ID: 1147060512

View in Genome Browser
Species Human (GRCh38)
Location 17:37873566-37873588
Sequence GACAAGTAACATTCTAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147060501_1147060512 24 Left 1147060501 17:37873519-37873541 CCAACAATAAAAACAGTATCTTG No data
Right 1147060512 17:37873566-37873588 GACAAGTAACATTCTAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147060512 Original CRISPR GACAAGTAACATTCTAATGT AGG Intergenic
No off target data available for this crispr