ID: 1147053548

View in Genome Browser
Species Human (GRCh38)
Location 17:37816512-37816534
Sequence CTTTATCCCATCACGGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147053548_1147053550 27 Left 1147053548 17:37816512-37816534 CCTGAAACCGTGATGGGATAAAG No data
Right 1147053550 17:37816562-37816584 AATTATTTAAAAACTTTTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147053548 Original CRISPR CTTTATCCCATCACGGTTTC AGG (reversed) Intergenic
No off target data available for this crispr