ID: 1147068585

View in Genome Browser
Species Human (GRCh38)
Location 17:37934788-37934810
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 11, 1: 1, 2: 3, 3: 10, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147068577_1147068585 -7 Left 1147068577 17:37934772-37934794 CCCCGCCTCCCAACGGACCTGGA 0: 12
1: 3
2: 0
3: 5
4: 150
Right 1147068585 17:37934788-37934810 ACCTGGACGTAGAGGGCCCTTGG 0: 11
1: 1
2: 3
3: 10
4: 108
1147068572_1147068585 22 Left 1147068572 17:37934743-37934765 CCTGGAGATTCCTGCAGTGGAAC 0: 15
1: 0
2: 3
3: 12
4: 116
Right 1147068585 17:37934788-37934810 ACCTGGACGTAGAGGGCCCTTGG 0: 11
1: 1
2: 3
3: 10
4: 108
1147068573_1147068585 12 Left 1147068573 17:37934753-37934775 CCTGCAGTGGAACTCCATGCCCC 0: 14
1: 0
2: 6
3: 15
4: 156
Right 1147068585 17:37934788-37934810 ACCTGGACGTAGAGGGCCCTTGG 0: 11
1: 1
2: 3
3: 10
4: 108
1147068579_1147068585 -9 Left 1147068579 17:37934774-37934796 CCGCCTCCCAACGGACCTGGACG 0: 12
1: 2
2: 0
3: 5
4: 69
Right 1147068585 17:37934788-37934810 ACCTGGACGTAGAGGGCCCTTGG 0: 11
1: 1
2: 3
3: 10
4: 108
1147068575_1147068585 -2 Left 1147068575 17:37934767-37934789 CCATGCCCCGCCTCCCAACGGAC 0: 12
1: 2
2: 0
3: 16
4: 281
Right 1147068585 17:37934788-37934810 ACCTGGACGTAGAGGGCCCTTGG 0: 11
1: 1
2: 3
3: 10
4: 108
1147068578_1147068585 -8 Left 1147068578 17:37934773-37934795 CCCGCCTCCCAACGGACCTGGAC 0: 12
1: 2
2: 1
3: 10
4: 145
Right 1147068585 17:37934788-37934810 ACCTGGACGTAGAGGGCCCTTGG 0: 11
1: 1
2: 3
3: 10
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900201924 1:1411894-1411916 ACCGGGACCTAGACGGACCTGGG - Intergenic
901377086 1:8847280-8847302 ACCTGGAAGTATAGAGACCTAGG - Intergenic
905171406 1:36111931-36111953 ACCTGGAGGTACAGGGCACTTGG - Intronic
906003609 1:42448689-42448711 AGGTGGATGTAGATGGCCCTGGG + Intronic
907781850 1:57574155-57574177 ACATAGAAGTAGAGGTCCCTGGG + Intronic
908957895 1:69657487-69657509 ACCTGGATGAAGAGGATCCTTGG - Intronic
911861867 1:102961866-102961888 AACTGGACCTGGTGGGCCCTGGG + Exonic
917154733 1:171984340-171984362 GCCTGGATGTGGAGGGCCCGTGG - Intronic
923014927 1:230119484-230119506 ACCTGGAGGCACAGGGCACTGGG + Intronic
924707057 1:246510075-246510097 ACTTGGATGTGGGGGGCCCTTGG - Intergenic
1067184560 10:44015734-44015756 ACCTGGGCGTAGCTGGCTCTAGG + Intergenic
1068933335 10:62613312-62613334 ACCTGGCCTTAGAGGACCCAAGG + Intronic
1069495759 10:68901649-68901671 ACCTGGAGAAAGATGGCCCTGGG + Intronic
1069514868 10:69069590-69069612 AACTGGTCGTAGATGGCCCAGGG + Intergenic
1070596176 10:77834634-77834656 ACCTGGCTGTGGAGGGGCCTGGG + Intronic
1077102155 11:827211-827233 GACGGGACGTAGAGGGCACTGGG - Intronic
1081747151 11:45481389-45481411 CCCTGGAGGTAAAGGGCACTGGG - Intergenic
