ID: 1147040743

View in Genome Browser
Species Human (GRCh38)
Location 17:37716722-37716744
Sequence CTCTATGAGCTGTAGCTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 3, 3: 5, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147040743_1147040748 22 Left 1147040743 17:37716722-37716744 CCTTAGAGCTACAGCTCATAGAG 0: 1
1: 0
2: 3
3: 5
4: 98
Right 1147040748 17:37716767-37716789 CTAAGAGCTTCAAAAAATCATGG 0: 1
1: 0
2: 1
3: 28
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147040743 Original CRISPR CTCTATGAGCTGTAGCTCTA AGG (reversed) Intronic
903973234 1:27132843-27132865 CTTAATGAGCTGTGGCTCCAGGG + Intronic
905852927 1:41287334-41287356 TTTTAAGAGCTGTAGGTCTATGG - Intergenic
907202478 1:52739456-52739478 TTCTATTAGCTGTAGTACTATGG + Intronic
907235453 1:53042165-53042187 TTCTATGAGCTGCCACTCTAAGG + Intronic
911835263 1:102610899-102610921 CTTTATGAGCTGTAACACTCAGG + Intergenic
915045541 1:153011273-153011295 CTTTATGAGCTGTAACACTGCGG - Intergenic
919681703 1:200441937-200441959 CTTTAGGAGCTGTATCCCTAGGG + Intergenic
921965332 1:221082121-221082143 ATCTATGAGCTTCAGCTTTAAGG + Intergenic
922197949 1:223376063-223376085 CTCTATGAGCTGTCACACTCAGG + Intergenic
923651296 1:235876530-235876552 CTCTATGATCTGTAGCCACATGG + Intronic
1071563086 10:86658135-86658157 CTCTATAAGCAGTGGCTCTTTGG + Exonic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1077824920 11:5796528-5796550 CACTCTGGGCTGAAGCTCTATGG + Intronic
1085157227 11:74306884-74306906 GTCTGTGAGCTGAAGCTCTAGGG + Intronic
1086155905 11:83665849-83665871 CTCTATCAGCTGTAGCAGTTAGG + Intronic
1087995689 11:104805466-104805488 CTCTATTAGCTATAGTTCAAGGG - Intergenic
1088699687 11:112400789-112400811 CTTTATGAGGTGTAGCACCAGGG - Intergenic
1089529466 11:119116912-119116934 CTCTGTGAGCAGTGGCTCTGTGG + Exonic
1091144891 11:133270296-133270318 CTCTATAAGCTTTAGCTAGATGG + Intronic
1091901259 12:4145818-4145840 CCCTATCCCCTGTAGCTCTAGGG - Intergenic
1097106421 12:56628904-56628926 CTCTATGACCTCTAGCTAAAGGG + Intronic
1097579878 12:61442150-61442172 TGTTATGAGCTGTGGCTCTAAGG + Intergenic
1097639272 12:62160081-62160103 CTCTTTGAGCTCTAACACTATGG - Intronic
1100743559 12:97621119-97621141 CACTAGGAGCTTTAGCTCTCTGG - Intergenic
1102438533 12:112944210-112944232 CTCTTTGAGCTGTTGCTCTAGGG + Intronic
1103252451 12:119511916-119511938 TTCTAGGATCTGTGGCTCTAGGG + Intronic
1103859115 12:123997779-123997801 CTGGATTAGCTGGAGCTCTAAGG - Intronic
1104071578 12:125350302-125350324 CTCTCTGACCAGTAGCTCTGTGG + Exonic
1104275308 12:127321510-127321532 CACTTAGAGCTGCAGCTCTAAGG - Intergenic
1104519125 12:129456761-129456783 CTCTACGAGCTGCATCTCTCGGG + Intronic
