ID: 1147038946

View in Genome Browser
Species Human (GRCh38)
Location 17:37702378-37702400
Sequence CAGGGGATGAATCCTGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 1, 2: 2, 3: 13, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147038944_1147038946 -7 Left 1147038944 17:37702362-37702384 CCCTGAGCAGAAAGGACAGGGGA 0: 1
1: 0
2: 6
3: 46
4: 374
Right 1147038946 17:37702378-37702400 CAGGGGATGAATCCTGCTTCTGG 0: 1
1: 1
2: 2
3: 13
4: 159
1147038938_1147038946 8 Left 1147038938 17:37702347-37702369 CCTAAAAGGCGAGACCCCTGAGC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1147038946 17:37702378-37702400 CAGGGGATGAATCCTGCTTCTGG 0: 1
1: 1
2: 2
3: 13
4: 159
1147038945_1147038946 -8 Left 1147038945 17:37702363-37702385 CCTGAGCAGAAAGGACAGGGGAT 0: 1
1: 0
2: 1
3: 34
4: 251
Right 1147038946 17:37702378-37702400 CAGGGGATGAATCCTGCTTCTGG 0: 1
1: 1
2: 2
3: 13
4: 159
1147038942_1147038946 -6 Left 1147038942 17:37702361-37702383 CCCCTGAGCAGAAAGGACAGGGG 0: 1
1: 0
2: 13
3: 42
4: 333
Right 1147038946 17:37702378-37702400 CAGGGGATGAATCCTGCTTCTGG 0: 1
1: 1
2: 2
3: 13
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147038946 Original CRISPR CAGGGGATGAATCCTGCTTC TGG Intronic
900213214 1:1467580-1467602 CGTGAGATGAATCCTGCCTCTGG + Intronic
900218441 1:1494690-1494712 CGTGAGATGAATCCTGCCTCTGG + Intronic
900220778 1:1508401-1508423 CGTGAGATGAATCCTGCCTCTGG + Intergenic
900225783 1:1533113-1533135 CGTGAGATGAATCCTGCCTCTGG + Intronic
902401547 1:16160371-16160393 CAGGGTATGAATCCAGCAACAGG + Intergenic
904572817 1:31479937-31479959 TGGGGGAGGAATCCTGCTTTGGG - Intergenic
904706236 1:32393134-32393156 ATTGGGATGAGTCCTGCTTCAGG - Intronic
906541028 1:46586173-46586195 CATGGGATAAATGCTGCCTCAGG + Intronic
914457389 1:147848637-147848659 GAGGGGATGTGTCCTGTTTCAGG + Intergenic
915970940 1:160354682-160354704 CAGAGTATGAATACTGTTTCTGG - Intronic
920745570 1:208624843-208624865 CAGGTGGTGTATCCTGCTTTGGG - Intergenic
921670954 1:217923640-217923662 CAAGGGTTGGATCTTGCTTCAGG + Intergenic
923783823 1:237049063-237049085 CAGGTGATGATTGCTGCTTTGGG + Intronic
1064084412 10:12334429-12334451 CAGGTGGGGAAACCTGCTTCTGG + Intergenic
1065394309 10:25217740-25217762 GATGGACTGAATCCTGCTTCGGG + Intronic
1065598983 10:27349364-27349386 CAGGGGATTAATCGTGACTCAGG - Intergenic
1067448939 10:46369374-46369396 CAGGGCATGAGTCCTGGTGCTGG + Intronic
1067588430 10:47491391-47491413 CAGGGCATGAGTCCTGGTGCTGG - Intronic
1067635556 10:47999482-47999504 CAGGGCATGAGTCCTGGTGCTGG - Intergenic
1067877973 10:50020921-50020943 CAGGGCATGAGTCCTGGTGCTGG + Intergenic
1070132114 10:73663489-73663511 CAGGGCATGAGTCCTGGTGCTGG - Intronic
