATAAATAACACTAAGG - Intergenic
1005506500 6:26473323-26473345 ATACACATGAAAATACAGTATGG + Intronic
1005769736 6:29055600-29055622 AGCCATTTTAGAAAACAGTATGG - Intergenic
1005853988 6:29846794-29846816 ATGCATATTAAACCATAGTTTGG + Intergenic
1006545296 6:34775971-34775993 ATGCATGTTAAAAGAGAATAAGG + Intergenic
1007530594 6:42538622-42538644 ATGGATTTTAAAAATCTGTAGGG + Intergenic
1007759005 6:44121305-44121327 ATTCATATTCTAAAACAGGAGGG - Intronic
1008017459 6:46537192-46537214 AGCCATTTTGAAAAACAGTATGG + Intergenic
1008120810 6:47615073-47615095 AGGCAGAATAAAAAACAGAAGGG - Intronic
1008344223 6:50406449-50406471 ATGCATTTTAAAAAATTTTAAGG - Intergenic
1008513220 6:52296701-52296723 ATGCACATTAACCAACAGTAAGG - Intergenic
1008524115 6:52390527-52390549 GTGCCTATAAAAAAAAAGTAAGG - Intronic
1009767278 6:68096434-68096456 ATGTATATTAGAAAACAGAAAGG + Intergenic
1010975779 6:82312315-82312337 GTACATTTTAGAAAACAGTATGG - Intergenic
1011282381 6:85689903-85689925 ATGCATATTAGAAAATACTGAGG + Intergenic
1012053184 6:94370096-94370118 ATGCATTATAAGAAACAGTATGG + Intergenic
1012056760 6:94422389-94422411 ATGGAAATTAAAAAACACCAGGG - Intergenic
1012349173 6:98230399-98230421 ATGCAGAGTAGAAAACAGTCAGG + Intergenic
1012641051 6:101614512-101614534 ATGGATATTAAATGACATTAGGG - Intronic
1013093196 6:106920108-106920130 ATGTATACAAAAAAAGAGTATGG + Intergenic
1013640174 6:112067517-112067539 TTACATATGAAAAAACAGAATGG - Intronic
1013833743 6:114307351-114307373 ATGGAAAAAAAAAAACAGTAAGG - Intronic
1013866279 6:114700576-114700598 ATGCATACCAAGAAACAGGAAGG - Intergenic
1013873411 6:114795675-114795697 TAACATATTAAAAATCAGTATGG + Intergenic
1013962466 6:115916871-115916893 ATGCTGATTAAATAACAGCAAGG - Intergenic
1014563882 6:122924860-122924882 GTTTATATTAAAATACAGTATGG - Intergenic
1014576300 6:123078058-123078080 ATGCATATCTAAAAATAGTAAGG + Intergenic
1014619816 6:123653113-123653135 ATGCATGTTTAAAAACATTAAGG + Intergenic
1015616793 6:135085434-135085456 ATGCAGGTTAAACAACATTAAGG - Intronic
1016126244 6:140407969-140407991 ATACACATTTAGAAACAGTAAGG - Intergenic
1016366842 6:143328034-143328056 ATGCATAAGAGAAAACAGTTTGG + Intronic
1016827710 6:148403835-148403857 ACTCATTTTAAAAAACACTATGG - Intronic
1017902253 6:158728638-158728660 TTGTTTATTAAAAAACATTAAGG + Intronic
1018296953 6:162358251-162358273 ATGAATTTTAATAAACAGTTTGG + Intronic
1020456423 7:8378648-8378670 ATGCAGATTAAAAAATAAAAAGG - Intergenic
1020666847 7:11055564-11055586 ATGCATCCTGAAAAACAATATGG - Intronic
1020959169 7:14780582-14780604 ATGCAAACTAAAATACAGCATGG - Intronic
1021453511 7:20804000-20804022 ATGAATATTAAATAAAACTAGGG + Intergenic
1021666899 7:22991993-22992015 TTGCAGATTAAAAAAAAGTAAGG - Intronic
1022751558 7:33232006-33232028 ATGAATATTAACAAAAATTAAGG + Intronic
1022797166 7:33741473-33741495 AGGCATTGTGAAAAACAGTACGG - Intergenic
1024210199 7:47196785-47196807 ATGCAAAATAAATTACAGTATGG - Intergenic
