ID: 1147047093

View in Genome Browser
Species Human (GRCh38)
Location 17:37760885-37760907
Sequence CTTAATAGACAGTTGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147047093_1147047095 -3 Left 1147047093 17:37760885-37760907 CCCAGCTTCAACTGTCTATTAAG No data
Right 1147047095 17:37760905-37760927 AAGAGATTTTATATATATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147047093 Original CRISPR CTTAATAGACAGTTGAAGCT GGG (reversed) Intergenic
No off target data available for this crispr