1071609569 10:87020586-87020608 CAGGGCATGAGTCCTGGTGCTGG + Intronic
1073587922 10:104728607-104728629 GCTGGGATGAATCCTGCCTCAGG + Intronic
1075456153 10:122586291-122586313 CAGGGAATGAGTCCTACTTGTGG + Exonic
1077148413 11:1056285-1056307 CATGGGATGAGTCCTGCTGTGGG - Intergenic
1077383605 11:2258817-2258839 CAAGAGGTGAATCCTGCTACGGG + Intergenic
1083379209 11:62251147-62251169 CAGGGGCTGACACCTGATTCTGG + Intergenic
1083745552 11:64734642-64734664 TAGGGCATGAATCTGGCTTCAGG + Intronic
1084674153 11:70624448-70624470 CTGGGGGTGAATCCTGGCTCAGG - Intronic
1085297213 11:75437967-75437989 CAGGGACTGAACCCTGCTTGGGG + Intronic
1085566278 11:77517081-77517103 CCAGGGATGAATCTTCCTTCAGG + Intronic
1087891552 11:103542849-103542871 CAGGGAAGGAATCCTCCTTTAGG - Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1089970727 11:122691040-122691062 CAGGGGGAGAATCCTGCCTAGGG - Intronic
1095799866 12:46260622-46260644 CAGGTGATGCGTTCTGCTTCAGG - Intronic
1097552343 12:61090528-61090550 CAGGTGATGAATCCTGCCAGGGG + Intergenic
1097865500 12:64556433-64556455 CAGGGGTGTAATCCTGCATCTGG + Intergenic
1103489284 12:121304456-121304478 CTGGGGCTGAATCCTGATTCTGG + Intergenic
1104775985 12:131390362-131390384 CCTTGGATGAATCCTGCATCAGG + Intergenic
1105539641 13:21304424-21304446 CAGGGTATGAAACCTCCTTTTGG - Intergenic
1105576474 13:21657752-21657774 AAGGGGATGACTCATGCCTCAGG + Intergenic
1105798699 13:23883805-23883827 CAGGGTATGAAACCTCCTTTTGG + Intronic
1107038903 13:35928389-35928411 CCGGGGATGATTCTTGCTTCTGG + Intronic
1114629065 14:24147676-24147698 CTGGGGCTGACTCCTGCCTCAGG + Exonic
1115899149 14:38125715-38125737 CAGGAGCTGTCTCCTGCTTCCGG + Intergenic
1118574723 14:67230943-67230965 AAGGGGATGATTCCTGTTCCAGG - Intergenic
1119844622 14:77819547-77819569 CTGGGTATGAGTCCTGCATCAGG - Intronic
1120841606 14:89090387-89090409 CTGGGGTTGAATCCTGCTGTGGG - Intergenic
1122196473 14:100091203-100091225 CAGGGGACGATTCCTGCCTTGGG - Intronic
1122365706 14:101193772-101193794 CAAGTCATGACTCCTGCTTCTGG + Intergenic
1124076810 15:26453980-26454002 CTGGGGAAGAATTCTGCTCCTGG + Intergenic
1125136293 15:36347729-36347751 CTGGGGCTGAATCCTGCTTCAGG - Intergenic
1126173867 15:45717259-45717281 CATGGGATGAATCCTCCTTCAGG + Intergenic
1126716651 15:51525180-51525202 CAGGTGATGAATCCTGCCAGGGG - Intronic
1127315557 15:57791139-57791161 TCTGGGATGAATCCTGCCTCAGG + Intergenic
1127827513 15:62718049-62718071 CAGGAAATGAACCCTGCTCCAGG - Intronic
1128789447 15:70422455-70422477 GAGGGGCTGAAACTTGCTTCAGG - Intergenic
1130742119 15:86612194-86612216 GAGGTGATGCATCCTGCTGCTGG - Intronic
1131489178 15:92847682-92847704 AAGAGGAAGAATTCTGCTTCAGG - Intergenic
1133338701 16:5022866-5022888 CAGGGGCTCAATCCTGCTGGGGG - Intergenic