1024278559 7:47699096-47699118 AGAAATATTAAAAAACACTAAGG + Intronic
1024766081 7:52661838-52661860 ATAAATATTAAAGAAAAGTAAGG + Intergenic
1026380082 7:69790731-69790753 AAGAATATTATAAAACTGTAAGG + Intronic
1026509345 7:71015586-71015608 ATGGATATTAAGAAGCAGAAGGG + Intergenic
1026540715 7:71277515-71277537 AAGAATATTACAAAACAGCAAGG + Intronic
1026769432 7:73185473-73185495 ATACATATGAATAAACATTAAGG - Intergenic
1026789772 7:73324142-73324164 CTGCAAATAAAAAAACAGGAAGG + Intronic
1026884838 7:73934209-73934231 ATAGATATTAAAAGATAGTAAGG - Intergenic
1027010301 7:74738857-74738879 ATACATATGAATAAACATTAAGG - Intronic
1027077741 7:75207180-75207202 ATACATATGAATAAACATTAAGG + Intergenic
1027443924 7:78250124-78250146 ATGAATATTAAAAAACAGCAAGG + Intronic
1027807199 7:82842971-82842993 ATCCATAATGGAAAACAGTATGG + Intronic
1028028915 7:85883908-85883930 AAGCATTTTAAAAAACAGAAAGG - Intergenic
1028064419 7:86364381-86364403 ATGCATATTGAAAAACATTTTGG + Intergenic
1028545725 7:91997582-91997604 AAACATGTTAAAAATCAGTAAGG + Intronic
1028948915 7:96611817-96611839 ATTTATATTAAAATACAGTTGGG - Intronic
1029530928 7:101124881-101124903 AGGCAGATTAAAAAGCAGGAGGG + Intergenic
1030066208 7:105661159-105661181 GTGCAAATTAGAAAACAGTCTGG - Intronic
1030230315 7:107201821-107201843 ATACAGATTAATAAGCAGTAAGG - Exonic
1031090852 7:117351759-117351781 ATGCATATTAAAAGACAAAATGG - Intergenic
1031244752 7:119296654-119296676 ATTCAGATTAAGAAATAGTAAGG - Intergenic
1032891029 7:136195001-136195023 AGTCATTTTGAAAAACAGTATGG - Intergenic
1033977408 7:147118737-147118759 TTGCATATCAAAAAATAGAATGG + Intronic
1034952580 7:155310251-155310273 TTGCTTTTTAAAAAACAGTTGGG + Intergenic
1035291497 7:157842103-157842125 ATCCATTTTAAATAACAGGAAGG + Intronic
1035415086 7:158676695-158676717 ATGCATAATAAAAAAGAGACTGG - Intronic
1035780845 8:2227277-2227299 AAGCATCTTCTAAAACAGTAAGG + Intergenic
1035794891 8:2346321-2346343 ATGGATCTGAAAAAACAGAAAGG - Intergenic
1038061517 8:23919033-23919055 ATGCATAGGAAAAAGGAGTAAGG - Intergenic
1039066828 8:33616299-33616321 CTGCATATTAAAAAAGATTAAGG - Intergenic
1039090793 8:33827645-33827667 GTGAGTATTAAAAAACAGTTGGG + Intergenic
1039206005 8:35155568-35155590 ATGAATAAATAAAAACAGTAGGG + Intergenic
1039214497 8:35254399-35254421 ATGGATATTAAAAGACACTCTGG - Intronic
1039637558 8:39182628-39182650 ATGGATATTTAAAGACAGAAAGG - Intronic
1039850286 8:41358867-41358889 ATGCTTATTAAAGTACAGTAAGG + Intergenic
1040521808 8:48183428-48183450 ATGCATAGGAAAAATCAATATGG + Intergenic
1041584290 8:59497639-59497661 ATGCAAACTAAAAAAAAGTTTGG + Intergenic
1041697459 8:60751270-60751292 ATGCATATTAATAAAAATGAAGG - Intronic
1041924800 8:63225480-63225502 AAGCATAATAAAAGGCAGTATGG - Intergenic
1042231574 8:66560713-66560735 ATTCATAGTATAAAAAAGTATGG + Intergenic
1042445434 8:68879230-68879252 ATGCTTTTTGAAAGACAGTATGG - Intergenic
