ID: 1147053427

View in Genome Browser
Species Human (GRCh38)
Location 17:37815548-37815570
Sequence ATCTAGATCTTAAAGTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147053427_1147053432 13 Left 1147053427 17:37815548-37815570 CCAACTTACTTTAAGATCTAGAT No data
Right 1147053432 17:37815584-37815606 GTTCCATCAAGCCATTGCCAAGG No data
1147053427_1147053435 23 Left 1147053427 17:37815548-37815570 CCAACTTACTTTAAGATCTAGAT No data
Right 1147053435 17:37815594-37815616 GCCATTGCCAAGGAAAGCAAGGG No data
1147053427_1147053431 -9 Left 1147053427 17:37815548-37815570 CCAACTTACTTTAAGATCTAGAT No data
Right 1147053431 17:37815562-37815584 GATCTAGATGGCACAGGGCAAGG No data
1147053427_1147053434 22 Left 1147053427 17:37815548-37815570 CCAACTTACTTTAAGATCTAGAT No data
Right 1147053434 17:37815593-37815615 AGCCATTGCCAAGGAAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147053427 Original CRISPR ATCTAGATCTTAAAGTAAGT TGG (reversed) Intergenic
No off target data available for this crispr