1133955793 16:10442893-10442915 CAGGGTTTGAATCCTTGTTCTGG - Intronic
1134062894 16:11209725-11209747 CAGTGGATGGATGCTGCTTCAGG + Intergenic
1134395829 16:13862447-13862469 CAGAGGATGAAGCCAACTTCTGG - Intergenic
1136048899 16:27636880-27636902 CAGGGGCTGCCTGCTGCTTCAGG + Intronic
1141129385 16:81425034-81425056 CTGGTGGTGAGTCCTGCTTCAGG - Intergenic
1141635724 16:85312951-85312973 CAGGGGATGAAGCGGGCCTCAGG + Intergenic
1141739523 16:85881638-85881660 CAGGGAATGGATTCTCCTTCAGG - Intergenic
1144397008 17:14854203-14854225 CAGGAGATGCATTCTGATTCTGG + Intergenic
1147038946 17:37702378-37702400 CAGGGGATGAATCCTGCTTCTGG + Intronic
1147689947 17:42308876-42308898 CAGCTGATGAATCCTGCCTGAGG - Intronic
1148445928 17:47737034-47737056 CAGGGGGTGATTCCTGGGTCTGG + Intronic
1150807984 17:68334291-68334313 CAGGGAATGAACCCATCTTCTGG + Intronic
1151116403 17:71740260-71740282 CAGGGGGTGAATCAGGTTTCAGG - Intergenic
1152742080 17:82022829-82022851 CAGGAGCTGGATCCGGCTTCCGG - Exonic
1154322779 18:13368155-13368177 CAGGGGATGCTTCCTGCACCAGG + Intronic
1155366117 18:25050577-25050599 CAGGGGACGAGTCCTGTCTCTGG - Intergenic
1155411947 18:25556183-25556205 CAGGGAAGAAATCCAGCTTCTGG + Intergenic
1155446392 18:25917053-25917075 CAGGGTGTTTATCCTGCTTCCGG - Intergenic
1157683734 18:49626788-49626810 CAGGGGCTGCTTTCTGCTTCGGG + Intergenic
1163999343 19:21082655-21082677 CAGGGGTAGAATCCTGACTCGGG + Intronic
1167712400 19:51120440-51120462 AAGGGGCTGATTCCTGTTTCTGG - Intergenic
1167942979 19:52962538-52962560 CAGGGCAAGAATCCAGCTCCGGG + Intronic
926045811 2:9708870-9708892 CAGGGGCTGCCTCCTGCCTCAGG - Intergenic
934246971 2:90315855-90315877 CTGGGGCTGATTCCTGCTCCGGG + Intergenic
934262354 2:91486748-91486770 CTGGGGCTGACTCCTGCTCCGGG - Intergenic
936011835 2:108930061-108930083 CAGGGGAGGCCTCCTGCTTGTGG - Intronic
937475388 2:122210370-122210392 CAGGAGATGGACCCTGCTGCTGG + Intergenic
937870978 2:126786068-126786090 CAGGGGATGAACACTCATTCAGG - Intergenic
944372638 2:199003482-199003504 CAGCTGAGGAATCCTGCTTGAGG + Intergenic
945653015 2:212588402-212588424 CTGGGTGTGAATCCTGGTTCTGG + Intergenic
946709316 2:222490236-222490258 CATGGGATGGACCCTGGTTCAGG + Intronic
947397691 2:229702615-229702637 CAGGTTAAGAATCCTGGTTCTGG + Intronic
948176911 2:235950571-235950593 CAGGGGATGAAGGCTGCTGTAGG + Intronic
1168938316 20:1686998-1687020 CAGGAGATGATTCCTTCTGCTGG - Intergenic
1169600750 20:7258079-7258101 CAGGGTATGTATTCTGCTTTTGG - Intergenic
1171035478 20:21709554-21709576 CTGGGCATGAACCCTTCTTCTGG + Intronic
1174819064 20:53711838-53711860 CAGGTGGTGAATGCTGATTCTGG + Intergenic
1175608766 20:60332830-60332852 CAGGGGAAGATTCCTGCTTTGGG + Intergenic
1176999959 21:15599997-15600019 ATGGGGATGAATTCTACTTCTGG + Intergenic
