ID: 1147066026

View in Genome Browser
Species Human (GRCh38)
Location 17:37923190-37923212
Sequence GGTGCCAATGGATGAATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147066018_1147066026 16 Left 1147066018 17:37923151-37923173 CCACTTGCTAGGGCTGTCATTGG No data
Right 1147066026 17:37923190-37923212 GGTGCCAATGGATGAATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147066026 Original CRISPR GGTGCCAATGGATGAATAGA TGG Intergenic
No off target data available for this crispr