1082818940 11:57530521-57530543 ACCTGAACCTCCAGGGCCCTGGG + Intronic
1084174757 11:67417459-67417481 ACCTGGAGGAAGAGGGCCCCTGG + Exonic
1089539189 11:119179823-119179845 TCCTGGGCGTGGAGGGCCCCCGG + Exonic
1093643561 12:21555909-21555931 ACATGCACATAGATGGCCCTAGG - Intronic
1096154824 12:49336190-49336212 ACCTGGACCGGGAGGGCCCGGGG + Exonic
1096551097 12:52372077-52372099 AGCTGGATGGAGAGTGCCCTGGG - Intergenic
1096803368 12:54126271-54126293 AACTGGAGGGAGAGGTCCCTGGG - Intergenic
1097063413 12:56302413-56302435 ACCTGGACCTAGAGCTCACTTGG - Intronic
1097269784 12:57766900-57766922 AGCTGGGCGTAGAGGGGCCTGGG + Exonic
1100599769 12:96103232-96103254 AGCCGGAAGTAGAGGGCCCCTGG - Intergenic
1106146705 13:27055494-27055516 ACCTGGATAAAAAGGGCCCTTGG + Intergenic
1107842991 13:44479046-44479068 ACTTGGTCCTAGATGGCCCTAGG + Intronic
1108049772 13:46421589-46421611 ACCAGGACGTAAAGGGCCACAGG - Intronic
1108585705 13:51867851-51867873 ACCTGGACGGTGTGGGCCATTGG + Intergenic
1114611045 14:24040704-24040726 ACCTGGAAGTAGAGGGGCATGGG + Intergenic
1120043988 14:79785942-79785964 ACCTGGAGGTAAAGGGCACTTGG - Intronic
1121659800 14:95626215-95626237 GCCTGGATGCAAAGGGCCCTGGG - Intergenic
1122885404 14:104708311-104708333 ACCTGGACCTACTGGGCCCCAGG + Intronic
1123171228 14:106374341-106374363 ACCTGGAAGAAGAGGACTCTGGG - Intergenic
1123176342 14:106422394-106422416 ACCTGGAAGAAGAGGACTCTGGG - Intergenic
1123942208 15:25222027-25222049 ACATGGACGCAGAGCACCCTTGG - Intergenic
1131019933 15:89088931-89088953 ACCTGGAAGGAGAGGGCCGAGGG + Intronic
1131998665 15:98158217-98158239 ACCTGGAGGTAGAGGGGCTCAGG + Intergenic
1132176530 15:99720324-99720346 ACCTGGCCATAGAGAGCCTTTGG - Intronic
1132765657 16:1533103-1533125 ACCTGTACTTGGAGGGCCTTGGG - Intronic
1135227355 16:20673228-20673250 CCCTGGACTGAGAGGGCCTTGGG + Intronic
1135417994 16:22283744-22283766 ACCTGGAGGGAGAGGGCACACGG + Intronic
1138333233 16:56231845-56231867 ACCTGGCAGGATAGGGCCCTTGG + Intronic
1139949762 16:70663196-70663218 TCCTGGAGGGAGAGGGGCCTGGG + Exonic
1143206014 17:5139555-5139577 ACCTGGATATAGGGGGCCCTTGG + Exonic
1145761906 17:27430078-27430100 ACCTGGATGTGGGGGGCCCTTGG + Intergenic
1146842591 17:36166241-36166263 ACCTGGACGTAGAGGGGCCTTGG - Exonic
1146854904 17:36254200-36254222 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146865716 17:36334176-36334198 ACCTGGACGTAGAGGGCCCTTGG + Exonic
1146870804 17:36378092-36378114 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146878163 17:36429174-36429196 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146882112 17:36450320-36450342 ACCTGGACGTAGAGGGCCCTTGG - Intergenic
1147068585 17:37934788-37934810 ACCTGGACGTAGAGGGCCCTTGG + Exonic