1178019911 21:28396135-28396157 CAGGGGATGAACCCTCCTCTGGG + Intergenic
1179320409 21:40285937-40285959 CAGGGGATCACTGCTGCTTCAGG + Intronic
1179878149 21:44281842-44281864 CAGGGGATGGAACCTCCATCTGG + Intergenic
1180160825 21:45997993-45998015 CAGGGGAGGGAGCCGGCTTCTGG + Intronic
1180220262 21:46354174-46354196 CAGGGGAGGAAGGCTGCTTGCGG + Intronic
1181491235 22:23262156-23262178 CAGCGGAGGAAGCCTGCTTTAGG - Intronic
1182267411 22:29128809-29128831 CAGGGTTTGAATCCTGGCTCTGG - Intronic
1183772475 22:39938768-39938790 CAGAGGATGAATCGTTATTCGGG + Intronic
950097271 3:10337567-10337589 CTGGGGAAGAAACCTGCTTCTGG + Intronic
950704131 3:14769627-14769649 CACGGCATGACGCCTGCTTCAGG - Intronic
950898736 3:16477204-16477226 CAGGTGATTAATCCAGTTTCAGG - Intronic
951473566 3:23081492-23081514 CATGGGTTGAAGGCTGCTTCTGG - Intergenic
954477571 3:50762514-50762536 ATGGGGATGAATTCTACTTCTGG + Intronic
956454260 3:69405444-69405466 CACAGGATGGCTCCTGCTTCTGG - Intronic
961388614 3:126538520-126538542 CAGGGCATGAGCCCAGCTTCAGG - Intronic
961664263 3:128486461-128486483 GAGGGGATGACTGCTGGTTCTGG - Intronic
962270122 3:133971380-133971402 GTGGGGCTGAATCCTGCTTCAGG - Intronic
973084259 4:46035186-46035208 CAGGGGATGACTGCTGTTTCTGG - Intergenic
975441554 4:74417115-74417137 CAGGGGAAGAAGTGTGCTTCAGG + Intergenic
980429872 4:132680323-132680345 CAGGGTATGAAGACTGATTCTGG + Intergenic
985933467 5:3077660-3077682 CAGGGTTTAAATCCTTCTTCTGG - Intergenic
987105996 5:14640034-14640056 GAGGGGCTGACTCTTGCTTCTGG - Intergenic
990997775 5:61750264-61750286 CAGTGGATGAATGCTGCCACTGG + Intronic
992641998 5:78775638-78775660 ATGGGTATGAATCCTTCTTCAGG + Intergenic
996749352 5:126873485-126873507 CAGGTGATGCAGCCTGCTGCTGG - Intronic
1002356140 5:178630449-178630471 CTGGGTCTGAATCCTGATTCTGG - Intronic
1002947780 6:1779305-1779327 CGGGGGAAGTATCCTGCTTCTGG + Intronic
1004752090 6:18572766-18572788 CAGGGTTTGCATCCTACTTCTGG + Intergenic
1004767253 6:18744139-18744161 CAGGAGAGGAATCCTGACTCGGG + Intergenic
1004857050 6:19761930-19761952 CAGGGGATGAATCCTGTTTCAGG - Intergenic
1006724102 6:36183914-36183936 CAGGAGATGAATCCAGCCTTGGG + Intergenic
1008134397 6:47757065-47757087 CAAGGGAAGAATTGTGCTTCTGG + Intergenic
1009904084 6:69847318-69847340 CAAGGGTTCCATCCTGCTTCAGG + Intergenic
1011047326 6:83099018-83099040 CAGGGGAAGATTCCTGCCTTAGG + Intronic
1011506034 6:88045208-88045230 CAGGGGAGAAATCCTGCCTCTGG + Intergenic
1012798166 6:103790223-103790245 CAGGGAATGAAGGCTGCCTCTGG + Intergenic
1013724598 6:113078026-113078048 GAGGGGATGAATCCAGCTGTGGG + Intergenic
1019558983 7:1646600-1646622 CAGGGGATGGACCCTCCTCCAGG + Intergenic