1105600437 13:21881802-21881824 ATGTGTGAGCTGTAGCTCTCAGG - Intergenic
1106627249 13:31433474-31433496 CTTTGGGAGCTGTAGCTCTCTGG + Intergenic
1107467009 13:40660329-40660351 CTATATGTGCTGTAGCTTTGGGG - Intronic
1108482460 13:50888194-50888216 CTGTATGTGCTGTATCTCTGGGG - Intergenic
1111371823 13:87329052-87329074 CTCTATCATCTGTAGTTCTCAGG - Intergenic
1116886689 14:50229130-50229152 TGCTAAGAGCTGTAGCTCTTAGG - Intronic
1116929407 14:50674825-50674847 CTCTATGAGATTTAGTTCTTTGG - Intergenic
1116956876 14:50932991-50933013 CTCTTTGAGCTGTGGCTCTTCGG + Intronic
1119553994 14:75539673-75539695 GTCTTAGAGCTGAAGCTCTAGGG - Intronic
1121446568 14:93982628-93982650 TTCCATGAGCTGGAGCTCTCTGG + Intergenic
1125256690 15:37772112-37772134 CACTAAGATCTGTAGCTCTGTGG + Intergenic
1126225370 15:46262948-46262970 CTCTCTGAGATGGAGCTCCAGGG - Intergenic
1126943982 15:53797655-53797677 ACCTATGAGCTGTAGTCCTATGG - Intergenic
1128902163 15:71433945-71433967 GTCTGTGAGCTAAAGCTCTAAGG - Intronic
1129038049 15:72662875-72662897 CCCGATGAGCTGTAGCTCACAGG - Intronic
1129211841 15:74074356-74074378 CCCGATGAGCTGTAGCTCACAGG + Intronic
1129398562 15:75266728-75266750 CCCGATGAGCTGTAGCTCACAGG - Intronic
1129402170 15:75291004-75291026 CCCGATGAGCTGTAGCTCACAGG - Intronic
1129789235 15:78329726-78329748 ATCTTTGAGCTTTAGCTCAAGGG + Intergenic
1138652359 16:58467992-58468014 CTCTCTGAGCTGTGTCTCTGGGG + Intronic
1143268477 17:5658327-5658349 CTCTCTGAGCTTTAGCTCCCTGG + Intergenic
1144739154 17:17571600-17571622 CTTTCTGGGCTGTGGCTCTAGGG - Intronic
1147040743 17:37716722-37716744 CTCTATGAGCTGTAGCTCTAAGG - Intronic
1151251336 17:72837932-72837954 CTCTTTGAGCAGTACCTCTGAGG - Intronic
1153663787 18:7350118-7350140 CTCCATGAGCAATAGCTCTGGGG + Intergenic
1155345628 18:24853889-24853911 CTCCATGAGTTTAAGCTCTATGG + Intergenic
1156847360 18:41682076-41682098 ATATATAAGCTGCAGCTCTATGG - Intergenic
1157760449 18:50259952-50259974 TTCTAAGAGCTGTAGCTCTAGGG + Intronic
1163476549 19:17529510-17529532 CTCTTTGAGCTGTTGCCCTAAGG - Intronic
1168592299 19:57647352-57647374 CTACATGAGCTGGAGCTCTCTGG + Intergenic
930413316 2:51055131-51055153 CTCTATGAGCTGTAACTCAAGGG - Intergenic
931899051 2:66767640-66767662 CTTTATCAGCTGTACCTCCAGGG + Intergenic
934299466 2:91768603-91768625 CTCTAGGAGCTGTTACTCCAAGG - Intergenic
937043413 2:118837774-118837796 CTCTGCCAGCTGTAGCTCTTGGG - Intergenic
941541055 2:166784759-166784781 CTCTATGACCTAATGCTCTAAGG + Intergenic
1169970289 20:11262307-11262329 CTCTATGTGCTTTAGCTCCATGG + Intergenic
1170303294 20:14909818-14909840 CTCTATGATCTGTAGGTATGGGG + Intronic
1170432204 20:16286505-16286527 CTCTCTCAGCTGTAGTTCAAAGG - Intronic