1147073688 17:37978716-37978738 ACCTGGACGTAGAGGGCCCTTGG - Intronic
1147080108 17:38014325-38014347 ACCTGGACGTAGAGGGCCCTTGG + Intronic
1147085209 17:38058254-38058276 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1147096057 17:38138285-38138307 ACCTGGACGTAGAGGGCCCTTGG + Intergenic
1147101156 17:38182220-38182242 ACCTGGACGTAGAGGGCCCTTGG - Intergenic
1147882874 17:43665321-43665343 CCCTGGACGGGGTGGGCCCTGGG + Intergenic
1149845753 17:60008726-60008748 ACCTGGACGTAGGGGACCCTTGG - Intergenic
1150084101 17:62265306-62265328 ACCTGGACGTAGGGGACCCTTGG - Intergenic
1152525227 17:80884622-80884644 TCCTGGACGCAGAGGGGCATGGG - Intronic
1152928716 17:83099496-83099518 ACCTGGGGGTAGGGGGCACTGGG - Intergenic
1158267683 18:55678092-55678114 CCCTGGATGTAGAGGGTGCTGGG + Intergenic
1160072730 18:75642762-75642784 ACTTGGAAGCAGAGGGCCCCTGG - Intergenic
1162567472 19:11452135-11452157 ACCTGGACGTCGCTGGCCGTGGG + Exonic
1162768283 19:12933472-12933494 GCTTGGACGTAGAGCGCCCGTGG + Intronic
1164632894 19:29773301-29773323 ACCTGGCACTGGAGGGCCCTGGG + Intergenic
1164694453 19:30233045-30233067 CCCTGGACTTACAGGGCACTGGG - Intronic
1166544427 19:43625720-43625742 ACCTGGACGAATAGGGATCTGGG - Intronic
1167147945 19:47694141-47694163 ACGGGGACGAAGAGGGGCCTGGG - Exonic
1167307748 19:48719051-48719073 ACCTGGACGGAGAGGGGGCAGGG + Exonic
1168501999 19:56900627-56900649 ACCTGGCCGTGGAAGGCCCCTGG + Intergenic
925390693 2:3491947-3491969 ACCTGGCCAGCGAGGGCCCTAGG - Intergenic
925429452 2:3778487-3778509 ACCAGGGAGCAGAGGGCCCTGGG + Intronic
928231069 2:29499496-29499518 ACCTGAACGTAGAAGACCCTAGG - Intronic
929511330 2:42568387-42568409 TGCTGGAAGTGGAGGGCCCTGGG - Intronic
932943217 2:76194518-76194540 ATATGGACTTGGAGGGCCCTCGG - Intergenic
935215160 2:100970197-100970219 CCCTGGGGGTAGGGGGCCCTTGG - Intronic
946199607 2:218064231-218064253 GCCTGGAAGCAGAGGGCCCCAGG + Intronic
946399423 2:219460804-219460826 CCCTGCACGGAGAAGGCCCTGGG - Intronic
949035692 2:241814844-241814866 ACCAGGACGTCCAGGGACCTGGG - Intronic
1168879368 20:1193786-1193808 ACCTGGAAGTCAGGGGCCCTTGG - Intergenic
1170044090 20:12066948-12066970 ATCTGGAAGTAGAGGGCTATTGG - Intergenic
1172132335 20:32664176-32664198 ACCTGGGAGGTGAGGGCCCTGGG + Intergenic
1172977988 20:38920613-38920635 ACCAGAAAGTAGAGGGCCCATGG + Exonic
1173841122 20:46157937-46157959 ACCTGGACCCAGCGGCCCCTGGG + Intergenic
1177397957 21:20562107-20562129 ACCTGAGGGCAGAGGGCCCTGGG - Intergenic
1179665459 21:42909009-42909031 ACCTCGACACTGAGGGCCCTCGG + Exonic
1180180995 21:46118628-46118650 CCCAGGACGCAGAGGGCCCCCGG + Exonic
1182023215 22:27098327-27098349 TCCTGGAGGCAGAGGGCCCGTGG + Intergenic
1183603194 22:38851924-38851946 GCCTGGCTGTACAGGGCCCTGGG - Intergenic
