ID: 1147067470

View in Genome Browser
Species Human (GRCh38)
Location 17:37930086-37930108
Sequence GATGAAGGAGTCGCCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 14, 1: 1, 2: 5, 3: 3, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147067465_1147067470 -4 Left 1147067465 17:37930067-37930089 CCACCCTGGAGACTTGGAGGATG 0: 17
1: 0
2: 4
3: 22
4: 214
Right 1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG 0: 14
1: 1
2: 5
3: 3
4: 100
1147067466_1147067470 -7 Left 1147067466 17:37930070-37930092 CCCTGGAGACTTGGAGGATGAAG 0: 18
1: 0
2: 5
3: 29
4: 280
Right 1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG 0: 14
1: 1
2: 5
3: 3
4: 100
1147067467_1147067470 -8 Left 1147067467 17:37930071-37930093 CCTGGAGACTTGGAGGATGAAGG 0: 18
1: 1
2: 2
3: 36
4: 298
Right 1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG 0: 14
1: 1
2: 5
3: 3
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147067470 Original CRISPR GATGAAGGAGTCGCCCCAGG AGG Intronic