ID: 1147044680

View in Genome Browser
Species Human (GRCh38)
Location 17:37743976-37743998
Sequence TTGTTAGCCGCGCCCATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 27}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147044680_1147044682 -8 Left 1147044680 17:37743976-37743998 CCTTGCATGGGCGCGGCTAACAA 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1147044682 17:37743991-37744013 GCTAACAAGAGTGCCCACCAGGG 0: 1
1: 0
2: 2
3: 9
4: 88
1147044680_1147044686 13 Left 1147044680 17:37743976-37743998 CCTTGCATGGGCGCGGCTAACAA 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1147044686 17:37744012-37744034 GGAACTCGCCTCCCAGATCCCGG 0: 1
1: 0
2: 0
3: 9
4: 113
1147044680_1147044681 -9 Left 1147044680 17:37743976-37743998 CCTTGCATGGGCGCGGCTAACAA 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1147044681 17:37743990-37744012 GGCTAACAAGAGTGCCCACCAGG 0: 1
1: 0
2: 0
3: 7
4: 79
1147044680_1147044687 19 Left 1147044680 17:37743976-37743998 CCTTGCATGGGCGCGGCTAACAA 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1147044687 17:37744018-37744040 CGCCTCCCAGATCCCGGCTCCGG 0: 1
1: 1
2: 3
3: 17
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147044680 Original CRISPR TTGTTAGCCGCGCCCATGCA AGG (reversed) Intronic
1063633393 10:7756445-7756467 TGGTTAGCTGTGGCCATGCATGG + Intronic
1070984014 10:80672659-80672681 TTCTTAGGCTTGCCCATGCATGG + Intergenic
1072957322 10:99898900-99898922 ATGTTAGCCCCGGCCAGGCATGG + Intronic
1091106696 11:132926587-132926609 TTGTAAGCTGCCTCCATGCAAGG - Intronic
1121831246 14:97054205-97054227 TTGACAGCTGCGCCCATGCCAGG + Intergenic
1127683330 15:61318076-61318098 TGGTTAGCAGCGGCCAGGCACGG - Intergenic
1129362278 15:75031341-75031363 TTGGCAGCCTGGCCCATGCAGGG + Intronic
1135568790 16:23532323-23532345 TTGTTAACAGAGTCCATGCAAGG + Intronic
1139366342 16:66435933-66435955 TTCTTAGCCCCTCCCAAGCAGGG + Intronic
1142174997 16:88641033-88641055 TTGTTAGCCCCTCCCCTGCCTGG + Intergenic
1147044680 17:37743976-37743998 TTGTTAGCCGCGCCCATGCAAGG - Intronic
1147301256 17:39530149-39530171 GTGTTAGCCAAGTCCATGCAAGG + Intronic
1147718165 17:42521882-42521904 TTGTGGGCAGGGCCCATGCAAGG - Exonic
1164147281 19:22519752-22519774 TGGTCAGCCGCGGCCTTGCATGG - Intronic
1164159319 19:22616358-22616380 TGGTCAGCCGCGGCCTTGCATGG + Intergenic
928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG + Intronic
947212865 2:227723824-227723846 TTGTTGGCCTCACCAATGCAAGG + Intergenic
1169277465 20:4243459-4243481 TTGGCAGCCCCGCCCATGCCAGG - Intronic
1182781243 22:32869750-32869772 TTGATGGCCGAGCCCATGCCAGG + Intronic
980688872 4:136265189-136265211 TAGTTAGCCGCCACCATGCTCGG - Intergenic
1007301279 6:40869724-40869746 TTGAAAGCCTCGCCCAGGCATGG - Intergenic
1017042830 6:150321758-150321780 TTCTCAGCCCCTCCCATGCAGGG + Intergenic
1029953222 7:104608974-104608996 ATGTTAGCCACGGCCAGGCATGG + Intronic
1041251560 8:55939635-55939657 GGGTTGGCCGCACCCATGCAGGG + Intronic
1046374310 8:113356061-113356083 TTGTTACACCCTCCCATGCATGG + Intronic
1049320577 8:141994140-141994162 ATGTAAGCCCAGCCCATGCATGG - Intergenic
1059662325 9:116414449-116414471 TTGTTATCACCGCCCAAGCAAGG + Intergenic
1190076569 X:47321573-47321595 TTGTTAGCCACGCCCACCCCTGG + Intergenic