949368640 3:3310453-3310475 AGCTGGAGGCAGAGGGACCTCGG - Intergenic
950686091 3:14619592-14619614 ACTGGGACCTAGAAGGCCCTTGG - Intergenic
951844183 3:27067893-27067915 ACCTGGACCTAGAGGCCACAGGG - Intergenic
954383126 3:50230142-50230164 TCCTGGACGAAGAGAGGCCTGGG + Intronic
957136735 3:76298015-76298037 AGCTGGACTTAGAGATCCCTAGG + Intronic
969373229 4:6747223-6747245 ACCTGGACGCTGAGGGCCCTTGG - Intergenic
969461930 4:7333580-7333602 AGGTGGACGACGAGGGCCCTGGG - Intronic
980848102 4:138348430-138348452 ACAGGGAGGTAGAGTGCCCTTGG + Intergenic
990950048 5:61289673-61289695 ACCTGGAAGTAGGGGGCACCAGG + Intergenic
993667344 5:90716547-90716569 TCCTGGACGTAGAGAGCTGTTGG - Exonic
995853779 5:116573264-116573286 ACCTGGCAGAAGATGGCCCTGGG - Intronic
997829814 5:137140144-137140166 ACATGGAAGCAGAGAGCCCTTGG + Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006369588 6:33635738-33635760 TCCTGGAGGTAGAGGGTTCTGGG + Intronic
1011745415 6:90403313-90403335 ACCTGGACATGGAGGGGCATTGG - Intergenic
1012639072 6:101586491-101586513 ACCTGGAAGTAGAGACCCATAGG + Intronic
1015742580 6:136472913-136472935 ACCTGGATTTAGTGGGCACTTGG - Intronic
1018740971 6:166728351-166728373 ACCTGGACGCAGGGGTCCCCCGG + Intronic
1019326646 7:441734-441756 ACCTGGAGTCTGAGGGCCCTGGG - Intergenic
1023822798 7:43989251-43989273 TCCTGCACGCAGAGTGCCCTGGG - Intergenic
1023880799 7:44320230-44320252 ACCTAGAGGTAGGGGGCCCTTGG + Intronic
1029769015 7:102641777-102641799 TCCTGCACGCAGAGTGCCCTGGG - Intronic
1030707020 7:112703368-112703390 ACCATGACGTAGAGAACCCTGGG + Intergenic
1036453745 8:8891557-8891579 ACCAGCACGTATAGGGCCCCTGG + Exonic
1049223901 8:141440639-141440661 ACCTGGGGGTAGAGCGCCCATGG + Intergenic
1049249282 8:141579606-141579628 ACCTGGCACTAGTGGGCCCTCGG - Intergenic
1049622153 8:143603381-143603403 ACCTGGAAGTAGAAGGCACAGGG + Intergenic
1051809847 9:21036584-21036606 ACCTGTACATATAGGCCCCTGGG + Intergenic
1052930025 9:34048645-34048667 GCCTGGACGTAGAGGGACCGTGG + Intronic
1057261874 9:93589078-93589100 CCCTGGACCTTGAGGGTCCTGGG - Intronic
1057919889 9:99088309-99088331 AACTGGACTGAGAGAGCCCTCGG + Intergenic
1061514136 9:131078908-131078930 CCCTGGAGGCAGAGGGCCCAGGG - Intronic
1061678444 9:132231102-132231124 ACCTGGACGAGCAGAGCCCTGGG - Intronic
1062359510 9:136180881-136180903 TCCTGGGCGGAGAGGGGCCTGGG + Intergenic
1062640188 9:137514838-137514860 ACCTGGATGTTGAGGTGCCTGGG + Intronic
1062733688 9:138122775-138122797 AGGTGGACGTAGACGGCCCCTGG + Exonic
1198274463 X:135088055-135088077 ATCTGGACTCAGAAGGCCCTGGG + Intergenic
1198534550 X:137573955-137573977 ACCTCCACCTACAGGGCCCTTGG + Intronic
1200126501 X:153817530-153817552 ACCTGGAGGAAGGGGGGCCTGGG + Intronic