ID: 1147066830

View in Genome Browser
Species Human (GRCh38)
Location 17:37927186-37927208
Sequence GCTCCCTTGACCCTGGCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 11, 1: 0, 2: 3, 3: 24, 4: 425}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147066816_1147066830 17 Left 1147066816 17:37927146-37927168 CCTGGTGCAGCCAGAGTACACCG 0: 11
1: 2
2: 4
3: 5
4: 60
Right 1147066830 17:37927186-37927208 GCTCCCTTGACCCTGGCGGGGGG 0: 11
1: 0
2: 3
3: 24
4: 425
1147066815_1147066830 18 Left 1147066815 17:37927145-37927167 CCCTGGTGCAGCCAGAGTACACC 0: 11
1: 2
2: 4
3: 8
4: 166
Right 1147066830 17:37927186-37927208 GCTCCCTTGACCCTGGCGGGGGG 0: 11
1: 0
2: 3
3: 24
4: 425
1147066814_1147066830 19 Left 1147066814 17:37927144-37927166 CCCCTGGTGCAGCCAGAGTACAC 0: 11
1: 4
2: 3
3: 11
4: 147
Right 1147066830 17:37927186-37927208 GCTCCCTTGACCCTGGCGGGGGG 0: 11
1: 0
2: 3
3: 24
4: 425
1147066824_1147066830 -3 Left 1147066824 17:37927166-37927188 CCGGGCAGGTCTCAGGGCAGGCT 0: 14
1: 2
2: 5
3: 39
4: 323
Right 1147066830 17:37927186-37927208 GCTCCCTTGACCCTGGCGGGGGG 0: 11
1: 0
2: 3
3: 24
4: 425
1147066820_1147066830 7 Left 1147066820 17:37927156-37927178 CCAGAGTACACCGGGCAGGTCTC 0: 14
1: 2
2: 1
3: 19
4: 84
Right 1147066830 17:37927186-37927208 GCTCCCTTGACCCTGGCGGGGGG 0: 11
1: 0
2: 3
3: 24
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147066830 Original CRISPR GCTCCCTTGACCCTGGCGGG GGG Intronic