ID: 1147035425

View in Genome Browser
Species Human (GRCh38)
Location 17:37676319-37676341
Sequence CCCGGGTCTCCTTTTCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147035419_1147035425 -1 Left 1147035419 17:37676297-37676319 CCAGGGGTGGACCTGCCAGGATC No data
Right 1147035425 17:37676319-37676341 CCCGGGTCTCCTTTTCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147035425 Original CRISPR CCCGGGTCTCCTTTTCCCAG AGG Intergenic