1042487760 8:69365406-69365428 ATTCATATTAAAAAAAAGTTAGG - Intergenic
1042593918 8:70425268-70425290 ATGCAGATTAAAAAAAATAAAGG - Intergenic
1042886778 8:73561085-73561107 ATGCAAATCAAAGAACAGTCTGG + Intronic
1043578658 8:81687116-81687138 ATGCATATAAAAACACATTTCGG - Intergenic
1044063688 8:87671675-87671697 ATGCCTATTAAAAAACCTTCAGG - Intergenic
1044360742 8:91280674-91280696 ATGCAGAGAAAAAAAAAGTAGGG - Intronic
1044427919 8:92074425-92074447 ATGCAGATTAAAAATCAAAAAGG - Intronic
1044690656 8:94874245-94874267 ATGCATATCAAAAAAAAAAACGG - Intronic
1044763499 8:95547659-95547681 AAGTATAATAAAAAAAAGTATGG + Intergenic
1045760036 8:105594344-105594366 ATGCCTTTTAAAACACAGAATGG + Intronic
1045760485 8:105600607-105600629 ATGCAAGTTAAAAAGCATTAGGG + Intronic
1045997113 8:108375954-108375976 ATGGATAGAAAAAATCAGTATGG - Intronic
1046253853 8:111670383-111670405 AAGCATATTAAACAAAGGTAAGG - Intergenic
1046298930 8:112259923-112259945 ATGCATATTCAAATAAAGGAGGG + Intronic
1046894213 8:119455685-119455707 AAGTATATTAAAAATCAATAAGG + Intergenic
1046919778 8:119716081-119716103 ATGCAAATATAAAAACAGAATGG + Intergenic
1047057317 8:121180303-121180325 AGGCATTATAGAAAACAGTATGG + Intergenic
1047949427 8:129918110-129918132 ATGCATAGTTAAAAACAGGGTGG - Intronic
1048818024 8:138352229-138352251 ATGCATTTTAATAATAAGTAGGG + Intronic
1049269960 8:141689931-141689953 ATGCACATTAAAACCAAGTACGG + Intergenic
1051038575 9:12778463-12778485 ATAGATATTCAAAAACAGTAAGG + Intronic
1051201017 9:14623933-14623955 AGTCATTATAAAAAACAGTATGG + Intronic
1051808628 9:21025228-21025250 TTGCTTATTAAGTAACAGTAGGG - Intronic
1052050709 9:23845784-23845806 CTGCATTTAAAAAAAAAGTAAGG + Intergenic
1052111494 9:24589537-24589559 ATACATATTAAAGAACAAAAAGG + Intergenic
1052395227 9:27930491-27930513 ATGCCTATTAGAAAATATTATGG - Intergenic
1053262633 9:36682639-36682661 ATGCATATTAAAATCTAGTATGG - Intergenic
1053383283 9:37666696-37666718 ATACAAAGTAAAAAAGAGTAAGG - Intronic
1055105397 9:72506875-72506897 ATGCATGTAAAAAACCTGTAAGG + Intergenic
1055561935 9:77529829-77529851 ATGCACATTTAAGAACAATAGGG - Intronic
1055659054 9:78483286-78483308 ATGAATTTTAAGAAACAATAAGG - Intergenic
1055663050 9:78525723-78525745 ATACATTTTAAAAAACAGATTGG + Intergenic
1056308363 9:85314079-85314101 ATGCAAATTAAAAACTAATAAGG + Intergenic
1058073498 9:100626097-100626119 ATGCAAATAAAACATCAGTAAGG - Intergenic
1058370300 9:104258732-104258754 ATTCATATTAAAACAAAGTGAGG - Intergenic
1060249555 9:121974457-121974479 ATGCATTTAAAAAAACTGGAAGG - Intronic
1061597183 9:131638906-131638928 TTGCTTATTAAAAGGCAGTATGG - Intronic
1185696758 X:2200797-2200819 ATGTCTATTAAAAAACAATTAGG + Intergenic
1186053490 X:5624962-5624984 ATACATATTTAAAAACATCATGG - Intergenic
1186358561 X:8813655-8813677 ATGCATAGGAACAAACAGAATGG + Intergenic
1186597759 X:11002448-11002470 CTGCATTTTAAAAAGCAGTTAGG + Intergenic