1174201128 20:48807366-48807388 CTGTATGTGCTGTACCTTTAAGG - Intronic
1175501925 20:59456726-59456748 CTCTCTGAGCTGCATCTCTCAGG - Intergenic
1179319264 21:40274121-40274143 CTCTAGGAGCTTTTGCTCTCTGG - Intronic
1181373705 22:22439616-22439638 GTCTATGAGCTGAACCTCAAAGG + Intergenic
1181556568 22:23674880-23674902 CTCTAGGAGCTGTCACTCCAAGG + Intergenic
1181697822 22:24602705-24602727 CTCTAGGAGCTGTCACTCCAAGG - Intronic
949583967 3:5419136-5419158 CTCTTTGATCTGGACCTCTAAGG + Intergenic
952560888 3:34592353-34592375 GGTTATGTGCTGTAGCTCTAGGG + Intergenic
952757189 3:36881115-36881137 TTATATGAGCTGTATCTCAATGG - Intronic
959350037 3:105250387-105250409 CTCCCTCAGCTGTAGCTCTGGGG - Intergenic
959702182 3:109308929-109308951 ATCTATGTGTTGTACCTCTAAGG - Intronic
962957077 3:140276143-140276165 CCCCATGAGGTGTAGCTCCATGG + Intronic
966508124 3:180730226-180730248 TTTTATGAGGTGAAGCTCTAAGG - Intronic
969246411 4:5936014-5936036 CTCTAAGAGCTTTATCTATATGG + Intronic
971469137 4:27001208-27001230 CACTGTGAGCTGTATCTCTTTGG + Intronic
976520887 4:86024901-86024923 CTTTATCAGCTGTATTTCTAGGG + Intronic
986486419 5:8242712-8242734 CTCTATGGTCTCTGGCTCTAAGG + Intergenic
987247305 5:16061463-16061485 TTCTGTGAGCTGCAGCTCTCAGG - Intergenic
992421510 5:76611014-76611036 TTCTAGGAGTTGTAGCTGTAGGG + Exonic
994193311 5:96893586-96893608 CTCTGTGAGCTCTACCTCTGAGG + Intronic
1005210822 6:23460321-23460343 CTTTAGGAGCTGTATCTCTATGG - Intergenic
1010007363 6:71010528-71010550 CTGCCTCAGCTGTAGCTCTAGGG + Intergenic
1014514560 6:122364066-122364088 CTATATGAGATGTGGCCCTATGG + Intergenic
1016877817 6:148881226-148881248 CTCTAAGAGGTTAAGCTCTATGG + Intronic
1018786495 6:167112507-167112529 CTCTATGAGCCATAACTATAAGG + Intergenic
1019388708 7:773511-773533 CTCTCTGAGCTGTGGCCCTTGGG + Intronic
1019716256 7:2540843-2540865 CTCTCTGAGCAGCAGCTCTGTGG + Intronic
1020220742 7:6234687-6234709 CTGGGAGAGCTGTAGCTCTAGGG + Intronic
1021667957 7:23005678-23005700 CTCTATCAGCTCTTTCTCTATGG + Intronic
1033511604 7:142065260-142065282 CTCTGGGAGCAGAAGCTCTATGG + Intronic
1033929627 7:146506463-146506485 CTACACGAGATGTAGCTCTATGG - Intronic
1035913648 8:3596115-3596137 CTCTTTGCTCTGTAGCTCGAGGG + Intronic
1047143076 8:122164409-122164431 CTCTATGGGCTGTCTCTCTGAGG - Intergenic
1058568092 9:106308678-106308700 CTTTATTAGATGTAGCTCTTAGG - Intergenic
1187985807 X:24809309-24809331 ATCTCTGATCTGTAGCTATATGG + Intronic
1194032947 X:88837980-88838002 CTCTATGACCTAATGCTCTAAGG + Intergenic
1198026075 X:132708606-132708628 ATCTATGAGCTGTTTCCCTAAGG - Intronic
1201647909 Y:16255683-16255705 CTCTATGATCTAATGCTCTAAGG - Intergenic
1201654901 Y:16329618-16329640 CTCTATGATCTAATGCTCTAAGG + Intergenic