1019984771 7:4647701-4647723 CAGGGGCTGACTCCAGCTTCTGG + Intergenic
1022027067 7:26458616-26458638 CAGGTGCTGAATTTTGCTTCAGG + Intergenic
1023257853 7:38329623-38329645 CATGGAATGAATTCTGCTGCAGG + Intergenic
1024635985 7:51290848-51290870 CTGGGGAGGCACCCTGCTTCAGG - Intronic
1026051786 7:66952923-66952945 CAGGGGAGGAAGCCTGCTGGAGG + Intronic
1027144815 7:75687254-75687276 CAGGGATTGGCTCCTGCTTCTGG - Intronic
1032386394 7:131528471-131528493 CAGGGGCTGGATCCAGCTGCTGG - Intronic
1033980002 7:147152152-147152174 TAGGGGATTAAATCTGCTTCTGG + Intronic
1034247923 7:149663020-149663042 CAGGGCTGCAATCCTGCTTCAGG + Intergenic
1035395211 7:158530473-158530495 CAGTGCATGAAACCTGCTCCAGG - Intronic
1036213983 8:6863943-6863965 CTGGGGGTAAATCATGCTTCTGG - Intergenic
1038653574 8:29428045-29428067 CAGGGGATGAAACCTCCATATGG + Intergenic
1039508827 8:38072605-38072627 CAGGCGATGAATCATGGTGCTGG - Intergenic
1043287883 8:78558131-78558153 CAGGTAATGAATACCGCTTCTGG + Intronic
1043823889 8:84901724-84901746 GAGGGGATGGATCCTGGCTCAGG + Intronic
1047003691 8:120597797-120597819 CCAGGGATGAATCAGGCTTCTGG + Intronic
1047382660 8:124377702-124377724 CAGGGGATCAATCCTCTTTCTGG - Intergenic
1047543671 8:125795390-125795412 CAGGGGCAGAATCTTGATTCTGG - Intergenic
1047566575 8:126050435-126050457 CTGGGGATGAATCTTACTTCAGG - Intergenic
1048788752 8:138080582-138080604 AAGGAGAGGAATCCTGCTTGGGG - Intergenic
1052050555 9:23843025-23843047 CAGATGATGATTGCTGCTTCAGG - Intergenic
1054779803 9:69155844-69155866 CAGGGGAGGATTCCTGCGGCAGG + Intronic
1058373669 9:104298788-104298810 CAGCAGATGAAACCTGCTGCAGG + Intergenic
1058428954 9:104901109-104901131 CAGGGAAGGAATCCTGCAACAGG - Intronic
1060198257 9:121636957-121636979 CAGGGGATAAATCCTACCCCTGG - Intronic
1061976518 9:134070669-134070691 CAGGGGAGGAAACCTGGGTCGGG - Intergenic
1062146402 9:134992154-134992176 CAGGGGATTTTTCCTCCTTCTGG - Intergenic
1185856869 X:3544145-3544167 CTGGACATGAATCCTGCTGCTGG - Intergenic
1187722543 X:22166241-22166263 AAGGAGATGAGTCATGCTTCAGG - Intronic
1187764282 X:22622529-22622551 CAGGTGGTGAATCCTAATTCAGG + Intergenic
1188033762 X:25294066-25294088 TAGGGGAAGAAACCTGGTTCAGG - Intergenic
1189174731 X:38944704-38944726 CAGATGATGAATTCTGCTTTGGG - Intergenic
1190277847 X:48910774-48910796 CAGGGACTGAATCCTGTATCAGG + Intronic
1194598528 X:95890086-95890108 CAGGGGAAAAATCATGCTTTGGG - Intergenic
1198483586 X:137063995-137064017 CTGGGTTTGAATCCTGGTTCTGG + Intergenic
1198737806 X:139806939-139806961 CAGGGGATGGGACCTGCTACAGG + Intronic
1200428125 Y:3045218-3045240 CAGGGTCTGACTCCTGATTCAGG - Intergenic
1200807357 Y:7446309-7446331 CTGGACATGAATCCTGCTGCTGG + Intergenic
1202138366 Y:21692281-21692303 GAGGCCCTGAATCCTGCTTCTGG + Intergenic