ID: 1147068138

View in Genome Browser
Species Human (GRCh38)
Location 17:37933072-37933094
Sequence GATCCTCTGTTCTGGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 14, 1: 5, 2: 2, 3: 15, 4: 255}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147068131_1147068138 17 Left 1147068131 17:37933032-37933054 CCCGACTGGCCCGAGGGCAGCTT 0: 14
1: 6
2: 1
3: 6
4: 94
Right 1147068138 17:37933072-37933094 GATCCTCTGTTCTGGCCCAGAGG 0: 14
1: 5
2: 2
3: 15
4: 255
1147068130_1147068138 18 Left 1147068130 17:37933031-37933053 CCCCGACTGGCCCGAGGGCAGCT 0: 14
1: 2
2: 2
3: 9
4: 119
Right 1147068138 17:37933072-37933094 GATCCTCTGTTCTGGCCCAGAGG 0: 14
1: 5
2: 2
3: 15
4: 255
1147068134_1147068138 7 Left 1147068134 17:37933042-37933064 CCGAGGGCAGCTTCCTCACACTG 0: 20
1: 0
2: 2
3: 47
4: 349
Right 1147068138 17:37933072-37933094 GATCCTCTGTTCTGGCCCAGAGG 0: 14
1: 5
2: 2
3: 15
4: 255
1147068133_1147068138 8 Left 1147068133 17:37933041-37933063 CCCGAGGGCAGCTTCCTCACACT 0: 15
1: 7
2: 3
3: 24
4: 202
Right 1147068138 17:37933072-37933094 GATCCTCTGTTCTGGCCCAGAGG 0: 14
1: 5
2: 2
3: 15
4: 255
1147068127_1147068138 30 Left 1147068127 17:37933019-37933041 CCTGGGGTCAGACCCCGACTGGC 0: 14
1: 0
2: 2
3: 25
4: 112
Right 1147068138 17:37933072-37933094 GATCCTCTGTTCTGGCCCAGAGG 0: 14
1: 5
2: 2
3: 15
4: 255
1147068132_1147068138 16 Left 1147068132 17:37933033-37933055 CCGACTGGCCCGAGGGCAGCTTC 0: 14
1: 4
2: 3
3: 12
4: 122
Right 1147068138 17:37933072-37933094 GATCCTCTGTTCTGGCCCAGAGG 0: 14
1: 5
2: 2
3: 15
4: 255
1147068135_1147068138 -6 Left 1147068135 17:37933055-37933077 CCTCACACTGTCCTCATGATCCT 0: 15
1: 6
2: 6
3: 63
4: 768
Right 1147068138 17:37933072-37933094 GATCCTCTGTTCTGGCCCAGAGG 0: 14
1: 5
2: 2
3: 15
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147068138 Original CRISPR GATCCTCTGTTCTGGCCCAG AGG Intronic