ID: 1147062713

View in Genome Browser
Species Human (GRCh38)
Location 17:37893923-37893945
Sequence TTTTTGAAGGGCATTGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147062713_1147062718 2 Left 1147062713 17:37893923-37893945 CCAACCACAATGCCCTTCAAAAA No data
Right 1147062718 17:37893948-37893970 GAGGTGAAATAGATACTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147062713 Original CRISPR TTTTTGAAGGGCATTGTGGT TGG (reversed) Intergenic
No off target data available for this crispr