ID: 1147051389

View in Genome Browser
Species Human (GRCh38)
Location 17:37797256-37797278
Sequence ACTTACAAAACACAAATTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147051386_1147051389 10 Left 1147051386 17:37797223-37797245 CCCATTATATGCTCCATTGGGAT No data
Right 1147051389 17:37797256-37797278 ACTTACAAAACACAAATTCAAGG No data
1147051387_1147051389 9 Left 1147051387 17:37797224-37797246 CCATTATATGCTCCATTGGGATG No data
Right 1147051389 17:37797256-37797278 ACTTACAAAACACAAATTCAAGG No data
1147051388_1147051389 -3 Left 1147051388 17:37797236-37797258 CCATTGGGATGTCAGATTTCACT No data
Right 1147051389 17:37797256-37797278 ACTTACAAAACACAAATTCAAGG No data
1147051385_1147051389 11 Left 1147051385 17:37797222-37797244 CCCCATTATATGCTCCATTGGGA No data
Right 1147051389 17:37797256-37797278 ACTTACAAAACACAAATTCAAGG No data
1147051382_1147051389 17 Left 1147051382 17:37797216-37797238 CCAAATCCCCATTATATGCTCCA No data
Right 1147051389 17:37797256-37797278 ACTTACAAAACACAAATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147051389 Original CRISPR ACTTACAAAACACAAATTCA AGG Intergenic
No off target data available for this crispr