1186811061 X:13188893-13188915 ATGCATATAAGAACACTGTATGG - Intergenic
1187629195 X:21149360-21149382 AAGCATTTTAATAATCAGTATGG - Intergenic
1188652061 X:32643644-32643666 ATTCTTATTAAAATACAGTATGG - Intronic
1188819582 X:34757979-34758001 ATGCATAAAAAAGAGCAGTAAGG - Intergenic
1188874473 X:35413023-35413045 GTTCATATTAAAAACAAGTAAGG + Intergenic
1189245390 X:39559515-39559537 ATGCATATTGAAAAAAAATGTGG - Intergenic
1189370860 X:40427965-40427987 ATGCATATTGAAAATTAGCAGGG + Intergenic
1190984157 X:55485584-55485606 AAGCATATTAAAATACAGACGGG - Exonic
1190994750 X:55595519-55595541 ATGCAAATTAAAACAAAATAAGG - Intergenic
1191695358 X:63984914-63984936 ATGGAAATTATAAAACACTAAGG + Intergenic
1191730341 X:64327596-64327618 ATTCATTATGAAAAACAGTATGG + Intronic
1191876552 X:65803101-65803123 ATGCAAAATGAAACACAGTAAGG + Intergenic
1192628812 X:72758801-72758823 ATGCAAAGCAAAAAAAAGTAGGG - Intergenic
1192652898 X:72962013-72962035 ATGCAAAGCAAAAAAAAGTAGGG + Intergenic
1192695344 X:73408755-73408777 ATGGAAATAAAAAAAGAGTAGGG + Intergenic
1192854135 X:74990086-74990108 ATAAAAATTATAAAACAGTAAGG + Intergenic
1193970495 X:88045339-88045361 AGACATAATGAAAAACAGTATGG + Intergenic
1194188145 X:90800020-90800042 ATGCAGGGTAAAAAAGAGTAAGG + Intergenic
1194196433 X:90899436-90899458 AGACATATCAAAAAACAGAAAGG - Intergenic
1194651054 X:96514898-96514920 ATCCATTATAGAAAACAGTATGG + Intergenic
1194692218 X:97001051-97001073 ATGCATATTAAGAAAATGAAAGG - Intronic
1194989159 X:100526725-100526747 AGCCATTATAAAAAACAGTATGG - Intergenic
1195602056 X:106760558-106760580 AGCCATATTGGAAAACAGTATGG + Intronic
1195725422 X:107910573-107910595 AGCCATTATAAAAAACAGTATGG - Intronic
1196158387 X:112455702-112455724 ATGCAGGTTATAAATCAGTAAGG - Exonic
1196374987 X:115023950-115023972 AAGCATCTAAAAAAACATTATGG - Intergenic
1196406621 X:115369391-115369413 ATGAATATGAAAAAAAAGCATGG - Intergenic
1196703335 X:118695200-118695222 ATGACTATTACAAAACACTATGG - Intergenic
1196924360 X:120618701-120618723 ATTCAGTTTCAAAAACAGTAGGG + Intronic
1197026232 X:121753172-121753194 ATGTCTATGAAAAAGCAGTATGG + Intergenic
1197058259 X:122146456-122146478 AAGAATTTTAAAAAACAGTTTGG + Intergenic
1197371005 X:125626684-125626706 CTTCATATTAAAAAAAATTATGG - Intergenic
1197851103 X:130861174-130861196 ATGTATATTGAAACACAATACGG + Intronic
1199183876 X:144892111-144892133 ATGCTTTTTAAAGAATAGTAAGG + Intergenic
1199381462 X:147177435-147177457 ATGCATATTAAGAGACAAAAAGG + Intergenic
1200534735 Y:4381965-4381987 ATGCAGGGTAAAAAAGAGTAAGG + Intergenic
1200537717 Y:4419584-4419606 AGGAAAATTAAAAAACAGAAAGG + Intergenic
1200542277 Y:4473636-4473658 AGACATATCAAAAAACAGAAAGG - Intergenic
1200746419 Y:6908141-6908163 ATTCAAATTAAAAGCCAGTAGGG - Intergenic
1200903855 Y:8461273-8461295 ATGCAAACTAAATAACAGCAAGG + Intergenic
1202018669 Y:20440361-20440383 GTGGATATTAATAAAAAGTAAGG + Intergenic