ID: 1147051386

View in Genome Browser
Species Human (GRCh38)
Location 17:37797223-37797245
Sequence ATCCCAATGGAGCATATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147051386_1147051389 10 Left 1147051386 17:37797223-37797245 CCCATTATATGCTCCATTGGGAT No data
Right 1147051389 17:37797256-37797278 ACTTACAAAACACAAATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147051386 Original CRISPR ATCCCAATGGAGCATATAAT GGG (reversed) Intergenic
No off target data available for this crispr