ID: 1147033790

View in Genome Browser
Species Human (GRCh38)
Location 17:37664193-37664215
Sequence GTGAAAAATATAAAGACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147033790_1147033798 27 Left 1147033790 17:37664193-37664215 CCATCAGTCTTTATATTTTTCAC No data
Right 1147033798 17:37664243-37664265 ACCTGGTAGACTGTTGTGGAGGG No data
1147033790_1147033792 3 Left 1147033790 17:37664193-37664215 CCATCAGTCTTTATATTTTTCAC No data
Right 1147033792 17:37664219-37664241 ACCTTCATCCTTATCGTCTGAGG No data
1147033790_1147033794 10 Left 1147033790 17:37664193-37664215 CCATCAGTCTTTATATTTTTCAC No data
Right 1147033794 17:37664226-37664248 TCCTTATCGTCTGAGGTACCTGG No data
1147033790_1147033797 26 Left 1147033790 17:37664193-37664215 CCATCAGTCTTTATATTTTTCAC No data
Right 1147033797 17:37664242-37664264 TACCTGGTAGACTGTTGTGGAGG No data
1147033790_1147033796 23 Left 1147033790 17:37664193-37664215 CCATCAGTCTTTATATTTTTCAC No data
Right 1147033796 17:37664239-37664261 AGGTACCTGGTAGACTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147033790 Original CRISPR GTGAAAAATATAAAGACTGA TGG (reversed) Intergenic
No off target data available for this crispr